ID: 1092821479

View in Genome Browser
Species Human (GRCh38)
Location 12:12357290-12357312
Sequence CTGACGCGTCCAGCCCACGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 56}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092821479_1092821482 1 Left 1092821479 12:12357290-12357312 CCTGCGTGGGCTGGACGCGTCAG 0: 1
1: 0
2: 1
3: 6
4: 56
Right 1092821482 12:12357314-12357336 CCCACACATTAGCCTCGCTGCGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092821479 Original CRISPR CTGACGCGTCCAGCCCACGC AGG (reversed) Exonic
900140392 1:1137245-1137267 CTGGCGCCCCCACCCCACGCCGG - Intergenic
900586475 1:3434796-3434818 CTGCCTCGGCCACCCCACGCGGG + Exonic
901049527 1:6419468-6419490 CCGACGCGCCCACCCCACCCAGG + Intronic
901321019 1:8339898-8339920 CAGAAGCCTCCAGCCCACCCAGG + Intronic
903603686 1:24559650-24559672 CAGATGTGTCCAGCCCAGGCAGG - Intronic
904382299 1:30119707-30119729 CTGATGCCTCCAGCCCATGCTGG - Intergenic
904441423 1:30534421-30534443 CTGATGCCTCCAGCCCACGCTGG - Intergenic
905939081 1:41848703-41848725 CTGACTGCTCCAGCCCAAGCTGG - Intronic
920878208 1:209856819-209856841 CTGACGTGTCCATTCCACACTGG + Exonic
923337070 1:232979731-232979753 CTGAGGCATGCAGCCCACACCGG - Exonic
1067271036 10:44791450-44791472 CTGAAGCATCCAACCCACTCAGG - Intergenic
1076643861 10:131937890-131937912 CTGCCCCGTGCAGCACACGCGGG + Intronic
1084338765 11:68478233-68478255 CTGCCGCGCCCGGCCCAGGCTGG + Intronic
1089753328 11:120667444-120667466 CGCACGCGTCCCGCCCACGCAGG - Intronic
1092821479 12:12357290-12357312 CTGACGCGTCCAGCCCACGCAGG - Exonic
1106154885 13:27145035-27145057 CTGCAGGGTCCAGCCCAGGCTGG - Intronic
1107086400 13:36431814-36431836 CTGCGGCGCCCTGCCCACGCTGG - Intronic
1113847684 13:113401887-113401909 CAGGCGCGTCCTACCCACGCGGG - Intergenic
1122900745 14:104781410-104781432 CAGACGCGTCCAGCCCTCCCTGG + Intronic
1125742154 15:41972697-41972719 CTGACGCCTTCAGCCCTCTCTGG - Intergenic
1127856994 15:62961242-62961264 CTGGCCCGTCCAGCACCCGCTGG - Intergenic
1129724998 15:77897196-77897218 GTGGCACGTGCAGCCCACGCTGG + Intergenic
1129977095 15:79831489-79831511 CTGAAGCTTCCAGCTCACGTTGG - Intergenic
1137668850 16:50267517-50267539 CAGACACATCCAGCCCACACTGG - Intronic
1142246111 16:88970821-88970843 CTGTCTCGTGCAGCCGACGCTGG + Intronic
1144722850 17:17484374-17484396 CTGAAGCGGCCAGGCCAAGCTGG - Intronic
1145988269 17:29062061-29062083 CTGACGGATCCAGCCCACCTTGG - Intergenic
1147126715 17:38375059-38375081 CTGAAGCTACCAGCCCAGGCTGG - Intronic
1150429538 17:65104083-65104105 CTGTGGCCTCCAGCACACGCAGG + Intergenic
1160992093 19:1864101-1864123 CTGGCGCGCCCACCCCACGCCGG + Intergenic
1162926244 19:13931808-13931830 CTGCCGTGTCCACCACACGCAGG + Intronic
1163124532 19:15237887-15237909 CGCCCGCCTCCAGCCCACGCAGG + Exonic
926012194 2:9417209-9417231 CTGCCTCGCCCAGGCCACGCTGG + Intronic
928425249 2:31172454-31172476 TTGTCAAGTCCAGCCCACGCAGG - Intergenic
930872551 2:56183899-56183921 CAGCTGCGTCCAGCCCATGCGGG + Intergenic
940316729 2:152335212-152335234 CTGACACTTCCAGCCCTAGCCGG - Intergenic
948854528 2:240723970-240723992 CTGACGCGGGCAGCCCAGGTAGG - Exonic
1173843566 20:46174454-46174476 CTCACCCGCCCAGCACACGCCGG - Exonic
1175314807 20:58039865-58039887 TGGACACGGCCAGCCCACGCTGG - Intergenic
1175783530 20:61698247-61698269 CTGACCATTCCAGCCCATGCCGG + Intronic
1180087522 21:45514602-45514624 CTCCCGCCTCCAGCCCACGCAGG - Exonic
1181590738 22:23883439-23883461 CTCACTGGTCCAGCCCACGCTGG - Intronic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1183323930 22:37181177-37181199 CTGGCCAGTCCAGCCCAGGCGGG - Exonic
961171712 3:124801966-124801988 CTGATGGGACCAGCCCACCCCGG + Intronic
968189884 3:196660042-196660064 CTGACAAGTCCAGCCTCCGCAGG - Exonic
968913789 4:3488370-3488392 CTGATGCCTTCAGCCCACACAGG - Intronic
969320812 4:6411369-6411391 GTGACGCTCCCAGCCCAGGCTGG + Intronic
985824373 5:2181712-2181734 CTGCCGCGTGCAGCAAACGCAGG + Intergenic
986014023 5:3741597-3741619 CAAAGGCATCCAGCCCACGCCGG - Intergenic
1006298069 6:33178869-33178891 CTGTAGCCTTCAGCCCACGCTGG - Intronic
1016894371 6:149037873-149037895 CTGACCCAGGCAGCCCACGCTGG - Intronic
1019437027 7:1027819-1027841 CCGACGACTCCAGCCCACCCAGG + Intronic
1020009083 7:4798758-4798780 CTGAGGCGCCGAGCCCACCCTGG - Intronic
1024053720 7:45646302-45646324 CTGGCGCTGGCAGCCCACGCTGG + Intronic
1033420833 7:141203413-141203435 CTGGAGTGTCCAGCCCACGTGGG - Intronic
1035346746 7:158205170-158205192 CTGAAGCATCCAGCCCAGCCAGG - Exonic
1037819825 8:22130267-22130289 CCGACGCGGCCAGACCACGGCGG - Intronic
1052807205 9:33024244-33024266 CTCACGCAATCAGCCCACGCTGG + Intronic
1056781736 9:89555807-89555829 CTGGCGTGTCCTGCCCATGCAGG + Intergenic
1061945671 9:133907162-133907184 CTGCCGGTGCCAGCCCACGCTGG + Intronic
1062123371 9:134846383-134846405 CTGACTCCTCCAGACCAGGCTGG - Intergenic
1196111709 X:111953592-111953614 CTGAGGCCTCCAGGCCACTCTGG + Intronic
1201187481 Y:11418162-11418184 CTGAAGCGTCCTGCCCACCTCGG + Intergenic