ID: 1092811576

View in Genome Browser
Species Human (GRCh38)
Location 12:12275848-12275870
Sequence ACTGCTGCTGCACTGGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092811576_1092811586 26 Left 1092811576 12:12275848-12275870 CCCCTGCCCAGTGCAGCAGCAGT No data
Right 1092811586 12:12275897-12275919 GTGCAGGTTCTCAGTTTGGGAGG No data
1092811576_1092811585 23 Left 1092811576 12:12275848-12275870 CCCCTGCCCAGTGCAGCAGCAGT No data
Right 1092811585 12:12275894-12275916 TCAGTGCAGGTTCTCAGTTTGGG No data
1092811576_1092811584 22 Left 1092811576 12:12275848-12275870 CCCCTGCCCAGTGCAGCAGCAGT No data
Right 1092811584 12:12275893-12275915 CTCAGTGCAGGTTCTCAGTTTGG No data
1092811576_1092811581 10 Left 1092811576 12:12275848-12275870 CCCCTGCCCAGTGCAGCAGCAGT No data
Right 1092811581 12:12275881-12275903 GCAGCCCATGCTCTCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092811576 Original CRISPR ACTGCTGCTGCACTGGGCAG GGG (reversed) Intergenic
No off target data available for this crispr