ID: 1092829561

View in Genome Browser
Species Human (GRCh38)
Location 12:12430507-12430529
Sequence AGGTTTTTACTTATGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 6, 3: 16, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092829557_1092829561 7 Left 1092829557 12:12430477-12430499 CCATATGAACTTTGGTGAGAATT 0: 1
1: 0
2: 1
3: 22
4: 250
Right 1092829561 12:12430507-12430529 AGGTTTTTACTTATGGAGTAGGG 0: 1
1: 0
2: 6
3: 16
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092829561 Original CRISPR AGGTTTTTACTTATGGAGTA GGG Intronic
902188660 1:14744778-14744800 AGTTATTTACTTATGAACTATGG - Intronic
905111923 1:35601517-35601539 AGCTTTCTTCTTATGGTGTAAGG + Intronic
905460681 1:38120886-38120908 AGGGTCTTCCTTATGGAGAAGGG - Intergenic
906008500 1:42501280-42501302 AGTTATTTCCTTATGGATTAAGG + Intronic
907112792 1:51941665-51941687 AGGTTTTGTTTTATGGAGTAAGG - Intronic
907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG + Intergenic
910052860 1:82996531-82996553 AGTTCTTTACCTATGAAGTAAGG + Intergenic
910951931 1:92657814-92657836 AGGCTTTTACTCATTGAGGAAGG + Intronic
911200570 1:95039495-95039517 AGGTTTTTACCTAGGGTGAACGG + Intronic
912123273 1:106501093-106501115 TGGTTATTTCTAATGGAGTAAGG + Intergenic
913061236 1:115210302-115210324 AGGTCTTTACTAATAGATTATGG - Intergenic
918011645 1:180592474-180592496 AGGTTGTGACTTATGAAGCAGGG + Intergenic
919538777 1:198822841-198822863 TGGTTTCTTCTTATGGAGTATGG - Intergenic
921573593 1:216807541-216807563 ATGTTTTTTCTTTTGGAATATGG + Intronic
921800328 1:219395784-219395806 TGATTTTTACATATGGTGTAAGG + Intergenic
922886739 1:229026132-229026154 AGCATTTTTCTTATGGAGAAAGG - Intergenic
923270434 1:232350532-232350554 ACATTTTTACATATGGTGTATGG - Intergenic
1064014803 10:11763498-11763520 AGGTTTTCTCTTCTGGAGGAAGG - Exonic
1064555592 10:16544165-16544187 AGGCTTTTATTTATGTGGTAAGG - Intergenic
1064818866 10:19300684-19300706 TGGTTTTTGAATATGGAGTAAGG - Intronic
1068487918 10:57683071-57683093 AAGTTTGTACTTATGTAGTTGGG + Intergenic
1071130076 10:82380152-82380174 AGCTTTTTACTTATGGCTTCAGG + Intronic
1071264052 10:83948294-83948316 AGGTTATTAACTATGAAGTAAGG - Intergenic
1072171074 10:92862339-92862361 AGGTTTTAACATATGAATTATGG - Intronic
1072583574 10:96761655-96761677 AGATTTATACATATGGAGCAGGG - Intergenic
1073982982 10:109175953-109175975 AAGCTTTTACTCATGGAGGAAGG - Intergenic
1074100240 10:110348963-110348985 TAGCTTTTACTTATGGAGGAAGG + Intergenic
1075512073 10:123080716-123080738 ATATTTTTTCTTATGGAGGAAGG - Intergenic
1075565249 10:123498789-123498811 TTGTTTTTACCTGTGGAGTAGGG - Intergenic
1077845065 11:6014491-6014513 GAGCTTTTACTTATGGAGGAAGG - Intergenic
1082848600 11:57745609-57745631 AGTTTTTTTCTTGTGGAGTTGGG + Exonic
1082862198 11:57867476-57867498 AGGCTTTTACTCATGGTGGAAGG + Intergenic
1082862548 11:57869789-57869811 AAGCTTTTACTCATGGAGGAAGG + Intergenic
1084372687 11:68754428-68754450 AGCTTTTTACTCATGGTGGAAGG - Intergenic
1085008597 11:73118619-73118641 AGGTTTTTCTTTTTGGTGTAAGG + Intronic
1086046277 11:82535588-82535610 AAGGGTTTCCTTATGGAGTACGG + Intergenic
1088425843 11:109701353-109701375 GGGTTTTTATTTATTGAATAAGG - Intergenic
1088452850 11:110000666-110000688 AGGGATTTACTTAAGGAATAGGG + Intergenic
1089575759 11:119441928-119441950 AAGCTTTTACTCATGGAGGAAGG + Intergenic
1091876506 12:3938444-3938466 AGATTTTTACTACTGGACTAGGG + Intergenic
1092829561 12:12430507-12430529 AGGTTTTTACTTATGGAGTAGGG + Intronic
1094290263 12:28840342-28840364 TGGTTTTTATATATGGTGTAAGG - Intergenic
1094408101 12:30140197-30140219 AAGCTTTTACTCATGGAATAAGG - Intergenic
1095364832 12:41390501-41390523 AGTATTTTACTTAGAGAGTATGG - Intronic
1097038693 12:56141336-56141358 AGGTTGTTACATTTGGAATATGG + Intronic
1098768035 12:74514658-74514680 AGCTTTTCACTTCTGTAGTACGG + Intergenic
1101918320 12:108912925-108912947 AAGCTTTTACTCATGGAGGAAGG - Intronic
1103254165 12:119526237-119526259 TGATTTTTATTTATGGTGTAAGG - Intronic
1103730243 12:123022619-123022641 AGTTTCTTACTTGTGGAGTGGGG - Intronic
1104362980 12:128151477-128151499 AGGTCTTTACCTATAAAGTAAGG + Intergenic
1107522494 13:41197242-41197264 AATTTTTTGCTTATGGTGTAAGG - Intergenic
1108034191 13:46270987-46271009 ATGTATTTACTTCTGGATTATGG - Intronic
1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG + Intronic
1111801435 13:92986243-92986265 AAGTTTTTACTCATGGTGGAAGG - Intergenic
1112860140 13:103820081-103820103 AAGTTCTTACTTATGGAAGAAGG + Intergenic
1115131096 14:30053050-30053072 AGGTTATTTCATATGTAGTAAGG + Intronic
1117285297 14:54281186-54281208 TGGTTTTTATGTATGGTGTAAGG + Intergenic
1118260128 14:64238670-64238692 ATGTTTTTACTTTTGGGGGATGG - Intronic
1119796081 14:77398659-77398681 AGGTCTTTAATAATGTAGTAAGG - Intronic
1120794251 14:88614785-88614807 AAGTTTTTACAAATGGAGTTGGG + Exonic
1122414914 14:101544791-101544813 AGGTTTTTACTCGTGGTGGAAGG + Intergenic
1122697971 14:103566727-103566749 AGGTTGATGCTTATGGAGAATGG + Intronic
1124657012 15:31516872-31516894 AGGTTTTTACTTATAGATCCTGG - Intronic
1125044668 15:35231761-35231783 AAGTTTTTACTTATGGTGGCAGG + Intronic
1126654731 15:50965048-50965070 AAGCTTTTACTTATGGAGGAAGG - Intronic
1128399131 15:67259060-67259082 AGGGTATTACTTATAGTGTAAGG + Intronic
1128985692 15:72219315-72219337 AGGTTTTAACTTGTTCAGTAAGG - Intronic
1134377307 16:13689237-13689259 AGTTTTTTACTCATGGAATCTGG + Intergenic
1134653590 16:15929668-15929690 ACTTTTTTTCTTATGGAGGAAGG - Intergenic
1137301137 16:47148806-47148828 AGGTTTTTTTTTTTGGAGGAGGG - Intergenic
1137460729 16:48660520-48660542 AAGCTTTTACTTATGGTGAAAGG - Intergenic
1137866540 16:51902965-51902987 AGGTATTTAATTATGGACAAAGG - Intergenic
1138324418 16:56152067-56152089 AGGTTATAAGTTATGAAGTAAGG + Intergenic
1139141406 16:64267280-64267302 AAGCTTTTACTTATGGTGGAAGG + Intergenic
1140220808 16:73042586-73042608 AGGGTGTTAGTTATTGAGTAGGG - Intronic
1140972803 16:80029584-80029606 AGGATTTTACTCATGGTGGAAGG - Intergenic
1144090845 17:11854893-11854915 AGTTTTATATTTATGGACTAGGG - Intronic
1150969314 17:70009688-70009710 AAGCTTTTACTTATGGTGGAAGG - Intergenic
1153113763 18:1628106-1628128 GGTTGCTTACTTATGGAGTATGG - Intergenic
1154338928 18:13487660-13487682 AGGGTTTTACTTATTTAGTGTGG - Intronic
1155680644 18:28481992-28482014 AGGTTTCCACTTAAGAAGTAGGG - Intergenic
1156282023 18:35648576-35648598 AGGTTTTAACTTATGTGGTTGGG + Intronic
1156696469 18:39773823-39773845 GGGTTTTTACTCATGGTGGAAGG - Intergenic
1157159073 18:45296368-45296390 AGCTTTTTATTCAGGGAGTAAGG + Intronic
1157180499 18:45493727-45493749 AGTTTTTTAGTTATGGATTCTGG + Intronic
1159183185 18:64936982-64937004 AAGTCTTTACTTCTGGAATATGG - Intergenic
1159527198 18:69607605-69607627 AAAATTTTACTTTTGGAGTAGGG + Intronic
1160010023 18:75100293-75100315 AAGATTTTACTTATGGTGGAAGG + Intergenic
1163327298 19:16613335-16613357 AGGTCTTTTCTTGTGGAGAAGGG - Intronic
1168557194 19:57353003-57353025 AGGTTTTTAGTTCTGGGGAAGGG + Intronic
1168665348 19:58200911-58200933 AGCTTTTTACTCATGGTGGAAGG + Intronic
925694357 2:6560104-6560126 AGGTTTTTAAATATGGAATGTGG + Intergenic
928021733 2:27710600-27710622 AGATTTTTACTTAGTAAGTAAGG - Intronic
931596960 2:63957659-63957681 AGGTTTCTACTAATGGATTTGGG - Intronic
931981713 2:67700124-67700146 AGGTTTCTACCTATGGAGCAAGG + Intergenic
933183823 2:79256985-79257007 ACGTATTTACTCATGGAATAAGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
939436648 2:142185643-142185665 AGGGTTTTCCTTATGCAGTGAGG - Intergenic
940075022 2:149731962-149731984 AAGTTTTTGCTTATTGAGAAGGG + Intergenic
942313576 2:174678968-174678990 TGGTATTTACCTATGGAGAAAGG + Intronic
942438644 2:176008214-176008236 ATGTTCTTACATATGGAGAAAGG + Intergenic
942883524 2:180893479-180893501 AAGCTTTTACTCATGGTGTAAGG - Intergenic
943068621 2:183115271-183115293 AGCTTTTTACTCATGGTGGAGGG + Intergenic
943656478 2:190513990-190514012 AGGTTTTTAGTTAAGGCTTATGG - Intronic
943985141 2:194609115-194609137 AGGTCTTTAATAATTGAGTAGGG + Intergenic
944792897 2:203151673-203151695 ATGTGTTTACTTATGAAGGAAGG + Intronic
945936344 2:215906361-215906383 AGGGTTTCACTTATGTATTACGG - Intergenic
947257625 2:228182870-228182892 AGGTTTTTTCTCATGGTGTTTGG - Intergenic
948096412 2:235337759-235337781 GGTTTTTTCCTAATGGAGTAGGG - Intergenic
1168783446 20:514993-515015 AAGATTTTACCTATGGACTAAGG + Intronic
1170340387 20:15320266-15320288 AAATTATTACTTATTGAGTAAGG + Intronic
1171354534 20:24534001-24534023 AGGTTTTTATTCATGGAAGAAGG + Intronic
1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG + Intergenic
1175157639 20:56982682-56982704 AGGTTCTTACTGATGGGGAATGG + Intergenic
1175304026 20:57963787-57963809 AGGATTTTACATATGGCTTAGGG - Intergenic
1175589071 20:60172887-60172909 AGGTTTTTCCTTTCCGAGTATGG - Intergenic
1176929658 21:14793002-14793024 ATTTTTTTATTTATGAAGTAAGG + Intergenic
1177410468 21:20723660-20723682 TAAGTTTTACTTATGGAGTAAGG + Intergenic
1178843830 21:36157817-36157839 ATGTTTTTGCTTATGTGGTAGGG + Intronic
1179914955 21:44470673-44470695 ATGTTTTTAATTGTGTAGTATGG + Intergenic
1182002834 22:26935172-26935194 ATGGTTTTACTTATTGATTAGGG + Intergenic
949212695 3:1524530-1524552 AGTATTTTATTTAGGGAGTAAGG - Intergenic
952558372 3:34559871-34559893 AAGCTTTTACTTATGGTGGAAGG + Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
953949258 3:47175750-47175772 AGGCTTTTACTCATGGTGAAAGG - Intergenic
955680892 3:61500684-61500706 AGATTTTTATATATGGTGTAAGG + Intergenic
955777156 3:62446190-62446212 AGGTTTTTAGTTATTTAGTTAGG - Intronic
957124785 3:76144728-76144750 GGGTTTTAACTTGTGGAATATGG + Intronic
957456178 3:80450303-80450325 AGGTTTTTACTTCTAAAATAAGG + Intergenic
957891565 3:86365435-86365457 GAGCTTTTACTTATGGAGGAAGG - Intergenic
959242320 3:103812556-103812578 CTGTTTTTAATTATTGAGTAGGG + Intergenic
960230465 3:115220204-115220226 AGGTTTTAACTTATGAATTTTGG + Intergenic
963109756 3:141678197-141678219 AGGTTTTTTCTCTTAGAGTAAGG - Intergenic
963112711 3:141700391-141700413 AGGATTTTGCTTTTGGAGGAGGG + Intergenic
966294243 3:178400329-178400351 AAGTTTTTACTCATGGAGGAAGG - Intergenic
967862705 3:194164041-194164063 AGGTTTTTACTTAAGAGGGAGGG - Intergenic
970083558 4:12319116-12319138 AGGTTTTTACTCATGAAGAATGG - Intergenic
971535550 4:27744696-27744718 AGGTTTTCTCTTATGGATCATGG + Intergenic
971800738 4:31286785-31286807 TGTTTTTCAATTATGGAGTAAGG - Intergenic
972919095 4:43916027-43916049 TGATTTTTGCTTATGGTGTAAGG - Intergenic
972943323 4:44223505-44223527 AAGTTTTTACTGATTGAATATGG - Intronic
973121681 4:46528391-46528413 AGGTTTTTAGTTATGGGGTTTGG + Intergenic
973963087 4:56131525-56131547 AGGTTTGTACTTGTGTAGTATGG + Intergenic
975320908 4:73010000-73010022 AGGTGTTTAATTATGCAATATGG - Intergenic
976314518 4:83645032-83645054 ACTTTTTTGCTTATGGAGTGGGG - Intergenic
978543703 4:109847248-109847270 AGGTTTTTAGTTAAAGAGGATGG + Intergenic
978824854 4:113009818-113009840 TGTTTTTTCTTTATGGAGTAGGG + Intronic
979071777 4:116216935-116216957 ATGTTTTTTCTTCTGGATTATGG + Intergenic
980328955 4:131386452-131386474 TAATTTTTACTTATGGTGTAAGG + Intergenic
980804771 4:137797614-137797636 AGGTTTTTACTTACCTTGTATGG + Intergenic
981052502 4:140323294-140323316 AAGTTTTTACTCATGGTGGAAGG - Intronic
981158038 4:141463246-141463268 TGATTTTTGCTTATGGTGTAAGG + Intergenic
981928388 4:150164384-150164406 AGGCTTTTAATTTGGGAGTAGGG - Intronic
983246532 4:165293908-165293930 GGGTTGTTCCTTATGGAGTAAGG - Intronic
983490317 4:168381814-168381836 AGATTTTTTCTTTTGTAGTAAGG - Intronic
983636687 4:169904895-169904917 AGGTGTCTACTAATGTAGTAGGG + Intergenic
986516971 5:8574534-8574556 AAGCTTTTACTCATGGAGAAAGG + Intergenic
990569062 5:57059638-57059660 AGGTTTTAGCTGAGGGAGTAAGG - Intergenic
992925325 5:81578869-81578891 AGATTGTTACTTAGGGAGTGTGG - Intronic
994678222 5:102851781-102851803 ATGTTATTATTTATGGAGAAAGG + Intronic
995240445 5:109880184-109880206 CAGTTTTTACTTGGGGAGTAAGG + Intergenic
995421547 5:111972906-111972928 AGTTTTGTGCTTATGGAATAAGG - Intronic
995468089 5:112471333-112471355 AGGGTTTTACTTGGGGAGTGAGG - Intergenic
995969443 5:117950098-117950120 AGGATTTTCATTATGGAGGAAGG + Intergenic
998515431 5:142749554-142749576 AAGCTTTTACTCATGGAGGAAGG - Intergenic
1001174836 5:169458615-169458637 ATGGTTTTATTTATGGAGTAGGG + Intergenic
1008806213 6:55431771-55431793 AGGTTTTTACTCATGGTGGAAGG - Intergenic
1009525398 6:64738371-64738393 AAGCTTTTACTTATGGAGCAAGG - Intronic
1009681797 6:66903471-66903493 ACATTTTTTATTATGGAGTATGG - Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1012042298 6:94223684-94223706 TGGTTTTTGCCTATGGTGTAAGG + Intergenic
1015847639 6:137537417-137537439 AAGTTTTTCCTTATTGAGAAGGG - Intergenic
1016409791 6:143770623-143770645 AGGTTTATAACTATGAAGTAGGG + Intronic
1017818139 6:158029591-158029613 TGTTTTTTACTTATGGAACAGGG - Intronic
1018655783 6:166034317-166034339 AGATTTTTGTTTATGGTGTAAGG + Intergenic
1021080601 7:16359566-16359588 AGGTTCTCACTTCTGGAGGATGG - Intronic
1022755893 7:33289214-33289236 AAGTTATTACTTTTGGAGTGTGG + Intronic
1022795716 7:33730035-33730057 AGGATTTCACTTATGGATTTGGG - Intergenic
1023383490 7:39631945-39631967 AAGTTTTTACTCATGGAAGAAGG + Intronic
1023603173 7:41900871-41900893 AAGTATTTAATTAAGGAGTAAGG - Intergenic
1025242155 7:57286063-57286085 AGGCTTTCACTCATGGGGTAAGG + Intergenic
1026501764 7:70948697-70948719 AAGTTTCTACTTATGGTGGAAGG - Intergenic
1027957567 7:84900581-84900603 ACGTTTGTACTCATGGCGTATGG - Intergenic
1028265060 7:88713558-88713580 AGGTTGTTACATTGGGAGTAGGG - Intergenic
1028303721 7:89234686-89234708 AGGTGTTTCCTTATGGAATGGGG - Intronic
1028713368 7:93936489-93936511 AGGTTTTCAATGATGGAATACGG + Intergenic
1029034357 7:97503401-97503423 AGCTTTTTACTTATGGCGGAAGG + Intergenic
1029045794 7:97626813-97626835 AGGTGTTTTGTTATTGAGTAAGG - Intergenic
1029955735 7:104637547-104637569 TGATTTTTGCTTATGGAGTACGG + Intronic
1030069076 7:105683367-105683389 AGGTTTTATTTTATGAAGTATGG - Intronic
1030306804 7:108027105-108027127 ATGTTTTTACTCCTAGAGTAAGG + Intronic
1033782339 7:144686233-144686255 AGCATATTACTTATGGAATAAGG + Intronic
1033910019 7:146251799-146251821 AGGTTTTAATTTGTGGAGAAAGG + Intronic
1036138877 8:6188031-6188053 AGATTTTCACATATGGAGTCAGG - Intergenic
1036140800 8:6206459-6206481 GGGTTTTAAATTTTGGAGTAGGG - Intergenic
1036617438 8:10399528-10399550 GGGTTTTTACTTATGGCTGAAGG - Intronic
1039273004 8:35903474-35903496 AGGCTTTTACTCATGGTGGAAGG - Intergenic
1039363868 8:36910019-36910041 GGGATTTTACTTATGTGGTATGG + Intronic
1040406481 8:47108753-47108775 ACATTTTTGCTTATGGAGTGAGG - Intergenic
1042748506 8:72133486-72133508 AGGATTTTGCTTTTGGAGGAGGG + Intergenic
1044122969 8:88420542-88420564 AGGTCTTTCCTTATGTAGTGGGG + Intergenic
1044190715 8:89313559-89313581 TGGCTTTTACATATAGAGTAAGG + Intergenic
1046818044 8:118606993-118607015 AGGTGCTTGCCTATGGAGTAGGG - Intronic
1047580483 8:126209260-126209282 TGATTTTTATTTATGGTGTAAGG + Intergenic
1048598517 8:135892941-135892963 ATGTTCTTACTCATGGAGTGGGG - Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050329020 9:4526754-4526776 AGGTTTTTACTCATGTGGTTTGG + Intronic
1050389146 9:5119623-5119645 AGATTATAACTTATGAAGTAAGG + Intronic
1051099922 9:13509234-13509256 AGGTTTTTAATTATGGTCTTTGG - Intergenic
1052698205 9:31906044-31906066 AAGCTTTTACTCATGGAGGAAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1056191381 9:84187708-84187730 AAGTGTTTACTTATGGTGGAAGG + Intergenic
1056728976 9:89147587-89147609 AGGTTTTTACTCGAGGAGTGAGG - Intronic
1058844234 9:108940045-108940067 ATGTATTTACTTCTGGATTATGG - Exonic
1062277671 9:135738421-135738443 AGGTTTGTTCTTCTGGAGTGTGG + Intronic
1185745552 X:2569869-2569891 AAGCTTTTACTCATGGAGGAAGG + Intergenic
1185917203 X:4048560-4048582 ACATTTTTACTTAAGCAGTAGGG + Intergenic
1186687986 X:11945621-11945643 AAGTTTTTACTCATGGTGGAAGG + Intergenic
1188754122 X:33939200-33939222 AGCTTTTTACTCATGGTGAAAGG - Intergenic
1194853078 X:98892627-98892649 AAGTTTTTACTCATGGTGGAAGG - Intergenic
1195509411 X:105696986-105697008 AAGCTTTTACTCATGGAGGAAGG + Intronic
1196262389 X:113598924-113598946 ATTCTTTTACTTATGTAGTAAGG + Intergenic
1196306258 X:114106747-114106769 AGGTTTTGCCTTTTGGAGTCAGG - Intergenic
1197849926 X:130846879-130846901 AGCTTTCTGCTTATGAAGTATGG - Intronic
1198992187 X:142527257-142527279 AGTTGATTACTTATGAAGTAAGG - Intergenic
1200875640 Y:8151755-8151777 AGGTTTTTACTCCAGGAGTCAGG + Intergenic
1200927858 Y:8670701-8670723 ATGTTTTTTCTTATTGTGTAGGG + Intergenic
1201720217 Y:17088999-17089021 GAGTTTTTATTTATGGAGGAAGG + Intergenic
1201743266 Y:17345596-17345618 AGGATTTTGCTTTTGGAGGAAGG + Intergenic
1201970693 Y:19790822-19790844 AAGTTTCTAATTATGGAATATGG - Intergenic
1202203048 Y:22374600-22374622 AGGTTTTTACTCCAGGAGTCAGG - Intronic