ID: 1092829422

View in Genome Browser
Species Human (GRCh38)
Location 12:12429440-12429462
Sequence ACCCGGGGCAGGATTTGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092829415_1092829422 -3 Left 1092829415 12:12429420-12429442 CCTGTCTTGCTCCTGCTATGACC 0: 1
1: 0
2: 3
3: 62
4: 378
Right 1092829422 12:12429440-12429462 ACCCGGGGCAGGATTTGCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 244
1092829414_1092829422 18 Left 1092829414 12:12429399-12429421 CCATCTTCTTATTTTCTCTGTCC 0: 1
1: 0
2: 3
3: 85
4: 1062
Right 1092829422 12:12429440-12429462 ACCCGGGGCAGGATTTGCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 244
1092829413_1092829422 19 Left 1092829413 12:12429398-12429420 CCCATCTTCTTATTTTCTCTGTC 0: 1
1: 0
2: 4
3: 69
4: 866
Right 1092829422 12:12429440-12429462 ACCCGGGGCAGGATTTGCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092829422 Original CRISPR ACCCGGGGCAGGATTTGCGG TGG Intronic