ID: 1092817753

View in Genome Browser
Species Human (GRCh38)
Location 12:12326136-12326158
Sequence AACCAAGGCATCCCGGAGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092817749_1092817753 -2 Left 1092817749 12:12326115-12326137 CCAGGGTTTGTCCTGTCAATTAA 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1092817753 12:12326136-12326158 AACCAAGGCATCCCGGAGACTGG 0: 1
1: 0
2: 0
3: 8
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092817753 Original CRISPR AACCAAGGCATCCCGGAGAC TGG Exonic
902282678 1:15385902-15385924 ACCCAGGGCATCCCAGAGTCAGG - Intronic
902297795 1:15480432-15480454 AACAAAGACATACCTGAGACTGG + Intronic
903043088 1:20546733-20546755 AACCAAGGGATCCAGAAAACAGG + Intergenic
903661142 1:24979534-24979556 AACAAAGACATACCTGAGACTGG - Intergenic
904080562 1:27869839-27869861 AACCAAGGCTGGCAGGAGACAGG - Intergenic
904396269 1:30224557-30224579 AAGCAGGGCATCCCTGAGATGGG - Intergenic
906138634 1:43519541-43519563 AAGGAAGGAATCCAGGAGACTGG + Intergenic
906459258 1:46024860-46024882 AATAAAGGCATACCAGAGACTGG + Intronic
909068256 1:70962452-70962474 AACAAAGACATACCTGAGACTGG + Intronic
909950476 1:81713877-81713899 AATAAAGACATACCGGAGACTGG + Intronic
915312958 1:155013640-155013662 GACCAAGGCCTTCTGGAGACGGG + Intronic
915512540 1:156394249-156394271 ATCAAAGGCATCCCGGTGCCAGG - Intergenic
915858767 1:159419554-159419576 AATAAAGGCATACCTGAGACTGG - Intergenic
916901037 1:169224124-169224146 GACCAAGGCATCCAGGTGAGAGG - Intronic
918787364 1:188779249-188779271 AACAAAGACATACCTGAGACTGG - Intergenic
919939754 1:202278165-202278187 AACCGAGGCAGACTGGAGACAGG + Intronic
921588021 1:216971022-216971044 AACCAAGTCATTCAGGTGACAGG + Intronic
922420036 1:225453455-225453477 AACAAAGACATACCTGAGACTGG + Intergenic
923793819 1:237134320-237134342 AATCAAGACATACCTGAGACTGG + Intronic
923900243 1:238318392-238318414 AATAAAGGCATACCCGAGACTGG - Intergenic
1062782842 10:231985-232007 AACCAAGGCCTCCCTGTAACAGG - Intronic
1065071822 10:22032595-22032617 AATAAAGACATCCCTGAGACTGG - Intergenic
1065506255 10:26432939-26432961 AATAAAGACATACCGGAGACTGG - Intergenic
1067808629 10:49410158-49410180 AGCCAAGGAATCCCAGAGAGGGG - Intergenic
1068221894 10:54056330-54056352 AAAAAAGGCATACCTGAGACTGG + Intronic
1068479002 10:57564689-57564711 AATAAAGGCATACCTGAGACTGG - Intergenic
1070329807 10:75409053-75409075 AACCCAGTCATCGCGGGGACTGG + Intergenic
1070688558 10:78508022-78508044 AGCCAAAGCAGCCCAGAGACAGG + Intergenic
1070809360 10:79289868-79289890 AACCAACACATCCCAGAGCCAGG + Exonic
1072033416 10:91542405-91542427 AAGCATGGCATCCGGGAGGCAGG + Intergenic
1075550510 10:123389328-123389350 AATAAAGGCATACCTGAGACTGG - Intergenic
1076520319 10:131077091-131077113 AACCAGGGCAGCCAGGAGGCAGG + Intergenic
1076757003 10:132577725-132577747 ACCCAATGCCTCCCTGAGACAGG - Intronic
1077856692 11:6133366-6133388 AATAAAGGCATACCGGAGACTGG - Intergenic
1079176632 11:18148033-18148055 AACAAAGACATACCTGAGACTGG + Intronic
1081705474 11:45180385-45180407 CACCAAGGCAGCTCGGAGGCTGG + Intronic
1081753113 11:45526125-45526147 AATAAAGGCATGCCTGAGACTGG - Intergenic
1083734782 11:64673431-64673453 TCCCAAGGCATCCCCCAGACAGG - Intronic
1084298565 11:68229674-68229696 AACAAAGACATACCCGAGACTGG + Intergenic
1084519870 11:69656541-69656563 AACAAAGACATACCCGAGACTGG + Intronic
1084521363 11:69665029-69665051 GACCAAGGGCTCCCGGAAACTGG + Intronic
1085337970 11:75711925-75711947 TACCAAGGCCTCCCTAAGACAGG + Intergenic
1085405947 11:76262307-76262329 TACCAAGGCCTCCCTAAGACAGG + Intergenic
1085843143 11:80036945-80036967 AACCAGGGCATAGTGGAGACTGG - Intergenic
1087141625 11:94769772-94769794 AACCAAGGCCTCACAGAGAAAGG - Intronic
1087675776 11:101159291-101159313 AACAAAGACATACCTGAGACTGG - Intergenic
1087678865 11:101195301-101195323 AAACAAGGAATCCCAGTGACAGG - Intergenic
1090321403 11:125846850-125846872 AATAAAGGCATACCTGAGACTGG + Intergenic
1090506636 11:127321787-127321809 AATAAAGACATACCGGAGACTGG + Intergenic
1090563999 11:127966092-127966114 ACCTAAGGCTTCCCTGAGACAGG + Intergenic
1092817753 12:12326136-12326158 AACCAAGGCATCCCGGAGACTGG + Exonic
1094753981 12:33444908-33444930 AATAAAGGCATACCTGAGACTGG + Intergenic
1102023535 12:109700062-109700084 AGACAAGACATCCCAGAGACGGG + Intergenic
1104100078 12:125599361-125599383 AACAAAGACATACCTGAGACTGG - Intronic
1104275252 12:127321051-127321073 AACCAAGGCATGGCAGAGAGAGG + Intergenic
1106468080 13:30030706-30030728 AATAAAGGCATACCTGAGACTGG + Intergenic
1109853586 13:68101121-68101143 AATAAAGGCATACCTGAGACTGG + Intergenic
1110645401 13:77877631-77877653 AATAAAGGCATACCCGAGACTGG - Intergenic
1110793745 13:79613536-79613558 AACAAAGACATACCTGAGACTGG + Intergenic
1112058449 13:95713147-95713169 AATAAAGACATACCGGAGACTGG - Intronic
1112931688 13:104747623-104747645 AATAAAGGCATACCTGAGACTGG - Intergenic
1115090246 14:29566426-29566448 AACAAAGACATACCCGAGACTGG + Intergenic
1116214099 14:41988699-41988721 AATAAAGACATACCGGAGACTGG + Intergenic
1118402980 14:65396321-65396343 AACAAAGACATACCTGAGACTGG + Intergenic
1120568883 14:86092947-86092969 AATAAAGACATCCCTGAGACTGG - Intergenic
1120779225 14:88471176-88471198 CACCAAGGCTTTCTGGAGACTGG - Intronic
1120885882 14:89451482-89451504 TACCAAGGCTTTCCTGAGACTGG + Intronic
1120887781 14:89465203-89465225 AACAAAGACATGCCAGAGACTGG - Intronic
1121036053 14:90704556-90704578 AACAAAGGCATCCCAGGGACAGG + Intronic
1121490109 14:94352262-94352284 AATAAAGGCATACCCGAGACTGG + Intergenic
1121515579 14:94547792-94547814 AACAAAGACATACCTGAGACTGG - Intergenic
1124029465 15:25996841-25996863 AATAAAGGCATACCTGAGACTGG + Intergenic
1124056170 15:26242682-26242704 AATCTAGGCATCCCCGGGACTGG - Intergenic
1124505963 15:30273853-30273875 AAGCAAGGCATCCCAGAGTTTGG + Intergenic
1124737590 15:32264779-32264801 AAGCAAGGCATCCCAGAGTTTGG - Intergenic
1126545691 15:49871732-49871754 AACCAAAGCATGCCAGACACTGG + Intronic
1126732106 15:51694350-51694372 ACCCAAATCATCCCTGAGACTGG - Intronic
1128699206 15:69791846-69791868 ATCCCAGGCATCCAGAAGACTGG + Intergenic
1128873499 15:71183048-71183070 AATGAAGACATACCGGAGACTGG + Intronic
1128944260 15:71810701-71810723 AACCCAGGCCTCCCGCAGGCAGG + Exonic
1134931080 16:18208364-18208386 AACAAAGACATACCTGAGACTGG + Intergenic
1140602398 16:76492844-76492866 AACAAAGACATACCTGAGACTGG - Intronic
1141671758 16:85495841-85495863 AATCAAGGCCTCCAGGAGGCTGG + Intergenic
1142583592 17:956864-956886 AACCAGGTCATCCAGGAGAGAGG + Intronic
1143469769 17:7165261-7165283 AACCTAGGCATCCCAGAGTGGGG - Intergenic
1147209654 17:38864987-38865009 AACCAAGGCTAGACGGAGACAGG + Intergenic
1147580012 17:41622864-41622886 AACCAAGGAATCCTGGGGTCAGG + Intronic
1152204205 17:78965691-78965713 ATCCAAGGCATCGAGGAGCCAGG + Intergenic
1153348461 18:4053170-4053192 AATAAAGGCATACCTGAGACTGG + Intronic
1154322828 18:13368403-13368425 AAAGCAGGCATCCCTGAGACAGG - Intronic
1155228741 18:23753226-23753248 ATCCAATACATCCCTGAGACTGG - Intronic
1155633545 18:27923525-27923547 AACCTAGGGATTCCGGGGACTGG + Intergenic
1160096601 18:75878888-75878910 AATAAAGGCATACCTGAGACTGG - Intergenic
1160142476 18:76338037-76338059 GCTCAAGGCACCCCGGAGACAGG - Intergenic
1160303655 18:77710014-77710036 AATAAAGGCATACCTGAGACTGG + Intergenic
1162815964 19:13194743-13194765 AACCAAGGCCCCCGGGAGCCTGG + Intergenic
925459016 2:4043853-4043875 AACGAAGACATACCAGAGACTGG - Intergenic
925719429 2:6813226-6813248 AACCAAAGGATCCTGGAGCCAGG + Intergenic
926418781 2:12676858-12676880 AACCAAGTTGTTCCGGAGACAGG + Intergenic
926526986 2:13992937-13992959 AATAAAGGCATACCTGAGACTGG + Intergenic
927127149 2:20022357-20022379 AATAAAGGCATACCCGAGACTGG + Intergenic
927386951 2:22545785-22545807 AACAAAGACATACCTGAGACTGG + Intergenic
930563126 2:52985456-52985478 AACCTATGAATCCAGGAGACTGG - Intergenic
934081927 2:88475954-88475976 AATAAAGGCATACCTGAGACTGG - Intergenic
935363653 2:102268114-102268136 ATCCAAGGCCTGCCTGAGACCGG - Intergenic
937588878 2:123590474-123590496 AACAAAGACATACCAGAGACTGG + Intergenic
938518237 2:132038047-132038069 AGGCAAGGAACCCCGGAGACGGG + Intergenic
940446461 2:153783911-153783933 AACAAAGACATACCCGAGACTGG - Intergenic
942733478 2:179083633-179083655 AATAAAGACATACCGGAGACTGG + Intergenic
942950354 2:181714018-181714040 AATAAAGACATACCGGAGACTGG - Intergenic
943115450 2:183664266-183664288 AATAAAGACATACCGGAGACTGG + Intergenic
947279185 2:228428932-228428954 AACAAAGACATACCCGAGACTGG - Intergenic
948435330 2:237949516-237949538 AACAAAGACATACCTGAGACTGG - Intergenic
1169735467 20:8833159-8833181 AATAAAGACATCCCAGAGACTGG + Intronic
1170674653 20:18467631-18467653 TCCCAAGGGATCCCGGAGAAGGG - Intronic
1170950801 20:20934171-20934193 AACCAATGCCCCTCGGAGACTGG - Intergenic
1173064653 20:39698752-39698774 AACCAAGGCTTCCCTGAGTCAGG + Intergenic
1173075713 20:39817537-39817559 AACAAAGACATACCTGAGACTGG + Intergenic
1173086095 20:39919798-39919820 AATCAATGAATCCAGGAGACTGG + Intergenic
1177392491 21:20494643-20494665 AACAAAGACATACCCGAGACTGG + Intergenic
1177430379 21:20985198-20985220 AACAAAGACATACCCGAGACTGG + Intergenic
1177459267 21:21389098-21389120 AATAAAGGCATACCGTAGACTGG + Intronic
1177656081 21:24019396-24019418 AACAAAGACATACCCGAGACTGG - Intergenic
1178694647 21:34782227-34782249 GACAAAGACATCCCCGAGACTGG - Intergenic
1179052840 21:37903446-37903468 AACAAAGACATACCTGAGACTGG - Intronic
1179299244 21:40091640-40091662 AATAAAGGCATGCCTGAGACTGG + Intronic
1183479749 22:38057078-38057100 AACGAAAGCATCCCTGAGCCGGG - Intronic
1184829668 22:46976549-46976571 AACCACGGCAACACGCAGACCGG + Intronic
950529162 3:13543197-13543219 AGCGAAGGCAGCCCAGAGACAGG - Intergenic
951054884 3:18136193-18136215 GATAAAGGCATACCGGAGACTGG + Intronic
952291750 3:32023458-32023480 AATAAAGGCATACCTGAGACAGG - Intronic
954618978 3:51985131-51985153 AGCCCAGGCAGCCCGGAGAGTGG - Intronic
955023885 3:55148398-55148420 AAGCCAGGCATCCCGGAGCCTGG + Intergenic
956766150 3:72486308-72486330 AACAAAGACATACCTGAGACTGG + Intergenic
957384814 3:79482587-79482609 AACAAAGACATACCAGAGACTGG - Intronic
957435413 3:80168805-80168827 AATAAAGGCATACCTGAGACTGG + Intergenic
957765854 3:84622705-84622727 AATAAAGACATCCCAGAGACTGG + Intergenic
957963771 3:87295406-87295428 AAAAAAGGCATACCTGAGACTGG + Intergenic
959453456 3:106531446-106531468 AATAAAGGCATACCCGAGACTGG - Intergenic
960071396 3:113435215-113435237 AACAAAGGCATACCTGAGAATGG + Intronic
960257622 3:115527669-115527691 AATAAAGACATCCCTGAGACTGG - Intergenic
962367794 3:134797275-134797297 AACCCAGGCATCCCTGCGCCAGG - Intronic
963260676 3:143188236-143188258 AACCAAGCCATGCCAGAGAGAGG - Intergenic
965013548 3:163127126-163127148 AATAAAGACATCCCTGAGACTGG + Intergenic
967047889 3:185754417-185754439 TATAAAGGCATACCGGAGACTGG - Intronic
967878213 3:194281053-194281075 AGCCAAGGAATCTCGGTGACTGG + Intergenic
968307026 3:197657324-197657346 ATCCAAGGGATCTCGGGGACCGG - Intergenic
970155889 4:13141501-13141523 AATAAAGGCATACCCGAGACTGG + Intergenic
970800275 4:19965465-19965487 AATAAAGGCATCCCCAAGACTGG + Intergenic
970898344 4:21129291-21129313 AATGAAGACATACCGGAGACTGG - Intronic
970977263 4:22056345-22056367 AACAAAGACATACCTGAGACTGG - Intergenic
971912192 4:32809251-32809273 AATAAAGACATACCGGAGACTGG + Intergenic
973745915 4:53963293-53963315 AACCCAGGCATCCCAATGACCGG - Intronic
974432630 4:61817640-61817662 AATAAAGGCATACCTGAGACTGG + Intronic
974826062 4:67132486-67132508 AATAAAGACATACCGGAGACTGG - Intergenic
977161939 4:93645619-93645641 GACCCAGGTATCCAGGAGACAGG - Intronic
979704591 4:123707209-123707231 GACCAAGGCATCAGAGAGACAGG + Intergenic
981763047 4:148215173-148215195 AAACAAGGCATCCAGAATACAGG + Intronic
982349816 4:154402520-154402542 AACAAAGACATACCTGAGACTGG + Intronic
982449623 4:155536875-155536897 AATAAAGACATACCGGAGACTGG - Intergenic
983602985 4:169550348-169550370 AACAAAGTCATACCCGAGACTGG - Intronic
984010350 4:174363827-174363849 AATAAAGGCATACCTGAGACTGG + Intergenic
985786035 5:1895405-1895427 TACCAAGACATACCTGAGACTGG - Intergenic
985896555 5:2752418-2752440 AACCAAGGCGCCCCGGATCCAGG - Exonic
986111297 5:4721204-4721226 AACAAAGACATACCTGAGACTGG + Intergenic
986489237 5:8272290-8272312 AACCATGGCATCTCAGTGACAGG + Intergenic
988653357 5:33178578-33178600 AATAAAGGCATACCAGAGACTGG - Intergenic
989106631 5:37869071-37869093 AATAAAGGCATACCCGAGACTGG + Intergenic
989213990 5:38884850-38884872 GAACCAGGCATCCAGGAGACTGG - Intronic
989639134 5:43566173-43566195 AATAAAGACATCCCGGTGACTGG - Intergenic
989690054 5:44131281-44131303 AATAAAGACATACCGGAGACTGG - Intergenic
990132870 5:52609289-52609311 AATAAAGGCATACTGGAGACTGG - Intergenic
990497601 5:56364118-56364140 AATAAAGGCATACCAGAGACTGG - Intergenic
992583106 5:78202262-78202284 AATAAAGACATCCCTGAGACTGG - Intronic
993561826 5:89418926-89418948 AACAAAGGCATACCTTAGACTGG - Intergenic
994084163 5:95740246-95740268 AACAAAGACATACCTGAGACTGG - Intronic
994542432 5:101116872-101116894 AACAAAGGCATACCTGAGACTGG - Intergenic
995437902 5:112158556-112158578 AATCAAGACATACCCGAGACTGG + Intronic
996274016 5:121642576-121642598 AATAAAGGCATACCAGAGACTGG + Intergenic
1001077595 5:168642097-168642119 AAAAAAGGCATACCTGAGACTGG - Intergenic
1001247357 5:170114752-170114774 AATGAAGACATACCGGAGACTGG + Intergenic
1001718593 5:173837641-173837663 AACAAAGACATTCCTGAGACTGG - Intergenic
1002843816 6:928307-928329 AATAAAGGCATACCAGAGACTGG + Intergenic
1002878488 6:1232058-1232080 AACCAAGGCATTAAGGAGAGGGG - Intergenic
1004489528 6:16100967-16100989 AACAAAGGCATACCTGAGACTGG - Intergenic
1008189142 6:48432999-48433021 AACAAAGACATACCAGAGACTGG + Intergenic
1009545868 6:65019768-65019790 AATAAAGACATCCCTGAGACTGG + Intronic
1012280890 6:97327357-97327379 AATAAAGACATCCCTGAGACTGG - Intergenic
1012832971 6:104228884-104228906 AATAAAGGCATACCTGAGACTGG - Intergenic
1013890632 6:115022068-115022090 AATAAAGACATCCCTGAGACTGG + Intergenic
1015308403 6:131736282-131736304 AATAAAGGCATACCTGAGACTGG + Intronic
1015721622 6:136248599-136248621 AATAAAGACATACCGGAGACTGG - Intronic
1015885678 6:137915769-137915791 AACAAAGTCATACCTGAGACTGG + Intergenic
1017121918 6:151032183-151032205 TATAAAGGCATCCCTGAGACTGG + Intronic
1018488525 6:164268331-164268353 AATAAAGGCATACCTGAGACTGG + Intergenic
1019400021 7:847387-847409 CCCCAGGGGATCCCGGAGACTGG - Intronic
1019400214 7:847925-847947 CCCCAGGGGATCCCGGAGACTGG - Intronic
1019400238 7:847997-848019 CCCCAGGGGATCCCGGAGACTGG - Intronic
1019400249 7:848033-848055 CCCCAGGGGATCCCGGAGACTGG - Intronic
1023122104 7:36919990-36920012 AACCAAAGCATCCCTGATCCAGG - Intronic
1024443738 7:49453199-49453221 AATAAAGACATACCGGAGACTGG + Intergenic
1025827888 7:65025321-65025343 AACAAAGACATACCTGAGACTGG - Intergenic
1025915418 7:65861765-65861787 AACAAAGACATACCTGAGACTGG - Intergenic
1026123602 7:67559554-67559576 AATAAAGGCATACCCGAGACTGG - Intergenic
1026307404 7:69154044-69154066 AATAAAGACATCCCTGAGACTGG + Intergenic
1026833424 7:73623528-73623550 AACCCAGGCCTCCCGGGCACCGG + Intronic
1027269033 7:76510365-76510387 AGCCAGGCCATCCCGGAGCCTGG - Intergenic
1028720315 7:94022943-94022965 AATAAAGACATACCGGAGACTGG - Intergenic
1028918350 7:96284866-96284888 AATAAAGGCATACCTGAGACTGG - Intronic
1030425155 7:109367334-109367356 AATAAAGGCATACCTGAGACTGG - Intergenic
1030851172 7:114488021-114488043 AATCAAGACATACCTGAGACTGG + Intronic
1031180401 7:118407440-118407462 AATAAAGGCATTCCCGAGACTGG + Intergenic
1032168644 7:129565932-129565954 AATAAAGACATCCCCGAGACTGG + Intergenic
1032696333 7:134339824-134339846 AATAAAGACATACCGGAGACTGG + Intergenic
1033836767 7:145323024-145323046 AATTAAGGCATACCTGAGACTGG - Intergenic
1036606868 8:10314919-10314941 AATAAAGACATACCGGAGACTGG + Intronic
1040997753 8:53418973-53418995 AATAAAGACATACCGGAGACTGG - Intergenic
1041823723 8:62068017-62068039 AATAAAGGCATACCCGAGACTGG - Intergenic
1042052886 8:64731115-64731137 AATAAAGACATACCGGAGACTGG - Intronic
1043309358 8:78839148-78839170 AACAAAGACATACCTGAGACTGG + Intergenic
1044744867 8:95362232-95362254 AACAAAGGCATGAAGGAGACAGG + Intergenic
1046477972 8:114773888-114773910 AATAAAGGCATACCTGAGACTGG + Intergenic
1047036700 8:120947981-120948003 AACAAAGACATACCTGAGACTGG + Intergenic
1047121102 8:121906522-121906544 AAGAAAGGCATACCTGAGACTGG + Intergenic
1047468101 8:125139431-125139453 AATAAAGACATACCGGAGACTGG + Intronic
1050598244 9:7225432-7225454 AACAAAGACATACCCGAGACTGG + Intergenic
1050945299 9:11510109-11510131 AATGAAGGCATTCCTGAGACTGG - Intergenic
1051269628 9:15342885-15342907 AACAAAGGAATACCTGAGACTGG + Intergenic
1051329853 9:16012780-16012802 AACAAAGGAATCCCAGACACTGG - Intronic
1051423293 9:16909978-16910000 AATAAAGACATACCGGAGACTGG - Intergenic
1051483725 9:17586514-17586536 AATAAAGGCATACCCGAGACTGG + Intronic
1051644283 9:19252065-19252087 AATAAAGGCATACCTGAGACTGG + Intronic
1053055788 9:34992393-34992415 AACAAAAGCATCCTGGGGACAGG - Intronic
1053615070 9:39757125-39757147 AATAAAGGCATACCCGAGACTGG + Intergenic
1054238450 9:62585266-62585288 AATAAAGGCATACCCGAGACTGG - Intergenic
1054262143 9:62878053-62878075 AATAAAGGCATACCCGAGACTGG + Intergenic
1054552579 9:66619786-66619808 AATAAAGGCATACCCGAGACTGG - Intergenic
1055170638 9:73254076-73254098 AATAAAGGCATACCTGAGACTGG - Intergenic
1061245910 9:129401273-129401295 ATCCAAGGCAGACCGGAGACTGG + Intergenic
1062012173 9:134273096-134273118 GACAAAGGCATCCGGGAGGCTGG + Intergenic
1062032834 9:134369735-134369757 CACCAAGGCAGCTCTGAGACAGG - Intronic
1062729517 9:138101325-138101347 AACCAAAGCGTCCAGGAGGCTGG - Intronic
1185451763 X:284725-284747 AACAAAGACATACCCGAGACTGG + Intronic
1186400868 X:9258228-9258250 ACCCAAGGCAGCCTGGAAACAGG + Intergenic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1186629460 X:11333498-11333520 AATAAAGGCATACTGGAGACTGG - Intronic
1187931469 X:24297273-24297295 AATAAAGGCATACCTGAGACTGG + Intergenic
1188041103 X:25370259-25370281 AAGCAAGGCAACCTGGAGGCTGG - Intergenic
1188857202 X:35210701-35210723 AATAAAGACATACCGGAGACTGG + Intergenic
1188983719 X:36751074-36751096 AACAAAGACATACCCGAGACTGG - Intergenic
1189434854 X:40982884-40982906 AACAAAGACATACCCGAGACTGG - Intergenic
1189952323 X:46245398-46245420 AACAAAGACATACCCGAGACTGG - Intergenic
1192155836 X:68745947-68745969 AACAAAGACATACCTGAGACTGG - Intergenic
1193756761 X:85418525-85418547 AACCAAGGCAGCCTGGAATCAGG + Intergenic
1194697137 X:97067015-97067037 AACCAAGGCATCCCACAGAAAGG - Intronic
1199420506 X:147638211-147638233 AATCAAGACATACCCGAGACTGG - Intergenic
1199569212 X:149251339-149251361 AACAAAGACATACCCGAGACTGG + Intergenic
1200053262 X:153445760-153445782 AGCCAAGGCATTCCGGTGAAGGG - Intronic