ID: 1092810424

View in Genome Browser
Species Human (GRCh38)
Location 12:12267043-12267065
Sequence ACGGTCGGCACCGCCTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 22}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092810413_1092810424 26 Left 1092810413 12:12266994-12267016 CCCGCGCAGCTCCTCATTCAGCC 0: 1
1: 0
2: 0
3: 13
4: 204
Right 1092810424 12:12267043-12267065 ACGGTCGGCACCGCCTCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 22
1092810420_1092810424 -1 Left 1092810420 12:12267021-12267043 CCTCGCGCAGCGGCGCAGGGATA No data
Right 1092810424 12:12267043-12267065 ACGGTCGGCACCGCCTCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 22
1092810415_1092810424 15 Left 1092810415 12:12267005-12267027 CCTCATTCAGCCTCTGCCTCGCG 0: 1
1: 0
2: 0
3: 14
4: 244
Right 1092810424 12:12267043-12267065 ACGGTCGGCACCGCCTCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 22
1092810411_1092810424 28 Left 1092810411 12:12266992-12267014 CCCCCGCGCAGCTCCTCATTCAG 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1092810424 12:12267043-12267065 ACGGTCGGCACCGCCTCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 22
1092810417_1092810424 5 Left 1092810417 12:12267015-12267037 CCTCTGCCTCGCGCAGCGGCGCA No data
Right 1092810424 12:12267043-12267065 ACGGTCGGCACCGCCTCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 22
1092810414_1092810424 25 Left 1092810414 12:12266995-12267017 CCGCGCAGCTCCTCATTCAGCCT 0: 1
1: 0
2: 3
3: 20
4: 292
Right 1092810424 12:12267043-12267065 ACGGTCGGCACCGCCTCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 22
1092810412_1092810424 27 Left 1092810412 12:12266993-12267015 CCCCGCGCAGCTCCTCATTCAGC 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1092810424 12:12267043-12267065 ACGGTCGGCACCGCCTCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092810424 Original CRISPR ACGGTCGGCACCGCCTCCTA GGG Intergenic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
900100267 1:959474-959496 ACCGGCGTCACCGCGTCCTACGG - Intergenic
1072679820 10:97498729-97498751 ACCGACAGCACCGCCCCCTAGGG - Intronic
1075581619 10:123623118-123623140 AGGGTCGGCATCACTTCCTAAGG - Intergenic
1076814951 10:132910007-132910029 CCGGTGGGCACCGTCTCCTCGGG + Exonic
1077024081 11:431639-431661 GCGGACGGCCCCGCCTCCTGCGG - Intronic
1077098232 11:809118-809140 AGGGTTGGCCCTGCCTCCTAAGG - Intronic
1092810424 12:12267043-12267065 ACGGTCGGCACCGCCTCCTAGGG + Intergenic
1101810422 12:108103127-108103149 CAGGTCTGCACTGCCTCCTAAGG + Intergenic
1104030917 12:125065410-125065432 ACGGCCGCCGCCGCCTCCTGCGG - Exonic
1105054040 12:133080902-133080924 ACGCTCGGCGCCGCCCCCCAGGG - Exonic
1116916559 14:50531955-50531977 AGGGTCGGCAGCGGCACCTACGG - Exonic
1150490900 17:65573614-65573636 ATGGACGGCCCCGCCTCCTATGG + Intronic
1154197371 18:12276565-12276587 ACTGGAGGCACCGCCTGCTAGGG + Intronic
1167093041 19:47357878-47357900 GTGGTCGGCTCCGCCTCCTGCGG - Exonic
925013632 2:504809-504831 CCGGTCAGCACAGCCTCCTCCGG - Intergenic
1173319246 20:41972720-41972742 TCTGTAGGCACCGCCTCCTTAGG + Intergenic
1181328503 22:22070204-22070226 ATGGTGGACACCGCCTCCTGTGG - Intergenic
996201045 5:120673876-120673898 ACTGTAGCCACCGCCTCCTAGGG - Intronic
996921194 5:128769602-128769624 TCTGTCGGCACCGCCTGCCAAGG - Intronic
1018468796 6:164078843-164078865 ACTGTGGGCACAGCCTTCTAGGG - Intergenic
1029405541 7:100372484-100372506 AGGGTGGGCAGAGCCTCCTACGG + Intronic
1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG + Intergenic
1057128540 9:92637901-92637923 GCGGTCAGCACAGCCTCCTGGGG - Intronic
1061016045 9:127981178-127981200 GCGGCCGGGCCCGCCTCCTAGGG + Intergenic