ID: 1092804482

View in Genome Browser
Species Human (GRCh38)
Location 12:12207133-12207155
Sequence AAGGTAGCTACCACTCTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092804482_1092804490 14 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804490 12:12207170-12207192 GACTGACCTTATTTGGAACGAGG 0: 1
1: 0
2: 1
3: 21
4: 215
1092804482_1092804484 -9 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804484 12:12207147-12207169 AGCTACCTTTCCCTGCAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 148
1092804482_1092804485 -8 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804485 12:12207148-12207170 GCTACCTTTCCCTGCAAGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 158
1092804482_1092804489 7 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804489 12:12207163-12207185 AAGAGGGGACTGACCTTATTTGG 0: 1
1: 0
2: 1
3: 5
4: 108
1092804482_1092804491 19 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804491 12:12207175-12207197 ACCTTATTTGGAACGAGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 88
1092804482_1092804483 -10 Left 1092804482 12:12207133-12207155 CCATAAAGAGTGGTAGCTACCTT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1092804483 12:12207146-12207168 TAGCTACCTTTCCCTGCAAGAGG 0: 1
1: 0
2: 1
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092804482 Original CRISPR AAGGTAGCTACCACTCTTTA TGG (reversed) Intronic
908424398 1:63991793-63991815 AAGGTAGCTATTAACCTTTAAGG + Intronic
908475109 1:64479658-64479680 AAGGAAGCTACCACCCTATGCGG + Intronic
916396065 1:164388858-164388880 AAGGCAGATACCACACTTTCAGG + Intergenic
918301530 1:183208415-183208437 AAGGAAGCTTGCACTCTTTCAGG + Intronic
921816336 1:219568361-219568383 AAGGAAGCAACAACTCTTTGAGG + Intergenic
922136349 1:222830952-222830974 AATTTAGATACCATTCTTTAAGG - Intergenic
922250102 1:223841340-223841362 AAGATAGGAACCTCTCTTTAGGG + Intronic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1063834904 10:10001619-10001641 AAGGTTGCTCACACTCTTTGTGG - Intergenic
1064321480 10:14309609-14309631 GAGGTAGCCACCAGTCATTAAGG + Intronic
1065861229 10:29873759-29873781 CAGATAGCTACCACTCTCCAGGG - Intergenic
1075132649 10:119753648-119753670 AAGGCAGCTACCAGTGTTCAAGG + Intronic
1078603311 11:12752436-12752458 AGGGTAGCAACCACCCTTTAGGG - Intronic
1087091786 11:94281189-94281211 AAGGTAGCTATCACATTTCATGG - Intergenic
1087231926 11:95675844-95675866 ACGGTAGCAACCACACATTAGGG - Intergenic
1087626274 11:100600350-100600372 AAGTTAGCTACCACATTTTCAGG + Intergenic
1090158313 11:124464961-124464983 AATGTACCTACCACTCTGTTAGG + Intergenic
1090230600 11:125100455-125100477 AAAATAGCTAACATTCTTTAAGG - Intronic
1092804482 12:12207133-12207155 AAGGTAGCTACCACTCTTTATGG - Intronic
1093962269 12:25287274-25287296 AAGGTGGTTACCACTTTTTCTGG - Intergenic
1096789883 12:54038087-54038109 AAGGCAGCTCCCACTTATTAGGG + Intronic
1104161108 12:126181869-126181891 AAGATAACTAGCACTCCTTATGG - Intergenic
1111872413 13:93849390-93849412 AAAGAAGCTACCACTCTGTTGGG - Intronic
1112925942 13:104675692-104675714 TAAGAAGCTACCACTCTTTAAGG - Intergenic
1116837373 14:49783182-49783204 AATGTAGCAACCATTCTTCAGGG - Exonic
1119996214 14:79256564-79256586 AAGGCAGCTTTCACTCTTTAGGG + Intronic
1127611690 15:60643445-60643467 AAGGAGGCTACCACTCTTCTTGG + Intronic
1139358632 16:66382587-66382609 AAGGTAGCCCCCACTTTCTACGG - Intronic
1140708391 16:77652957-77652979 AACGTAGCTACCATTTTTTGAGG - Intergenic
1144848936 17:18234387-18234409 ACGGTAGCCACCACACCTTACGG + Exonic
1146465796 17:33085241-33085263 AACGTAGCTGCCACATTTTATGG + Intronic
1147805155 17:43126031-43126053 AAGATACGTACAACTCTTTAGGG + Intergenic
1155277669 18:24204644-24204666 AAGATAGCTAGGTCTCTTTAAGG + Intronic
1156100559 18:33589228-33589250 AATATTGCAACCACTCTTTACGG - Intronic
1158584782 18:58722274-58722296 AAGCTAGCTGCTACTTTTTAAGG + Intronic
1168417850 19:56180602-56180624 AAGGTAGCCAGCACTATTGAGGG - Exonic
925622624 2:5808534-5808556 AAGGTAGCCATCATTCTTTCTGG - Intergenic
938870704 2:135473166-135473188 AAGGTGGCTACCAGAGTTTATGG - Intronic
939067133 2:137497124-137497146 AAAGTAACTACCAATCTTTCTGG - Intronic
939472927 2:142647775-142647797 AAGGTAGCTACCACACTTCTAGG + Intergenic
939921338 2:148118072-148118094 ATGGTGGCGACCATTCTTTAAGG - Intronic
945848532 2:214977851-214977873 AAAGGAGCTGCCGCTCTTTATGG - Intronic
946603982 2:221382399-221382421 AAGACACCTACCACTGTTTAAGG - Intergenic
947082197 2:226411120-226411142 AAGGTAGATCGCACTCCTTAGGG - Intergenic
1171955960 20:31463974-31463996 AAGGTAACTAAGACTCTATAAGG - Intergenic
1172283840 20:33727094-33727116 AAAGTAGCTTCCCCTCTTTCTGG + Intergenic
1179302927 21:40128616-40128638 AAGGAAGCTACCATGCTGTAGGG + Intronic
949558985 3:5185725-5185747 AAGGGAGTTACTACACTTTAGGG - Intergenic
949839883 3:8308101-8308123 ATGGTATCTGTCACTCTTTATGG + Intergenic
952650373 3:35719549-35719571 AAGGTGGCCACCACTATTTCTGG - Intronic
955082894 3:55674195-55674217 AAGGTAGCTAAGACTGTTTTTGG - Intronic
955857350 3:63287382-63287404 AATGTAGATACCACTGTCTAGGG + Intronic
960362042 3:116724662-116724684 AAGATTGCTAGCAATCTTTAGGG + Intronic
963093257 3:141507047-141507069 AAGGTAGATACAACTATATATGG + Intronic
963363336 3:144304058-144304080 AAAGTTGCTTCCACTCTTTTGGG + Intergenic
970993658 4:22240125-22240147 AAGGGAGAAACCATTCTTTATGG - Intergenic
978090063 4:104704279-104704301 AATGTAGCTACCCATGTTTATGG - Intergenic
982625321 4:157759394-157759416 AAGTTAGAAAACACTCTTTAGGG - Intergenic
987680671 5:21132725-21132747 AAAGTTGCTACCACTTTTTCAGG - Intergenic
988509171 5:31851547-31851569 AAAGTAGCTTCCACACATTAAGG - Intronic
990232869 5:53734029-53734051 ATGGTAGCTACCAGTCCTCATGG - Intergenic
991179740 5:63736075-63736097 AAGGTAGGTAGCAGCCTTTATGG + Intergenic
993418726 5:87672256-87672278 AAGGTAGCTCCCTCACTTGATGG + Intergenic
995445183 5:112235037-112235059 AAGGTTGCTGACAGTCTTTAAGG + Intronic
998735542 5:145135515-145135537 AAGTTAGCTGCCACATTTTAAGG + Intergenic
1002583111 5:180222465-180222487 GAGGTAGCTACCACCCTCTAGGG - Intergenic
1008758504 6:54825954-54825976 AAGGCTGCTCCCACCCTTTAAGG - Intergenic
1016331073 6:142952440-142952462 AAGCTAGCTGTCACTCTGTAAGG - Intergenic
1020791992 7:12638536-12638558 AAGGGAGCTAAGACTCTATATGG + Intronic
1024084081 7:45879311-45879333 AAAGTAGCTTCCACATTTTAAGG + Intergenic
1030955724 7:115849525-115849547 AAGGAAGATACCTCTCTTTGGGG - Intergenic
1035887866 8:3311047-3311069 AAGGTATTTCCCACTCTTAATGG - Intronic
1037326809 8:17700158-17700180 AAGTTAGCTATGAGTCTTTATGG + Intronic
1043230201 8:77790585-77790607 AATGCAGGTACCACTCTTTAAGG - Intergenic
1044896510 8:96898343-96898365 ATATTAGCTACCACTCTTTGAGG + Intronic
1045557836 8:103231922-103231944 ATGGTCGCTACCACTCATTGTGG + Intergenic
1051931600 9:22392932-22392954 AATGTAGCTTCCACTCTGAAAGG + Intergenic
1057061901 9:92011196-92011218 AAAGTAACTTCCACTCCTTAAGG + Intergenic
1058287300 9:103194390-103194412 ATGGTAGAAATCACTCTTTATGG - Intergenic
1186203157 X:7174517-7174539 AACCTCACTACCACTCTTTAGGG - Intergenic
1186334858 X:8575257-8575279 AAGGTAGTTACCAACCTTTCTGG + Intronic
1186520600 X:10203331-10203353 AAGCTAACTACCACTAGTTAAGG + Intronic
1189908474 X:45785651-45785673 AAGCTACTTACCACTCTTTTTGG + Intergenic
1190125020 X:47697078-47697100 AAGGTAGCTATACCTATTTATGG - Intergenic
1195597150 X:106704946-106704968 AAGGGAGCAGCCACTCTTGAAGG + Intronic
1196678237 X:118443172-118443194 AAGGTAGCTAACCCTATTTCAGG - Intronic
1199938692 X:152602620-152602642 AAGGTAGCAATCAGTCTCTAGGG + Intergenic