ID: 1092821429

View in Genome Browser
Species Human (GRCh38)
Location 12:12357072-12357094
Sequence CCTTCCGGGACGCAGATGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5364
Summary {0: 1, 1: 0, 2: 0, 3: 206, 4: 5157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092821429_1092821438 28 Left 1092821429 12:12357072-12357094 CCGCCCATCTGCGTCCCGGAAGG 0: 1
1: 0
2: 0
3: 206
4: 5157
Right 1092821438 12:12357123-12357145 GTGAAAGCGGCGCCGCCCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 51
1092821429_1092821436 15 Left 1092821429 12:12357072-12357094 CCGCCCATCTGCGTCCCGGAAGG 0: 1
1: 0
2: 0
3: 206
4: 5157
Right 1092821436 12:12357110-12357132 CGTGAACCAGTGAGTGAAAGCGG 0: 1
1: 0
2: 3
3: 27
4: 199
1092821429_1092821433 -10 Left 1092821429 12:12357072-12357094 CCGCCCATCTGCGTCCCGGAAGG 0: 1
1: 0
2: 0
3: 206
4: 5157
Right 1092821433 12:12357085-12357107 TCCCGGAAGGAGCGAGCTTGCGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092821429 Original CRISPR CCTTCCGGGACGCAGATGGG CGG (reversed) Intronic
Too many off-targets to display for this crispr