ID: 1092804977

View in Genome Browser
Species Human (GRCh38)
Location 12:12213024-12213046
Sequence CAGCTTCTTTAGAGGACTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092804977 Original CRISPR CAGCTTCTTTAGAGGACTAA TGG Intronic
901689947 1:10966245-10966267 CAGTTTCTGCAGAGGAATAATGG + Intronic
902732656 1:18379657-18379679 CAGCTTCTGGGGAGGACTCAGGG - Intergenic
906776596 1:48535264-48535286 CAGCCTCTGCAGAGGCCTAAAGG - Intronic
907157044 1:52344101-52344123 CAAGTCCGTTAGAGGACTAAAGG - Intronic
908460359 1:64342914-64342936 GAATTTCATTAGAGGACTAAAGG - Intergenic
913534215 1:119755669-119755691 CAGCTTCTGGAGAGGACTTTGGG + Intronic
916405021 1:164489575-164489597 CAGCTTCTTTATGGGACAAACGG - Intergenic
919580244 1:199363289-199363311 CAGCTTCTGTAAAGGCCTCAGGG - Intergenic
920890874 1:209984773-209984795 CAGCTTCTGGAGAGGGCTCAGGG + Intronic
921029636 1:211326368-211326390 CAGCTTGTTTTGAGGACCACAGG + Intergenic
921329928 1:214025344-214025366 CAGCTTTTCTAGAGGCCTAATGG - Intronic
922130900 1:222776685-222776707 AAGCTTTTATAGAAGACTAAAGG + Intergenic
922747331 1:228051781-228051803 CAGCTTCTTGGGAGGCCTCAGGG + Intronic
922794196 1:228331634-228331656 GAGATTCCTTAAAGGACTAAAGG - Intronic
1063604706 10:7512544-7512566 CAGCTTCCTCAGAGGGATAAGGG + Intergenic
1064031474 10:11885812-11885834 CAGCTTCTCCAGAGGAACAAGGG + Intergenic
1065435201 10:25698494-25698516 CAGCTTCTGGAGAGGTCTCAGGG - Intergenic
1068712339 10:60148606-60148628 GATCTTACTTAGAGGACTAAAGG - Intronic
1071364894 10:84889425-84889447 CAGCGTCTGCAGAGGATTAAAGG + Intergenic
1074927299 10:118086208-118086230 CAGCTTCTACAGAGGCCTCAGGG + Intergenic
1078017560 11:7628152-7628174 CGGCCTCTTTAAAGAACTAAAGG + Intronic
1078199651 11:9169057-9169079 CTTCTTCTTTAAAAGACTAAAGG - Intronic
1079807140 11:24946676-24946698 CAGCTTCATTAGAAGACAAAAGG - Intronic
1080508111 11:32938220-32938242 CAGGTTTTTGAGAGGACTCAGGG + Intronic
1082127020 11:48445399-48445421 CAGCTAATTTAGAAGACTATGGG - Intergenic
1085039251 11:73317364-73317386 CTGCTTCTTTATTGGACTATTGG - Intronic
1085358890 11:75867041-75867063 CAACCTCTTTAAAGGACTTAAGG - Intronic
1087220922 11:95545464-95545486 CAGATTTTTTTTAGGACTAATGG - Intergenic
1087397462 11:97619089-97619111 CAGCTTCTGTGGAGGCCTCAAGG - Intergenic
1088460399 11:110076375-110076397 CAGCTTCTGGGGAGGCCTAAGGG + Intergenic
1088528917 11:110786796-110786818 CAGCTTCTGGAGAGGCCTAAGGG - Intergenic
1088766790 11:112989866-112989888 CTGCATCTTTAGAGGAATTAAGG - Intronic
1090521363 11:127483031-127483053 CAGCTTCTGGGGAGGACTCAAGG + Intergenic
1091632002 12:2169103-2169125 CAGCTACTTTCAAGCACTAAAGG - Intronic
1092026903 12:5248313-5248335 AAGCTTCTTTGGAGGAATAATGG + Intergenic
1092804977 12:12213024-12213046 CAGCTTCTTTAGAGGACTAATGG + Intronic
1092833445 12:12466357-12466379 CAGCTTCTGATGACGACTAAGGG - Exonic
1095877367 12:47096369-47096391 CAGCTTTATTTTAGGACTAAAGG + Intronic
1097499773 12:60388027-60388049 GAGCTCCTTCAGAGGCCTAAGGG + Intergenic
1100301165 12:93309346-93309368 CAACAAATTTAGAGGACTAAAGG + Intergenic
1103191020 12:119002181-119002203 CAGCATCTAATGAGGACTAATGG - Intronic
1104206149 12:126640774-126640796 CAGTTTCTTTATAGCACCAATGG + Intergenic
1106058528 13:26263020-26263042 TAGGTTGTTTAGAGGACTAAAGG + Intronic
1108791799 13:53978225-53978247 CAGGTTCCTTAAAGAACTAAAGG + Intergenic
1111494713 13:89033333-89033355 CAGCTTCTTGGGAGGCCTCAGGG - Intergenic
1116082799 14:40197840-40197862 CAGATGTTTTAGAGAACTAAAGG - Intergenic
1116267411 14:42711414-42711436 CAGCTTCTGGGGAGGCCTAAGGG - Intergenic
1117287075 14:54296305-54296327 CAGCTTCTTCAGAGGAGCTATGG + Intergenic
1117492114 14:56259045-56259067 CAACATCTTTAAAGTACTAAAGG + Intronic
1118097208 14:62550458-62550480 CAGCTTCTGTGGAGAACTCAGGG - Intergenic
1122174863 14:99909338-99909360 CAGCTTCATTAGAGCACTATAGG - Exonic
1125361777 15:38872201-38872223 CAGCGTCTTTGGAGTCCTAAAGG + Intergenic
1125437546 15:39663519-39663541 CAGCTACCATAGAGGTCTAAGGG - Intronic
1126316641 15:47377018-47377040 CAGCTTCTTTAGAAGTCAAGGGG - Intronic
1126352360 15:47757701-47757723 TAGTTACTTTAGAGCACTAAAGG - Intronic
1126361249 15:47848157-47848179 TTGCTTTTTTAAAGGACTAAGGG - Intergenic
1127303467 15:57680073-57680095 AAGCTTGTTGAGAGGATTAAGGG + Intronic
1129032647 15:72629836-72629858 GAGGTTCTTCAGAGGACCAATGG + Intergenic
1129470598 15:75751448-75751470 GAGGCTCTTTAGAGGACCAATGG + Intergenic
1131406046 15:92165750-92165772 ATGCTTCTTTAGAGCACAAAAGG - Exonic
1131771773 15:95745670-95745692 CAGCTTCTGTAGAGGCCTCAGGG + Intergenic
1137333668 16:47526906-47526928 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG + Intronic
1143154465 17:4827454-4827476 TAGCTTCTTGTGAGGACTGAGGG - Intergenic
1143893445 17:10119377-10119399 CAGCTTCATGAGAGCACTGAGGG - Intronic
1145983959 17:29031884-29031906 CAGCTTCTTAAGAAGAGAAAGGG - Intronic
1146569812 17:33942503-33942525 CAGCTTCTGTAAAGGAGAAAAGG - Intronic
1147542309 17:41370561-41370583 CAGCATTTTGAGAGGACTGAAGG - Intronic
1151925876 17:77196042-77196064 CAGATTCCTTAGAGGACTTGAGG - Intronic
1153355595 18:4131606-4131628 CTCCTGCTTTAGAGGACTAGAGG + Intronic
1155170573 18:23264238-23264260 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
1156264340 18:35472669-35472691 CTGCTTCTTTGGAGGACAATTGG - Intronic
1156723629 18:40100882-40100904 CATCTTCTTAAGAGGATGAAAGG - Intergenic
1158102486 18:53845187-53845209 CTGCTTATTTAGTAGACTAAAGG + Intergenic
1158118064 18:54018759-54018781 CAGTTTCCTTAGAGGACACAAGG - Intergenic
1164564606 19:29316865-29316887 CGACTTCTTCAGAGGTCTAAAGG + Intergenic
1167237263 19:48322414-48322436 CACTTTCTTGAGAGGACTAGGGG - Intronic
926849146 2:17175557-17175579 CAGCTTCTGGAGAGGCCTCAAGG + Intergenic
927585505 2:24300152-24300174 CAGTTACTTTTGAGGACAAACGG - Exonic
928571617 2:32615019-32615041 CTGCTTCTGTAGAGGCCTCAAGG + Intronic
929393787 2:41499321-41499343 CAGTCTCTGTAGAGGAGTAATGG - Intergenic
930382594 2:50650410-50650432 CAGCTTCTTATGAGGATTCAGGG - Intronic
930441433 2:51412421-51412443 CAGCTTCATTAGCTGATTAAAGG + Intergenic
930721507 2:54642357-54642379 AAGGTTCTTTAGAGAACTAGAGG + Intronic
930822451 2:55660644-55660666 AAACTCCTTCAGAGGACTAAAGG + Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931527993 2:63179309-63179331 CAGCTTCTGGGGAGGACTCAGGG + Intronic
932155774 2:69415819-69415841 AAGCTTCTTAAGAGGTGTAAGGG - Intronic
932571490 2:72940725-72940747 CAGCAGCTTTAGGGGACTGAGGG + Intergenic
938097337 2:128472215-128472237 CAGCTTGCTTAGAGAAGTAAGGG + Intergenic
939093804 2:137809401-137809423 CAGTTGCTTTTGAGGACTGATGG + Intergenic
939354258 2:141080944-141080966 TAGCTACCTGAGAGGACTAAGGG - Intronic
941668850 2:168269111-168269133 CAGATTTTGGAGAGGACTAAAGG - Intergenic
941919314 2:170833321-170833343 CAGCTTCATTAAATGACTGATGG + Intronic
942394274 2:175530113-175530135 CAACTTCATTTGAGAACTAAAGG + Intergenic
944205037 2:197149614-197149636 CTGCTGCTTTGGAGAACTAAAGG - Intronic
945538662 2:211054474-211054496 CAGATTCTTTAGAGTAAGAAAGG - Intergenic
945639962 2:212412506-212412528 CAGCTTCTGGAGAGGCCTCAGGG - Intronic
946854138 2:223936183-223936205 CAGCTTCTTGGGAGGATTACAGG + Intronic
947800264 2:232925196-232925218 CAGCTTCCTAAGATGATTAATGG - Intronic
948102444 2:235385491-235385513 CAGCTTCTCAAATGGACTAAGGG + Intergenic
1169138189 20:3210281-3210303 CAGCTTCTTGAGAGAACTTCAGG - Intronic
1169376962 20:5073936-5073958 CAGCTTCTGGTGAGGACTCAGGG + Intronic
1169621269 20:7509068-7509090 CAGCTTCTGTGGAGGCCTCATGG + Intergenic
1170320124 20:15086843-15086865 CAGGATATTGAGAGGACTAAAGG + Intronic
1174546997 20:51333102-51333124 CAGGTGATTTAGAGGATTAAAGG + Intergenic
1175767413 20:61601132-61601154 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
1177537624 21:22448929-22448951 CTGCTGCTTGAGAGGACTATAGG + Intergenic
1181981256 22:26768477-26768499 CAGCTTCATTAGGGGACCGATGG + Intergenic
949267426 3:2174771-2174793 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
950140161 3:10609748-10609770 CAGCATCTTTAGATGGCTCAGGG + Intronic
950143970 3:10634771-10634793 GAGCTCCTTTAGGGGAGTAAAGG - Intronic
951346003 3:21547492-21547514 GAGCTTCCCTAGAGGCCTAAGGG - Intronic
951576028 3:24114995-24115017 CAGCCTCTTTCTAGGACTTAGGG + Intergenic
953535825 3:43776009-43776031 CTGCTTCCTGAGAGGACTCAGGG + Intergenic
960084441 3:113575505-113575527 TAGCTTCTTTAGGCGACTTAAGG + Intronic
964017777 3:151968326-151968348 CAGATTCCTTAAAGAACTAAAGG + Intergenic
967718971 3:192795038-192795060 CAGCCTCATTAGAGAACTGAAGG + Intergenic
967817753 3:193813539-193813561 CAGAGTCTATAGAGGAATAAAGG + Intergenic
968158192 3:196400827-196400849 CAGCGTCTTTGTAGGACTATAGG - Intronic
968352911 3:198076599-198076621 CAGCTTGTTTAGTGCACTTATGG - Intergenic
969951655 4:10843223-10843245 CAGCTTCTTTGGAGGCCTCAAGG + Intergenic
971058268 4:22937866-22937888 GAGTTTGTTTAGAGCACTAATGG + Intergenic
971097178 4:23420381-23420403 CAGCTTCTTTTCAGGATTGAGGG + Intergenic
971314354 4:25554807-25554829 CAGTTTCTGTAGAGGACTGGAGG + Intergenic
971673998 4:29600637-29600659 CAGCCTCATTTGAGGAATAAAGG + Intergenic
971931379 4:33088359-33088381 CACCTACTTTAGGGGACTATTGG - Intergenic
972260614 4:37404738-37404760 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
973168623 4:47110901-47110923 CAGCTTCTTCAGAGAAATATAGG - Intronic
975841308 4:78477307-78477329 ACGCTTCTTGGGAGGACTAAAGG - Intronic
976282824 4:83342043-83342065 CAGCTTCTGGGGAGGACTCAGGG + Intergenic
977612678 4:99052431-99052453 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
978034166 4:103974033-103974055 CAGATCCTTAAGAGGACTATGGG - Intergenic
982818346 4:159915246-159915268 CAGTTTCTTTGAAGGAATAAAGG - Intergenic
984031634 4:174611633-174611655 CAGCTTCTAATGAGGACCAAAGG - Intergenic
986988783 5:13527752-13527774 CAGCTTCTGGGGAGGACTGAGGG - Intergenic
989443204 5:41496293-41496315 AAGCTTATTTAAAGGAATAATGG + Intronic
991333529 5:65520288-65520310 CAGCTTCTAGGGAGGCCTAAGGG - Intronic
991404950 5:66292790-66292812 CAGCCTCTTTAGATGAGCAAGGG + Intergenic
993310132 5:86319349-86319371 CTGCTTCTATTGAGGACTCAGGG - Intergenic
993731639 5:91429698-91429720 CAGCCTCTCCAGAGGACAAAAGG - Intergenic
994259275 5:97637842-97637864 CAGCTTCTAGGGAGGACTCAAGG + Intergenic
995459131 5:112384670-112384692 AAGCTTCTTTTGAGGAAGAAAGG + Intronic
997488332 5:134250817-134250839 CAGCTGCTTCAGAAGACTTATGG + Intergenic
997533677 5:134599039-134599061 CAGCTTCTGAATAGGACTACAGG + Intergenic
999067912 5:148711352-148711374 CAGCTTCTGTAGAGGCCCTAAGG + Intergenic
1000438096 5:161238415-161238437 CACTTTCTTTAGAGGGTTAATGG - Intergenic
1001067830 5:168553239-168553261 CAGCTGGTTGAGAGCACTAAAGG + Exonic
1001955893 5:175847953-175847975 CAGCTTCATCACAGGGCTAATGG + Intronic
1004452960 6:15764276-15764298 CATTTTCTTTAGAGCAATAAAGG + Intergenic
1004603312 6:17171434-17171456 CAGCTTCTGGAGAGGCCTCAGGG + Intergenic
1006491317 6:34391168-34391190 CAGCTTCTTTTCATAACTAACGG + Intronic
1010370625 6:75103057-75103079 CAGCTTATTTCTGGGACTAAAGG + Intronic
1011832681 6:91392247-91392269 AAGCAACTTTAGAGGACTACAGG + Intergenic
1012602353 6:101114019-101114041 CAGCTTCTGTTGATGACAAATGG + Intergenic
1012692036 6:102326592-102326614 CAGCCTCTTTAGAGGAGTTCAGG + Intergenic
1015336191 6:132041583-132041605 CAGCTTCTTGGGAGGCCTCAGGG - Intergenic
1015807461 6:137125644-137125666 AAGCTTGTTCAAAGGACTAAAGG - Intergenic
1015989871 6:138928195-138928217 AAGATTGTTCAGAGGACTAAAGG + Intronic
1016798936 6:148148830-148148852 CTGCTTCTTAAGTGGAGTAATGG - Intergenic
1024145857 7:46515645-46515667 CAGCTTCTGGAGAGGCCTCAGGG - Intergenic
1024384315 7:48734192-48734214 CAGCGTCTTTACAGAACTGATGG + Intergenic
1025610948 7:63075220-63075242 CAGCTTCTGGAGAGGCCTCAGGG + Intergenic
1025708453 7:63887663-63887685 CAGCTTCTGGAGAGGCCTCAGGG - Intergenic
1025932505 7:66007572-66007594 CAGCTTCTTTAGTGGACCCCAGG + Intergenic
1026643610 7:72149099-72149121 CTGCTTCTGGAGAGGACTCAGGG - Intronic
1029130672 7:98328294-98328316 CAGCCTCTATAGAGAACTCAAGG + Intronic
1031147255 7:118010501-118010523 TAGCTTCTTGAGAGGCCTTAGGG + Intergenic
1033105600 7:138519356-138519378 ATGCAGCTTTAGAGGACTAAAGG + Intronic
1033314214 7:140284179-140284201 CAGATTCCTCAGATGACTAAAGG + Intergenic
1037274644 8:17164964-17164986 CAGCTCTTTGAGAGGACTCATGG - Intronic
1041043850 8:53873201-53873223 CAGCTTTTGGAGAGGTCTAAGGG - Intronic
1043047220 8:75341830-75341852 CAGCTTTTATAGAAGAGTAAAGG + Intergenic
1044157189 8:88862273-88862295 CAGCTTCTTAAAAGGCCTCAAGG + Intergenic
1044515773 8:93136719-93136741 CAGCTTCTGGAGAGGTCTCAGGG + Intronic
1045529318 8:102969710-102969732 CAGCTTCTTTCTAGCACTATGGG - Intronic
1046517098 8:115276646-115276668 CTGATTCTTCAGAGGACTCATGG + Intergenic
1048058672 8:130894495-130894517 ATGATTCTTTAGGGGACTAAAGG + Intronic
1048791986 8:138112625-138112647 CAGTTTCTCTACAGGAATAATGG + Intergenic
1049327160 8:142028590-142028612 CATCTTCTTTAAAGGAATGAAGG + Intergenic
1049845151 8:144797149-144797171 CAGATTCTTTGGGGGACCAAGGG - Intergenic
1050916794 9:11146002-11146024 CATCTTCTTATGAGGACTATTGG - Intergenic
1053047225 9:34929879-34929901 AAGCTTCTTCAGGGGACTAAAGG - Intergenic
1056179933 9:84072874-84072896 CAGCTTCTACAGAGGTCAAACGG - Intergenic
1056798646 9:89676193-89676215 CAGCATCTTTAGGGGACTACTGG + Intergenic
1056897533 9:90564896-90564918 CACTTTCTTTGGAGAACTAAAGG - Intergenic
1057157624 9:92857566-92857588 GAGGGTCTTTAGAGGACAAAAGG + Intronic
1057442202 9:95090806-95090828 CAGCTTCCTTTGAGGATTAAAGG + Intergenic
1058343211 9:103923356-103923378 AAGATTCTTTAAAGAACTAAAGG + Intergenic
1058443693 9:105034320-105034342 CAGTTTCTTTTGGGGAATAATGG + Intergenic
1058836688 9:108863601-108863623 CACCTTCTGTAGAGGAAGAAAGG - Exonic
1062047366 9:134430689-134430711 AAGCTTCTTTAGAGGGGTACTGG + Intronic
1062145748 9:134988766-134988788 CAGCTTCTGGAGAGGCCTCAGGG + Intergenic
1203786486 EBV:130991-131013 CAGCATCTTTAGTGTACTTAAGG - Intergenic
1187836385 X:23436126-23436148 CAGCTTCTTGTGAAGACTTAGGG - Intergenic
1188784188 X:34324067-34324089 GAGATTCCTTAGAGAACTAAAGG + Intergenic
1188951104 X:36376317-36376339 CTGCTGCTTCAGAGGACTAATGG - Intronic
1191210945 X:57884491-57884513 CAGCTTCTTAAGAGGCCTCAGGG + Intergenic
1192737103 X:73860085-73860107 CAGCTTATTTAAAGAAATAATGG - Intergenic
1193282356 X:79668512-79668534 CAGCTTCTGGAGAGGCCTCAGGG + Intergenic
1197031214 X:121818409-121818431 CAGCTTCTGGTGAGGACTTAGGG + Intergenic
1198696646 X:139347173-139347195 GATCTTCTTCAGAGGAATAATGG - Intergenic
1199280908 X:145998098-145998120 CAGCTTTTCTAGACCACTAAGGG - Intergenic
1201545055 Y:15152805-15152827 CAGTTGCTTTTAAGGACTAAAGG + Intergenic