ID: 1092804482

View in Genome Browser
Species Human (GRCh38)
Location 12:12207133-12207155
Sequence AAGGTAGCTACCACTCTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092804482_1092804485 -8 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804485 12:12207148-12207170 GCTACCTTTCCCTGCAAGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 158
1092804482_1092804489 7 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804489 12:12207163-12207185 AAGAGGGGACTGACCTTATTTGG 0: 1
1: 0
2: 1
3: 5
4: 108
1092804482_1092804491 19 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804491 12:12207175-12207197 ACCTTATTTGGAACGAGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 88
1092804482_1092804484 -9 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804484 12:12207147-12207169 AGCTACCTTTCCCTGCAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 148
1092804482_1092804490 14 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804490 12:12207170-12207192 GACTGACCTTATTTGGAACGAGG 0: 1
1: 0
2: 1
3: 21
4: 215
1092804482_1092804483 -10 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804483 12:12207146-12207168 TAGCTACCTTTCCCTGCAAGAGG 0: 1
1: 0
2: 1
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092804482 Original CRISPR AAGGTAGCTACCACTCTTTA TGG (reversed) Intronic