ID: 1092818303

View in Genome Browser
Species Human (GRCh38)
Location 12:12330243-12330265
Sequence AAACTGCTTCCTGGGAAGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092818303_1092818309 23 Left 1092818303 12:12330243-12330265 CCTACCTTCCCAGGAAGCAGTTT 0: 1
1: 0
2: 0
3: 18
4: 265
Right 1092818309 12:12330289-12330311 TTTGACATAGAAAGTGCAGTAGG 0: 1
1: 0
2: 0
3: 14
4: 221
1092818303_1092818310 24 Left 1092818303 12:12330243-12330265 CCTACCTTCCCAGGAAGCAGTTT 0: 1
1: 0
2: 0
3: 18
4: 265
Right 1092818310 12:12330290-12330312 TTGACATAGAAAGTGCAGTAGGG 0: 1
1: 0
2: 0
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092818303 Original CRISPR AAACTGCTTCCTGGGAAGGT AGG (reversed) Exonic
900181180 1:1311701-1311723 AAACAGCTGCCTGGGCAGGCAGG + Exonic
901504445 1:9675708-9675730 CAACTAAGTCCTGGGAAGGTGGG - Intronic
902358245 1:15924231-15924253 AAACTGCTACTTGGGAAGCCAGG - Intronic
902702064 1:18179260-18179282 AGACCGCAGCCTGGGAAGGTTGG - Intronic
903672673 1:25045902-25045924 AAACTGCTTTCTTGGAGGGCTGG + Intergenic
904871225 1:33619433-33619455 TAGCTGCTGCCTGGGAAGATGGG - Intronic
906316039 1:44786913-44786935 AGACTGCTTCCCAGGAGGGTGGG + Intronic
906821185 1:48931959-48931981 ATACTCTTTCCTGGGAAGGATGG - Intronic
907808497 1:57844851-57844873 TAACTGTTACCTGGGCAGGTGGG - Intronic
909717056 1:78721804-78721826 AAACTGCCTCCTAGGAGGGTGGG - Intergenic
910307361 1:85781067-85781089 AAAATGATTCCTGAGAAGTTAGG - Intronic
910927373 1:92410874-92410896 AAACCGCTTCCTGCCAAGGTGGG - Intergenic
911169658 1:94757476-94757498 ATGCTGCTTCTTGGGAAGGAGGG - Intergenic
912385717 1:109270309-109270331 GAACTGCTTCCAGGGAAGCCTGG - Intronic
914453529 1:147814583-147814605 ACACTTCTTCTTTGGAAGGTAGG - Intergenic
915743821 1:158140980-158141002 AGACAGCTGTCTGGGAAGGTTGG + Intergenic
917563923 1:176191655-176191677 TAACTGCTGCCTGTGAAGATTGG - Intronic
918023435 1:180717815-180717837 AAAATGTTTCCTGGGGTGGTGGG - Intronic
920595044 1:207260208-207260230 AAACTGCTTCCTCTATAGGTGGG + Intergenic
921149423 1:212387728-212387750 AAAATGCTTCCATGGAAGGATGG - Intronic
924166273 1:241286588-241286610 AGACTGATTCCTGGGGAGGTAGG - Intronic
1067234799 10:44438549-44438571 AGACTCATTCCAGGGAAGGTTGG - Intergenic
1067655938 10:48191248-48191270 AGGCTGCTTCCTTGGATGGTTGG - Intronic
1069239820 10:66125367-66125389 AAACTGCTTTCTGGGTAGTAGGG - Intronic
1069694414 10:70376408-70376430 CAACTGCTTCCAGGGAAGTTGGG + Intronic
1070094069 10:73319320-73319342 AAACTTCTTCCTGGGGTGCTTGG + Intronic
1071210366 10:83335077-83335099 AAGCTGCTTCCTGGTAACATTGG - Intergenic
1073540758 10:104314942-104314964 AGAGGGCTCCCTGGGAAGGTGGG + Exonic
1074574084 10:114652038-114652060 AAAATACATCCTGGGAAAGTTGG - Intronic
1075139140 10:119815954-119815976 AAACTTGTTCCTTTGAAGGTTGG + Intronic
1076177017 10:128375941-128375963 AAAATGCTGCCTAAGAAGGTAGG - Intergenic
1076588968 10:131570311-131570333 CCACTGCTTCCTGGGAGGGTGGG + Intergenic
1077371150 11:2182217-2182239 AAACTGCATCCAGGGAAGAAAGG + Intergenic
1078364128 11:10692771-10692793 CAACTGTTTCCTGGGCAGGAGGG + Intronic
1079494045 11:21020960-21020982 AAAATCCTTCCTGGTAAGGAGGG + Intronic
1082597053 11:55095424-55095446 AAACTGCTGCCTGAAAAGGATGG - Intergenic
1084257134 11:67950836-67950858 AAAGTGCTGCCTGCGCAGGTTGG - Intergenic
1084815645 11:71644432-71644454 AAAGTGCTGCCTGTGCAGGTTGG + Intergenic
1084935350 11:72583919-72583941 AGACTGCTTCCAGGGAAGAGAGG + Intronic
1085025269 11:73232848-73232870 AACCTGCCTCCTGGGACGTTAGG + Intronic
1085781562 11:79413601-79413623 AAACTGCTTATTAGGAATGTTGG + Intronic
1086545014 11:87957657-87957679 GACCTGCTTTCAGGGAAGGTAGG + Intergenic
1087348622 11:97003239-97003261 AAAATGGTTCCTGGGGAGGCAGG - Intergenic
1090396620 11:126423670-126423692 AGAGTGCTTCCTGGGAAGTGTGG - Exonic
1091658234 12:2361524-2361546 CAACTGCACCCTGGGAAGGAGGG - Intronic
1091800589 12:3322132-3322154 AGCCTTCTTCCTGGGAAGCTGGG - Intergenic
1092818303 12:12330243-12330265 AAACTGCTTCCTGGGAAGGTAGG - Exonic
1093199138 12:16166016-16166038 AAACTACTTCCTGGGAATGAAGG + Intergenic
1094295268 12:28898531-28898553 AAACTTCTGCCTGGGAATCTAGG - Intergenic
1095035702 12:37367106-37367128 AAACTGCTCCCTGAAAAGGAAGG + Intergenic
1095404008 12:41847329-41847351 AAACTGGATCCTTGGAGGGTGGG - Intergenic
1096313951 12:50546981-50547003 AAACTGCTTACTCGGAGGTTCGG + Intronic
1098687058 12:73434950-73434972 AAACTTCTTCCTAAGATGGTTGG + Intergenic
1098893591 12:76032655-76032677 AAGCCGCTTCCTGGGAAGTAAGG + Exonic
1101612335 12:106303045-106303067 GAACTCCATCCTGGGAAGGCGGG + Intronic
1102602603 12:114043495-114043517 AAACTGCTGCCTCGGAGGGAGGG - Intergenic
1103081964 12:118031348-118031370 AAACTGCTGCCTGGGGCTGTGGG + Exonic
1105495030 13:20923000-20923022 GCAGTGCTTCCTGGGAAAGTGGG + Intergenic
1105591953 13:21800401-21800423 GAGCTCCTTCCTGGGCAGGTTGG - Intergenic
1106457818 13:29943013-29943035 ACCCAGCTTCCTGGGAAGATGGG + Intergenic
1107211734 13:37865801-37865823 AAATTGCTTTGTGGGAAGGCAGG - Intronic
1109250293 13:60011339-60011361 AATCTTTTTCCTGGGAAGGAAGG + Intronic
1109970051 13:69756125-69756147 AAGATGCTTCCTGGGAAGGGTGG - Intronic
1111060878 13:83017145-83017167 AAACTGCTACCAGGAACGGTGGG - Intergenic
1112564054 13:100537266-100537288 AAACTGCTTGCTTAGAAGGATGG + Intronic
1112784357 13:102935580-102935602 ACACTGTTTCCAGGGATGGTTGG + Intergenic
1116283916 14:42947096-42947118 AAAATGCTTCCTAGAAATGTTGG + Intergenic
1117258383 14:54003568-54003590 AAAGAGCTCCCTGGGAAGGAAGG + Intergenic
1118400384 14:65374028-65374050 CAACTGGTTCCTCCGAAGGTGGG - Intergenic
1118904554 14:70014202-70014224 AAGCTGCATCCTTTGAAGGTGGG - Intronic
1119194706 14:72708863-72708885 AAGCTGCTGCCTGGGAAGAAAGG + Intronic
1120391010 14:83908719-83908741 AAAGTGCTTCCTAGGAACCTGGG + Intergenic
1120953017 14:90060384-90060406 AAACCGCTCTCTCGGAAGGTGGG + Intergenic
1121010652 14:90518249-90518271 AAACTGCTGGCTGGGCAGGCAGG + Intergenic
1121496046 14:94391786-94391808 AAGCTGGTGCCTGGGAAGGAGGG - Intergenic
1122799149 14:104221201-104221223 AAACTGCCTCCTAGGAAGTCAGG + Intergenic
1124081404 15:26501545-26501567 AAACTGCTTCCTTGAAGGGAAGG - Intergenic
1124795401 15:32773346-32773368 AAACTGCCTCCTGGGGATGGGGG + Exonic
1124989685 15:34659344-34659366 AACCAGCTTGCTGGGAAGGAAGG + Intergenic
1125387746 15:39156127-39156149 AAACTGCTTCCTTGAAAGAGTGG - Intergenic
1128893873 15:71355484-71355506 AAACAACTTCCTGGGTAGATAGG - Intronic
1129554853 15:76497077-76497099 AAACTGCTTCATGGGACAGAAGG - Intronic
1132302943 15:100787749-100787771 AAGCTGCAGCCTGGGCAGGTTGG - Intergenic
1133370876 16:5244757-5244779 AAAGTGCTGCCTGCGCAGGTTGG + Intergenic
1133453772 16:5924735-5924757 AGAATGATTCCTGGAAAGGTAGG - Intergenic
1134124124 16:11604866-11604888 AAACTGCTTCCTGAAGAGGCTGG + Intronic
1134452949 16:14374501-14374523 AAAGTGCTTTCTGGGAATGATGG - Intergenic
1134800348 16:17078577-17078599 AAAACGCCTCCTGGGGAGGTAGG + Intergenic
1136501176 16:30670264-30670286 AGGCTTCTCCCTGGGAAGGTGGG + Exonic
1136513982 16:30756791-30756813 ACACTGCCACCTGGGAAGGGGGG - Exonic
1138337292 16:56263249-56263271 TAACTCCTTTCTGTGAAGGTGGG - Intronic
1140236111 16:73160405-73160427 ACACTGCTTCCTGTGAAAGAAGG - Intergenic
1141823737 16:86464930-86464952 AAATTACTTCCTGGGATGGCTGG + Intergenic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1144024624 17:11267128-11267150 AAGCTGCTTCCTGGAAGAGTTGG - Intronic
1148085649 17:44992279-44992301 AACCTGCCTCCTGGGACTGTTGG - Intergenic
1151256952 17:72885234-72885256 AAACAGCTTCCTATGAAGCTTGG + Intronic
1151335162 17:73435394-73435416 AAGCTGCGTCCTGGGAAGAGGGG + Intronic
1151734029 17:75927625-75927647 GCACTTCTTCCTGGGAAGCTGGG + Intronic
1152055591 17:78023478-78023500 CAAGTGCTTCTTGGGAAGCTAGG - Intronic
1152131438 17:78479305-78479327 CAATTGCTTCATGGGGAGGTAGG - Intronic
1153050217 18:895427-895449 AGACTGCTCTCTGGGAAAGTTGG + Intergenic
1155695386 18:28678984-28679006 AAACTGCTACGTGGTGAGGTTGG + Intergenic
1155890826 18:31266719-31266741 AAACTGCCTGCTGCAAAGGTTGG - Intergenic
1156396940 18:36707305-36707327 AACCTGCTTCCAGGGAAGGCTGG - Intronic
1157492586 18:48134871-48134893 AAACAGCTTCCTGGGCACTTGGG + Intronic
1157583990 18:48789853-48789875 ATGCTGCTTCCTAGGAATGTAGG + Intronic
1158053620 18:53254244-53254266 TAACTTTTTCCTGGAAAGGTAGG + Intronic
1158466301 18:57693311-57693333 AGACTGCTTCCTCCGAAGGCCGG + Intronic
1161517083 19:4702598-4702620 CCACAGCCTCCTGGGAAGGTAGG - Exonic
1162366810 19:10254671-10254693 AAGGAGCTTCCTGGGGAGGTTGG + Intronic
1163152039 19:15421361-15421383 ATACCCCTTCCTGGGAAGGAGGG - Exonic
1163247955 19:16109002-16109024 AAACTGCGGCCTGGGAAGCTTGG + Intergenic
1164151174 19:22552999-22553021 GAACTGCTTCCTGGGCTGGTGGG - Intergenic
1164349434 19:27317684-27317706 AAACTGCTCCATGAGAAGATAGG - Intergenic
1165104309 19:33460033-33460055 CAACTGCTACCAGGGAAGGCTGG - Intronic
1167635046 19:50649431-50649453 TGGCTGCATCCTGGGAAGGTGGG - Exonic
1168714333 19:58518311-58518333 GACCTGCTTCCTGGGCAGGGTGG + Intronic
925698973 2:6613801-6613823 AATCTGCTACCTGGAAAGGAAGG - Intergenic
926766677 2:16328346-16328368 GAAAAGCTTCCTGGAAAGGTGGG - Intergenic
927360203 2:22223932-22223954 AAACTTCTTCCTGGGCATGTAGG - Intergenic
927520575 2:23695839-23695861 ACACTGCTTCTTGGGAGGTTCGG - Intronic
927848706 2:26485616-26485638 AATCTGCTTCCCGGGATGTTAGG + Intronic
928587673 2:32777596-32777618 AAACTCCTTACTGGGCATGTTGG - Intronic
931746835 2:65298353-65298375 AGACTGCTGCCTGGGCAGATGGG + Intergenic
933839893 2:86277954-86277976 AAACTGATTACTTGGAGGGTGGG - Intronic
934574985 2:95394405-95394427 AGACTGCTTCCTGGTCATGTTGG + Intergenic
935469354 2:103438359-103438381 AAACTGCTTTCTGGGAATAAGGG - Intergenic
936154022 2:110036660-110036682 ACAGTGCTTCCTGAGAAGGAGGG + Intergenic
938096161 2:128465554-128465576 AAGCAGCTTCATGGGAAAGTGGG - Intergenic
939952537 2:148491985-148492007 AGAATGCTTCCAGGGAAGGGAGG - Intronic
940683229 2:156812911-156812933 AAACTGCTTCTTTGGAATTTAGG - Intergenic
941092731 2:161196862-161196884 AAATAGTCTCCTGGGAAGGTTGG + Intronic
941996664 2:171607588-171607610 AAGCTGCTTCCTGAGAACGATGG + Intergenic
942885394 2:180917242-180917264 AAAGAGCTTCCTAGGAAGATAGG - Intergenic
943260684 2:185658130-185658152 ATACAGCTTCTTAGGAAGGTGGG - Intergenic
946218389 2:218204351-218204373 AAACACCTTCCTGGGAAGTTTGG + Intergenic
946961515 2:224990568-224990590 AAACTACTTACTGGGGAAGTGGG - Intronic
947379572 2:229532334-229532356 AAACTGGCACCTGGGGAGGTGGG - Intronic
948542609 2:238701329-238701351 AAACTGCTCCCAGGGGAGGCTGG - Intergenic
948896925 2:240931918-240931940 AAGGTGCATCCTGGGAAGGAAGG + Intronic
949062960 2:241971833-241971855 GACCTGCCTCCTGGGAAGTTGGG + Intergenic
1170109575 20:12790400-12790422 AAACGGCTTCCGGGGAAGGACGG - Intergenic
1171034145 20:21703017-21703039 AAGCTGCCTCCTTGGGAGGTGGG + Intergenic
1171271718 20:23823486-23823508 AGACTGCTGCCCGGGAAGCTGGG - Intergenic
1171821542 20:29849348-29849370 AAACTGCTTCATCAAAAGGTAGG - Intergenic
1173420717 20:42898738-42898760 AAACTGGTGCCTGGGAAGGCTGG - Intronic
1173603012 20:44309602-44309624 AAACTGAGGCCTGGAAAGGTAGG - Intronic
1176164806 20:63667329-63667351 AAGCTGCTGCCTGGGATGGATGG - Intronic
1177016951 21:15802863-15802885 AAACTGCTTCTTGAGAAGATTGG + Intronic
1177176150 21:17702623-17702645 TGACTGCTTTCTGAGAAGGTTGG + Intergenic
1177323170 21:19547920-19547942 AAGCTGCTTCCTTGTAAGTTTGG + Intergenic
1177358354 21:20037670-20037692 AAACTACTTCCTGGGTATGCAGG - Intergenic
1181473805 22:23156564-23156586 TGTCTTCTTCCTGGGAAGGTGGG - Intronic
1181572477 22:23775092-23775114 GAAATGCTTCTTGGGAAAGTGGG + Intronic
1182750948 22:32641850-32641872 AAAGTGCTTCCTGAGAAATTGGG + Intronic
1182849551 22:33460391-33460413 AAAGAGCTTCCTGGGTAGTTTGG + Intronic
1185058345 22:48592685-48592707 TAACTCGGTCCTGGGAAGGTTGG + Intronic
1185150154 22:49159610-49159632 CAACAGTGTCCTGGGAAGGTGGG + Intergenic
950494720 3:13326880-13326902 CAAATGCTTTCTGTGAAGGTCGG + Intronic
950750425 3:15123885-15123907 AAAGTGCTGCCTGCGCAGGTTGG + Intergenic
956022413 3:64946713-64946735 AAAATGTATCCTGGGAGGGTGGG - Intergenic
957072075 3:75575316-75575338 AAAGTGCTGCCTGTGCAGGTTGG - Intergenic
958611891 3:96436696-96436718 AAACTTCTGCCTGGGAATCTAGG + Intergenic
960397092 3:117151166-117151188 GACCTGCTTCAGGGGAAGGTCGG + Intergenic
961848820 3:129794413-129794435 TAACAGCTTCTTGGGAAAGTCGG + Intronic
961861494 3:129919934-129919956 AAACTGTTTCCTGTGAAAATGGG - Intergenic
964427762 3:156571244-156571266 AAACTGTTTCGTGGGAAGTAAGG + Intergenic
965239879 3:166182219-166182241 AACCTGCTTCCTTAGAAGTTGGG + Intergenic
966466255 3:180233828-180233850 AAACTTCTGCCTGGGAATCTAGG + Intergenic
967213982 3:187194514-187194536 AAACTGAATCCTGGGAGGGCAGG - Intergenic
967686227 3:192419737-192419759 AAACTGATTGCTGGGGATGTGGG + Intronic
969015666 4:4102637-4102659 AAAGTGCTGCCTGCGCAGGTTGG - Intergenic
969738297 4:9005725-9005747 AAAGTGCTGCCTGCGCAGGTTGG + Intergenic
970266682 4:14296072-14296094 TAACTGAGTCCAGGGAAGGTGGG + Intergenic
972338754 4:38132008-38132030 AAATTGATTCCAGGGAAGATAGG + Intronic
976074161 4:81277845-81277867 AAACTGTTTCCTGGGCTGCTGGG - Intergenic
976397490 4:84571667-84571689 AAACTGCTAGATGGGAGGGTAGG - Intergenic
977263577 4:94827682-94827704 ATACTGCTACATGGGAAGCTAGG - Intronic
978178380 4:105762441-105762463 AAAATGATTCCTGGGTAGATAGG + Intronic
981200383 4:141972900-141972922 AAACTGCTGCCTGGATACGTAGG + Intergenic
981425244 4:144595375-144595397 ACACAGCTTCCAGGGAAGCTGGG - Intergenic
981447070 4:144852187-144852209 AAACCGCACCCTGGGAAGGCTGG + Intergenic
981963322 4:150568993-150569015 AAACTGAGGCATGGGAAGGTTGG - Intronic
985579700 5:690149-690171 AAGGTGTTTCCTGGGAAGGAAGG - Intronic
985594546 5:782208-782230 AAGGTGTTTCCTGGGAAGGAAGG - Intergenic
985675730 5:1230385-1230407 AAGATGCCTCCTGGGAGGGTGGG - Intronic
985693131 5:1324586-1324608 AAATTTCTTACTGGGAAGGGCGG - Intronic
986759710 5:10868768-10868790 CACCTGCTACCTGGGGAGGTGGG + Intergenic
987292537 5:16522252-16522274 GAACTGCTTCTTAGGAAGGGCGG + Intronic
989183300 5:38599245-38599267 AAACTGTTTCCTGGAGAGCTAGG - Intronic
989895245 5:47062546-47062568 AAACTGCTCTCTCGGAAGGAAGG + Intergenic
989902254 5:47194637-47194659 AAACTGCTTTATGAAAAGGTAGG - Intergenic
989907661 5:47283540-47283562 AAACTGCTTTATGAAAAGGTAGG - Intergenic
989921264 5:49807233-49807255 AAACTGCTCTATGGAAAGGTAGG - Intergenic
989929185 5:49924078-49924100 AAACTGCTCTATGGAAAGGTAGG - Intergenic
989933632 5:49990335-49990357 AAACTGCTCTATGGAAAGGTAGG - Intergenic
990978319 5:61578502-61578524 AAACTGATTTATGGGAAGATTGG + Intergenic
991431069 5:66547705-66547727 AAAATCTTTCCTGGGGAGGTGGG - Intergenic
992171666 5:74107906-74107928 AACCTGCTCCCTGGGATGCTGGG - Intergenic
993098258 5:83505795-83505817 AAACTTCTGCCTGGGCAGCTAGG + Intronic
995108888 5:108405858-108405880 GACCTGCTTCAGGGGAAGGTTGG - Intergenic
997441449 5:133911514-133911536 AAAAGGCTTCCAGGGGAGGTAGG + Intergenic
997586988 5:135049078-135049100 GAACTGCTTTATGGGAAGGCTGG + Intronic
997786893 5:136721730-136721752 AATCTGCTTCCTGGGAAGTGAGG + Intergenic
997912533 5:137889872-137889894 ATACAGCTTCTTGGGAAGGCTGG - Intronic
998250627 5:140549797-140549819 AGGCTGCTTCCTGGGAAGACAGG - Intronic
998761934 5:145441860-145441882 AGACTTCTTTCTGGGGAGGTTGG - Intergenic
999619270 5:153455728-153455750 AAAATGCTTCCTGCCAAGTTAGG + Intergenic
1001333216 5:170777010-170777032 AAGCTGCTTCCAGGGAGGGGCGG - Intronic
1001787849 5:174428881-174428903 AAAGTCTTTCCTGGGAAGGATGG + Intergenic
1003200671 6:3957464-3957486 AAACTGATGCCTGAAAAGGTGGG - Intergenic
1003319135 6:5036886-5036908 AAACTGATGCCTGAGAAGTTAGG + Intergenic
1003438962 6:6122054-6122076 AAACAGTTTCCTGGGCAGGAAGG + Intergenic
1003954406 6:11148418-11148440 AAACAGCCTCCTGAGTAGGTGGG + Intergenic
1004249650 6:14013085-14013107 AAACCTCTTCCTGGGAAATTAGG + Intergenic
1005584073 6:27259434-27259456 AAACTGCTCCTGGGGATGGTTGG - Intergenic
1006308889 6:33243229-33243251 AAAGAGCCTCCTGGGGAGGTTGG - Intergenic
1007516956 6:42420163-42420185 AAACTAAGTCCTGGGAAGGGAGG - Intronic
1007690636 6:43699060-43699082 ACACTGCTTCCAGGCTAGGTTGG + Intergenic
1008053572 6:46924052-46924074 AAATTTCTTCCTGAGAAAGTAGG - Intronic
1008376123 6:50794316-50794338 AAACTCGGTCCTGGGAATGTGGG - Intergenic
1009116440 6:59265820-59265842 AAACTGCTCTCTGGAAAGGGAGG - Intergenic
1009748283 6:67848274-67848296 AAACTGCTTCCTTGAAGGGACGG + Intergenic
1013617485 6:111858407-111858429 AAATTGCTTCCTGGGTTGGAAGG - Intronic
1015116032 6:129650494-129650516 AAACTGCTTCCTGAGAGATTTGG - Intronic
1015614464 6:135060608-135060630 AATCTGCTTCCTGCGTAGATAGG + Intronic
1017206727 6:151809931-151809953 AAACTGCTTGATGTGAAGGAAGG + Intronic
1017999699 6:159568367-159568389 AAACTGCTGCCAGGGACTGTTGG + Intergenic
1018923201 6:168189848-168189870 CAGCTACTTGCTGGGAAGGTGGG + Intergenic
1020514968 7:9106767-9106789 AAACTGCTGCCTTGAAGGGTGGG + Intergenic
1020936612 7:14473419-14473441 AAACTGCTTCCTGGGCATCCAGG - Intronic
1021839791 7:24713312-24713334 AACCTGCATCAGGGGAAGGTTGG + Intronic
1023689516 7:42771980-42772002 AAAATGCTTCCTGGGGAAGATGG - Intergenic
1026346815 7:69481670-69481692 AAACTTCTTCCTGAGGAGCTTGG + Intergenic
1029623764 7:101706937-101706959 AAGCTGCTTCCAGGGCAGCTTGG - Intergenic
1029803573 7:102974861-102974883 ATACTGCTGCTTGGGAAGATGGG - Intronic
1032670610 7:134079200-134079222 AGAGTGCTTCCTGAGCAGGTTGG - Intergenic
1034131227 7:148719919-148719941 ATGCTGCTTCCTTAGAAGGTAGG - Intronic
1035051851 7:156003464-156003486 ACGCTGCTCCCTGGGAAGGGAGG + Intergenic
1035739187 8:1913274-1913296 GAACTTCTCCCTGGGAAGGATGG - Intronic
1036257438 8:7217049-7217071 AAAGTGCTGCCTGCGCAGGTTGG - Intergenic
1036309484 8:7675645-7675667 AAAGTGCTGCCTGCGCAGGTTGG - Intergenic
1036360053 8:8070474-8070496 AAAGTGCTGCCTGCGCAGGTTGG + Intergenic
1036829352 8:12010173-12010195 AAAGTGCTGCCTGCGCAGGTTGG - Intergenic
1036890911 8:12596494-12596516 AAAGTGCTGCCTGCGCAGGTTGG - Intergenic
1037806886 8:22062971-22062993 AAACAGCATCCTGGGAACCTGGG - Intronic
1039195824 8:35030522-35030544 AAACTGCTTCTTTGGCTGGTGGG - Intergenic
1040982493 8:53257843-53257865 AAACTTCACCCTGGGATGGTGGG + Intergenic
1042376224 8:68055957-68055979 TAAATGCTTTCTTGGAAGGTAGG + Exonic
1042830407 8:73021313-73021335 ACACTAATTCTTGGGAAGGTGGG - Intronic
1042867376 8:73367715-73367737 CAACATCTTCCTGGGAAGCTGGG + Intergenic
1043841217 8:85107025-85107047 AAACTGCTTCCCGGGCGTGTAGG - Intergenic
1046392990 8:113601647-113601669 GAACTGCTTCCTGGTGAGGATGG + Intronic
1047192776 8:122693410-122693432 AAGCTGCTTCTTGGGCAGGGTGG - Intergenic
1047938000 8:129800608-129800630 AAACTGCTGCCTTGAAAGGAAGG - Intergenic
1048613955 8:136054228-136054250 CAACTGCTTCCTTGTCAGGTGGG - Intergenic
1049942632 9:562393-562415 CAACTGCTTCTGGGGAAGATGGG + Intronic
1050405764 9:5307091-5307113 ACACAGCTGCCTGGGAGGGTGGG + Intergenic
1050659823 9:7872162-7872184 AAACTGCTTTCTGAGCAAGTTGG - Intronic
1054808264 9:69413061-69413083 AAGCTTCTTTCTGGGAAGGAAGG + Intergenic
1055913227 9:81374604-81374626 AAACTGCTGAGTGGGAAGGTGGG - Intergenic
1057405096 9:94762576-94762598 AAACTGTATCCTTGGAAGTTTGG + Intronic
1057880842 9:98791711-98791733 AAACTGGCTCCCGGGAAGGAGGG - Intronic
1060054591 9:120402755-120402777 AAGCTGCTCCCTGGGAGTGTCGG - Intronic
1060563570 9:124568763-124568785 AAACTACCTCCTGTGAAGGTGGG + Intronic
1061238664 9:129356860-129356882 ACCCTGATGCCTGGGAAGGTGGG - Intergenic
1062363076 9:136196733-136196755 AAGCTTCTCCCGGGGAAGGTGGG + Exonic
1186266134 X:7835902-7835924 AAACTGCCTTCTGGGAAGAATGG - Intergenic
1186345875 X:8692594-8692616 GACCTGCTTCTTGGGAATGTTGG - Intronic
1187488640 X:19728670-19728692 ATATTTCTTCCTGGGAACGTTGG + Intronic
1187612953 X:20961838-20961860 AACTTGCTTCCTGGAAAGGAAGG + Intergenic
1189292930 X:39898645-39898667 AATCTGTTACCTGGGAACGTGGG + Intergenic
1191900206 X:66032914-66032936 AAATGGCTTCCTTTGAAGGTAGG + Intronic
1194728227 X:97424339-97424361 ATACTGGTTCTTGGGAATGTGGG + Intronic
1195466643 X:105186471-105186493 TAACTGCTTTCTGACAAGGTTGG + Intronic
1195751674 X:108165642-108165664 AGTCTGCTTTCTGGGAAGGAAGG - Intronic
1196173336 X:112613918-112613940 ACACTGCTTTCTGAGATGGTGGG - Intergenic
1197373032 X:125647580-125647602 AAATTGGTACCAGGGAAGGTGGG - Intergenic
1197734623 X:129841700-129841722 AACCTGCTTTCTGGGGAGTTTGG - Intronic
1198663185 X:138993776-138993798 ATTATGCTTCATGGGAAGGTGGG - Intronic
1199058135 X:143321514-143321536 AAACTGCTTGCAGTAAAGGTTGG - Intergenic
1199250445 X:145655734-145655756 AAACTGCTTCTTGGGTGGGGAGG - Intergenic
1199445474 X:147915670-147915692 AATGTGCTTCCTGAGAAGATTGG + Intronic