ID: 1092807003

View in Genome Browser
Species Human (GRCh38)
Location 12:12233531-12233553
Sequence GTTGACTTAATTGAAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092807003_1092807006 -3 Left 1092807003 12:12233531-12233553 CCAGTCTTTTCAATTAAGTCAAC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 1092807006 12:12233551-12233573 AACAAGGTGAGAGATAAAAAGGG 0: 1
1: 0
2: 2
3: 54
4: 845
1092807003_1092807011 8 Left 1092807003 12:12233531-12233553 CCAGTCTTTTCAATTAAGTCAAC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 1092807011 12:12233562-12233584 AGATAAAAAGGGAAAGGGGGAGG 0: 1
1: 1
2: 19
3: 146
4: 1401
1092807003_1092807007 2 Left 1092807003 12:12233531-12233553 CCAGTCTTTTCAATTAAGTCAAC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 1092807007 12:12233556-12233578 GGTGAGAGATAAAAAGGGAAAGG 0: 1
1: 0
2: 2
3: 85
4: 842
1092807003_1092807009 4 Left 1092807003 12:12233531-12233553 CCAGTCTTTTCAATTAAGTCAAC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 1092807009 12:12233558-12233580 TGAGAGATAAAAAGGGAAAGGGG 0: 1
1: 0
2: 22
3: 137
4: 1313
1092807003_1092807010 5 Left 1092807003 12:12233531-12233553 CCAGTCTTTTCAATTAAGTCAAC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 1092807010 12:12233559-12233581 GAGAGATAAAAAGGGAAAGGGGG 0: 1
1: 0
2: 22
3: 220
4: 1847
1092807003_1092807008 3 Left 1092807003 12:12233531-12233553 CCAGTCTTTTCAATTAAGTCAAC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 1092807008 12:12233557-12233579 GTGAGAGATAAAAAGGGAAAGGG 0: 1
1: 0
2: 5
3: 124
4: 1175
1092807003_1092807005 -4 Left 1092807003 12:12233531-12233553 CCAGTCTTTTCAATTAAGTCAAC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 1092807005 12:12233550-12233572 CAACAAGGTGAGAGATAAAAAGG 0: 1
1: 0
2: 6
3: 33
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092807003 Original CRISPR GTTGACTTAATTGAAAAGAC TGG (reversed) Intronic
904448421 1:30594715-30594737 ATTTACTTATTTGTAAAGACTGG - Intergenic
909243312 1:73242650-73242672 GTTCACTTAGTTGAGTAGACAGG - Intergenic
909709451 1:78629824-78629846 CTTGACTGAATTGAAAAAACTGG - Exonic
910816400 1:91295778-91295800 GTTGACTTTTTTAAAAAAACAGG - Intronic
911261486 1:95691722-95691744 GGTGACTTAATGGACAAGATAGG + Intergenic
911866117 1:103024301-103024323 ATTGATTTATTTGTAAAGACAGG + Intronic
912308617 1:108596497-108596519 GTTGATGTAATTCATAAGACTGG + Intronic
913050528 1:115113384-115113406 GTTGACTTCATTTTACAGACAGG - Intergenic
916322461 1:163520257-163520279 GTGGCTTTTATTGAAAAGACAGG + Intergenic
918414961 1:184297191-184297213 ATGGACATGATTGAAAAGACTGG + Intergenic
1064227397 10:13499640-13499662 GCTGAGTTACTTTAAAAGACAGG - Intronic
1067752886 10:48983600-48983622 CTTGACTTTATTAAAAAGGCAGG - Intergenic
1067979235 10:51064731-51064753 GTTCAATTAAATCAAAAGACAGG - Intronic
1072285200 10:93907851-93907873 GGTGACTTGATGGAAAAGAAAGG + Intronic
1072860620 10:99000716-99000738 GATTACTTATTTGAAAAGATTGG + Intronic
1073108573 10:101047525-101047547 GGTGACTGCATTGAAAGGACGGG + Intergenic
1073141356 10:101250364-101250386 GATGACTGAATGGATAAGACAGG + Intergenic
1074031665 10:109695191-109695213 GTGCAATTAATTTAAAAGACAGG + Intergenic
1076042135 10:127259295-127259317 GTGGACTTAATAGAAAGCACTGG + Intronic
1079446409 11:20560408-20560430 GTTGTCTTAATTGAAAAAGATGG - Intergenic
1080936305 11:36867628-36867650 GTTGAGCTAATTGAAAAGTCTGG - Intergenic
1085999552 11:81964873-81964895 GGTCCATTAATTGAAAAGACTGG - Intergenic
1086981189 11:93199058-93199080 GTTCACTTAAAGGAAAAGAAAGG - Intergenic
1088355458 11:108939128-108939150 GTTGTCTTATTTGTAAAGACAGG - Intronic
1090483403 11:127087727-127087749 GCTGAGTTAGTTCAAAAGACTGG - Intergenic
1092669550 12:10847595-10847617 GTTTCCTTAAATGAAAAGAGGGG + Intronic
1092807003 12:12233531-12233553 GTTGACTTAATTGAAAAGACTGG - Intronic
1094619924 12:32070345-32070367 ATTGACTTGATTACAAAGACAGG + Intergenic
1095437776 12:42210266-42210288 GTTTGTTTAATTGAAAAGAAAGG - Intronic
1098476699 12:70912427-70912449 TCTGACTTAAATGAGAAGACTGG - Intronic
1099308811 12:80992936-80992958 ATTGACTTAACTTCAAAGACAGG - Intronic
1100505150 12:95212695-95212717 GTTTAATTACTTGAATAGACAGG + Intronic
1100731322 12:97473503-97473525 GTTGACATATTTCAAAAGATAGG - Intergenic
1100735171 12:97520764-97520786 ATTGACTAAATTGCAAAGATTGG - Intergenic
1101268517 12:103117780-103117802 GTTGCCTTCATTGAATATACTGG - Intergenic
1102740170 12:115199914-115199936 TTTGACTGAGATGAAAAGACCGG - Intergenic
1103309435 12:119992683-119992705 TTTGATTTAATTGAAAATACAGG - Intronic
1106656130 13:31748680-31748702 GATGACTTTTTTTAAAAGACAGG + Intronic
1107381978 13:39866524-39866546 GTTGACGTTGTTGAGAAGACAGG - Intergenic
1108845024 13:54667594-54667616 ATTGACTGACTTCAAAAGACAGG - Intergenic
1109612124 13:64779826-64779848 GTTGACTAAATTGATAATGCAGG + Intergenic
1109890167 13:68601377-68601399 TTTAACTTAATTGCAAAGAGGGG + Intergenic
1109910334 13:68902701-68902723 ATTGACTTTATCCAAAAGACAGG - Intergenic
1109935277 13:69275167-69275189 GTAGACCAAGTTGAAAAGACAGG - Intergenic
1110292990 13:73828623-73828645 GTTGAATGTATTGAAAATACAGG - Intronic
1115794120 14:36913445-36913467 TTTGACTTTTTTGTAAAGACAGG + Intronic
1116736176 14:48694963-48694985 GGTGACTTAACAGCAAAGACCGG - Intergenic
1120202902 14:81557004-81557026 GTTTTCTTAATTGAAAAAATTGG - Intergenic
1120480584 14:85044349-85044371 TTTGAGTTAATTAAAAAGGCAGG - Intergenic
1122456923 14:101861025-101861047 GATAATTTAATTGAAAAAACAGG - Intronic
1122872935 14:104649567-104649589 GTTGGATTCATTTAAAAGACTGG - Intergenic
1123203320 14:106688867-106688889 GGTGCCTTAATTCCAAAGACAGG + Intergenic
1123834985 15:24180377-24180399 CTTGACTTTTTTGAAAACACAGG + Intergenic
1125382689 15:39103920-39103942 GGTGACATGATTGAAATGACTGG - Intergenic
1126547664 15:49890450-49890472 GCTGACTTTCTTTAAAAGACTGG + Intronic
1127047711 15:55044231-55044253 GTTTGTTTAATTGAAAAGAAAGG - Intergenic
1127369699 15:58327472-58327494 ATTGGGTTAATTCAAAAGACTGG + Intronic
1132127410 15:99240280-99240302 TTTGGCTTAATTGTAAAAACTGG + Intronic
1133256246 16:4518220-4518242 GTTGACTTTGATGAAAAGATGGG - Intronic
1134184915 16:12077099-12077121 GTTGTTTTATTTGTAAAGACAGG - Intronic
1138248736 16:55486131-55486153 CTTGACTGAAGTGTAAAGACTGG - Intronic
1138361942 16:56437802-56437824 CTTGACTTTATTCAAAAGAGAGG - Intronic
1138769388 16:59645821-59645843 GTTGACTTTAGTAGAAAGACAGG - Intergenic
1138972890 16:62168293-62168315 ATTGAGTTAATTTAAATGACTGG + Intergenic
1139342756 16:66279441-66279463 GCTGAGTTAATTCAAAAGACTGG - Intergenic
1146474082 17:33148044-33148066 GTTGTCTTAAATGAAAAGCCTGG - Intronic
1149002876 17:51775132-51775154 GGTGACTTGAGTGAAAGGACTGG + Intronic
1149949493 17:60970295-60970317 GTTCAGTTAATACAAAAGACAGG + Intronic
1152405177 17:80094054-80094076 GTTGATTTAAAAGAAAAAACAGG - Intronic
1155604001 18:27582644-27582666 GTGGACTTAATTGAGAAAAATGG + Intergenic
1157407484 18:47434704-47434726 GTTGAATTATATGAAAATACAGG + Intergenic
1157692778 18:49697603-49697625 GTTAACTTAAAGGAAAAGATAGG + Intergenic
1158006066 18:52673240-52673262 GTGGACATAAATGAAAAGACTGG - Intronic
1158526361 18:58218264-58218286 GTTGACTACACTTAAAAGACTGG - Intronic
1165675787 19:37721358-37721380 GTAGTCTTTGTTGAAAAGACTGG + Intergenic
925652704 2:6108394-6108416 GTTGACTTAAGTTAAAAAATAGG - Intergenic
926459667 2:13113041-13113063 TTTGTTTTAATTGAAAGGACTGG + Intergenic
928251166 2:29681943-29681965 GTTGCCTAAATTGATAAGAGAGG - Intronic
929290945 2:40190521-40190543 TTTTACTTAATTAAAAAGAGAGG - Intronic
930555261 2:52887272-52887294 GCTGACTTATCTGATAAGACAGG - Intergenic
930821721 2:55652505-55652527 GTTGACTTGACTGAGAACACTGG - Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
938278786 2:130050509-130050531 GGTGACCTAAATGAAAAAACAGG - Intergenic
938329760 2:130441368-130441390 GGTGACCTAAATGAAAAAACAGG - Intergenic
938360186 2:130680135-130680157 GGTGACCTAAATGAAAAAACAGG + Intergenic
938436589 2:131286843-131286865 GGTGACCTAAATGAAAAAACAGG + Intronic
940051901 2:149473852-149473874 GTAGACCTTATTGAAAAGTCTGG - Exonic
945052518 2:205837414-205837436 GTTGACTTGATTGAAGATAAAGG - Intergenic
945055816 2:205868023-205868045 GTTGATTGAAATGAAAAGACTGG + Intergenic
948745122 2:240085469-240085491 TTCGACCTAAATGAAAAGACAGG + Intergenic
1170099722 20:12685699-12685721 GTTGACAGAATTAAAAAGATAGG - Intergenic
1176755204 21:10720774-10720796 ATTGAATTAATTGAATAGAATGG - Intergenic
1178014142 21:28323373-28323395 GCTGATGTAATTAAAAAGACAGG - Intergenic
1178094097 21:29195699-29195721 TTTTACTTTATTGAAAAGAGGGG - Intronic
1178149537 21:29778136-29778158 GTATACTAAATTGAGAAGACAGG - Intronic
949601104 3:5598631-5598653 GTTGACTAACTTGCAAACACGGG + Intergenic
949788675 3:7769320-7769342 GATGAATTAATTGAAACCACAGG + Intergenic
951500523 3:23381772-23381794 GTTGACTTAGATGAAAATAAAGG + Intronic
951659576 3:25047677-25047699 GTTTACTTATTTGCAAAAACAGG - Intergenic
951944021 3:28114064-28114086 GTTATCTTAACTGAAAACACAGG - Intergenic
957467904 3:80619387-80619409 GTTAACTTATTTTAAAATACAGG + Intergenic
958705988 3:97655996-97656018 GTAGAATAATTTGAAAAGACTGG - Intronic
959535270 3:107477643-107477665 ATTGACTTAAGTGGAAAGAATGG + Intergenic
960033191 3:113076160-113076182 GTTGTTTTAATTGAAGTGACAGG - Intergenic
962285597 3:134083697-134083719 GTTGATTCACTTGAAAAGATTGG + Intronic
964603463 3:158530582-158530604 GCTCACTTATTTGAAAAGAGAGG + Intronic
965436069 3:168653128-168653150 ATGGACTTTATTTAAAAGACTGG - Intergenic
967074438 3:185989473-185989495 TTTGACTAAAATGTAAAGACAGG - Intergenic
969336613 4:6514201-6514223 GTTCACAAAATTGAAAAGATTGG - Intronic
970697117 4:18691407-18691429 GTTGACATAATTTAACATACAGG + Intergenic
974410627 4:61537589-61537611 TTTGTCTTAATTCAAAAGACAGG + Intronic
975432091 4:74305528-74305550 GATAAGTAAATTGAAAAGACTGG + Intergenic
975930009 4:79509525-79509547 TTTGACTTCATTGGAAAGATGGG + Intergenic
976978342 4:91191821-91191843 GTTATCAGAATTGAAAAGACTGG - Intronic
978791275 4:112665786-112665808 GTCTACTTAATTGAGAAAACGGG - Intergenic
979013342 4:115398283-115398305 GATATCTTAATTGAAAAGTCTGG + Intergenic
979833559 4:125331425-125331447 GTTAACTGATTGGAAAAGACTGG + Intronic
981106712 4:140889976-140889998 TTTGCCTTAATTAAAAAGGCAGG - Intronic
981660355 4:147158854-147158876 GTTCAGTGAATTGAAAAGATTGG + Intergenic
982053953 4:151529054-151529076 TTGGACTTCACTGAAAAGACCGG - Intronic
983610905 4:169643902-169643924 GTTGTTTTACTTGAAAAGACAGG + Intronic
983648709 4:170017948-170017970 GTTTATTTAATTGATATGACTGG - Intronic
983813340 4:172091625-172091647 GAGGACATAATTGAAAACACTGG - Intronic
984563502 4:181299443-181299465 GAGGACTTAATGGAAAAGAGTGG + Intergenic
985140568 4:186835698-186835720 GTTGACATAATTTCAAAGACTGG - Intergenic
986006279 5:3671737-3671759 GTTCACATAATCGAAAAGTCTGG + Intergenic
988490736 5:31703150-31703172 TTTGCCTTAATTGTAAAGAGCGG + Intronic
990076634 5:51853471-51853493 GTTAAGCTAATGGAAAAGACTGG - Intergenic
990106527 5:52270275-52270297 GTTTACTTAATTAAAATTACTGG + Intergenic
994125518 5:96165731-96165753 GTTAACATAAATGAAAATACAGG - Intergenic
994312797 5:98295464-98295486 GTTGACATATTTCAAAAGACAGG + Intergenic
994780353 5:104081002-104081024 GTGTACTTATTTGAAAAGAAAGG + Intergenic
995231445 5:109769273-109769295 GTTAACTAAATTGATAAAACTGG + Intronic
999586866 5:153099150-153099172 GTTTACTTAAGACAAAAGACTGG - Intergenic
1001097247 5:168785377-168785399 GTTTACTTAATTTAAAGGAAGGG - Intronic
1001527264 5:172437683-172437705 ATTCACTTAATTGAAAAAATTGG - Intronic
1003236586 6:4300630-4300652 GTTGAATTGATTGAGAAGAATGG + Intergenic
1005800400 6:29416540-29416562 GTTAACTTAAATAAAAAGACAGG - Intronic
1008296065 6:49779203-49779225 GTTGACTAATTTGACAAGATGGG - Intergenic
1011458369 6:87577034-87577056 TTTGAATTAATTGACAACACAGG + Intronic
1013008261 6:106095542-106095564 ATTTATTTAATTGAAAAGATTGG + Intronic
1013260103 6:108433171-108433193 GTTCACATAACTGAAAAGTCTGG - Intronic
1014008753 6:116451920-116451942 GTTTACTTTATTGTAAATACTGG - Intergenic
1015182601 6:130377278-130377300 GTTAAGTGATTTGAAAAGACAGG + Intronic
1017321390 6:153098058-153098080 AATGACTTAATGGAAAAGTCAGG + Intronic
1019943822 7:4311231-4311253 GTAGACTTAATTGAGAGTACAGG + Intergenic
1021999570 7:26213293-26213315 GTTTACTTTATTGTAAATACTGG + Exonic
1023485258 7:40679522-40679544 CTTGACTTCATTCAAGAGACTGG - Intronic
1024563734 7:50664820-50664842 TGTGACTCATTTGAAAAGACAGG - Intronic
1024951459 7:54865056-54865078 GTAGCCGTAATGGAAAAGACAGG + Intergenic
1028359660 7:89952619-89952641 GTTGACTTCATGGAACAGAGAGG - Intergenic
1030568379 7:111189201-111189223 GTTATTTTAATTGAAAACACTGG - Intronic
1031026159 7:116682396-116682418 GTTGGCTTTATTGAAAAGAGAGG + Intronic
1031599946 7:123694753-123694775 TATGACTTTATTGAAAAAACAGG - Exonic
1034028125 7:147730051-147730073 GTTGACTTCATTGAGCAAACAGG + Intronic
1040523632 8:48198923-48198945 GCTGCCTTAATTAAAAAGAAAGG - Intergenic
1040682103 8:49823570-49823592 GTTAAGTTGATTTAAAAGACAGG - Intergenic
1040769901 8:50960904-50960926 GGTGTCTTAAGTGAAAAGATAGG - Intergenic
1042538274 8:69881242-69881264 GTTGATTTTCTTGAAAAGATAGG - Intergenic
1042916733 8:73883020-73883042 GAAGACTTAAATGAAATGACTGG - Intergenic
1043522445 8:81061027-81061049 GTAGACTTTGTAGAAAAGACTGG + Intronic
1045536463 8:103033346-103033368 GTTGATTTTATAGAAAAAACGGG + Intronic
1045792728 8:106003940-106003962 GTAGATTTAAATGAAAAGAAAGG + Intergenic
1048099171 8:131329172-131329194 GTTAATTTAATTAAAAACACTGG + Intergenic
1048546637 8:135393556-135393578 AGTGACTTAATTGAAAGGAAGGG + Intergenic
1048817796 8:138350268-138350290 GTTGACTTAGGTGAAAGAACGGG - Intronic
1049055311 8:140231878-140231900 TTTGACTTAATTTAAAGGGCTGG - Intronic
1051521011 9:17988228-17988250 ATTGACTAAATTGGAAAGAATGG + Intergenic
1051855806 9:21563781-21563803 CTTGTCTTAATTGAAAATACAGG + Intergenic
1054827931 9:69591390-69591412 GTGTACTTAATCGAAGAGACTGG - Intronic
1055601920 9:77928469-77928491 GTTGTTTTAAAGGAAAAGACAGG + Intronic
1055796505 9:79980412-79980434 TTTGACTTTATTGGAAAGAAAGG - Intergenic
1057038456 9:91830099-91830121 GTTGACTGATTTGAAAATACAGG - Intronic
1058231253 9:102428842-102428864 ATTGAATCAATAGAAAAGACTGG - Intergenic
1060071268 9:120550101-120550123 CTTGGCTTTCTTGAAAAGACAGG - Intronic
1186692352 X:11991934-11991956 CTTGCCCTAATTGCAAAGACTGG + Intergenic
1190501092 X:51079440-51079462 GATGACTTATTTGATGAGACTGG + Intergenic
1191831560 X:65420930-65420952 GTAGACTTCATTGACAAGAATGG - Intronic
1194109431 X:89814559-89814581 GTTGGCTGACTTGAAAAGACAGG + Intergenic
1194755101 X:97729936-97729958 ATTGTCTTATTTGAAAAGACAGG + Intergenic
1196063716 X:111439695-111439717 GCTGACTTAAATGAAAAGCTAGG + Intergenic
1197158277 X:123293967-123293989 ATTGGCTTAATTGAAAAATCTGG - Intronic
1197174257 X:123468072-123468094 GTTGACTTATTTCAAAAGACTGG - Intronic
1197323455 X:125062853-125062875 GCTGATTAAATTGACAAGACAGG + Intergenic
1199714437 X:150496295-150496317 GTTGACTTACATGAAAATCCAGG - Intronic
1200462097 Y:3469301-3469323 GTTGGCTGACTTGAAAAGACAGG + Intergenic
1202031698 Y:20581859-20581881 GTTGACTTAATCAAAATGAGTGG + Intronic