ID: 1092830714

View in Genome Browser
Species Human (GRCh38)
Location 12:12441871-12441893
Sequence TTGAGAAATGTGAAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092830712_1092830714 -6 Left 1092830712 12:12441854-12441876 CCTGGGGAACATGGGTCTTGAGA 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1092830714 12:12441871-12441893 TTGAGAAATGTGAAGCTGGATGG 0: 1
1: 1
2: 2
3: 24
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092830714 Original CRISPR TTGAGAAATGTGAAGCTGGA TGG Intronic
900825342 1:4921655-4921677 TTGAGATATGTGAGTGTGGATGG - Intergenic
901074617 1:6545750-6545772 TAAAGAAATGTGAAGCAGGCTGG + Intronic
904173838 1:28611240-28611262 TTGGGGAATGTGAAGCAGAATGG + Intronic
904398931 1:30243097-30243119 TTTAAAAATGTAAACCTGGAAGG - Intergenic
905431019 1:37923737-37923759 TTCAGAAATATGAAAATGGAGGG + Intronic
905917543 1:41696117-41696139 TTGACAAATGTGAGGCATGAGGG + Intronic
907192509 1:52661113-52661135 TGGTGAAAGATGAAGCTGGAAGG + Intronic
907443338 1:54491509-54491531 TAGAGAGAGATGAAGCTGGAGGG + Intergenic
907490632 1:54806776-54806798 TGGAGAAAAATGAAGCTGGGAGG + Intronic
910502837 1:87913434-87913456 TTGAAAAATCTGTAGCTAGATGG - Intergenic
910876495 1:91883754-91883776 TTGACAAATGTCAAACTGAAGGG + Intronic
913259410 1:116984964-116984986 TTTATAACTGTGAAGATGGATGG + Exonic
913271039 1:117093935-117093957 TTGAGAAAACTGCAGCAGGAGGG - Intronic
914684458 1:149965924-149965946 TTCAGAAATAGGAAGGTGGAAGG - Intronic
914838910 1:151231587-151231609 TTCAGAAAGGGGAAGCTAGAAGG - Intronic
914978650 1:152392203-152392225 TTGAGAAATGTGGAGTGAGATGG - Intergenic
915553363 1:156647640-156647662 ATGAGCAATGTGATGCTGGCTGG + Exonic
915813275 1:158938647-158938669 TTGATAAATCTGAAACTTGATGG - Intronic
915879578 1:159652808-159652830 TTGATTAATGTGAAGAAGGATGG - Intergenic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
917355107 1:174119344-174119366 TTGGGAAAAGTGAAGGTGAAAGG + Intergenic
918595009 1:186282984-186283006 TGGAAAAAGGTGAAGCTGTAGGG + Intergenic
919480664 1:198084971-198084993 TTGAGAAATATAAAGCAAGAAGG + Intergenic
919506612 1:198406715-198406737 TTAAGAAATGTCAGGTTGGAGGG + Intergenic
920153590 1:203929862-203929884 TTGAGTAATGAGAAGCTGTGGGG + Intergenic
920975276 1:210780042-210780064 TTGAGAAAGCTGAAGGTGGGTGG + Intronic
921296044 1:213704989-213705011 CTGAACAATCTGAAGCTGGAGGG + Intergenic
921608160 1:217179104-217179126 GTGGGGAATGTGAAACTGGAAGG - Intergenic
1063212072 10:3889958-3889980 TGGAGAAATGTGAAGCCAGCAGG - Intergenic
1063538447 10:6908561-6908583 TTGAGAAAGCAGAAGCAGGAAGG + Intergenic
1064447358 10:15407518-15407540 TTGGTAAAATTGAAGCTGGAAGG - Intergenic
1064631717 10:17321050-17321072 TGTAAAAATGTGAAGCTGTATGG - Exonic
1066406528 10:35124533-35124555 TTGAGAAATCTGAAGGTGAGGGG + Intergenic
1066640286 10:37548541-37548563 TTAAGAAATGGGAAGTTGGTGGG + Intergenic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1068064976 10:52119484-52119506 TTGAAAAATGTTAAGTTGCATGG - Intronic
1068092654 10:52451999-52452021 TTGAGAAATGAGAGGATAGAAGG - Intergenic
1068636447 10:59353232-59353254 TTGAGAAAATTGTAACTGGAGGG - Intronic
1069687880 10:70330726-70330748 TTCTGAGAAGTGAAGCTGGATGG - Intronic
1069802586 10:71091284-71091306 TTAGGAGATGTGAAGATGGAAGG + Intergenic
1070648936 10:78221190-78221212 TTGGGAAAGCTGAGGCTGGAAGG + Intergenic
1070984225 10:80674208-80674230 TTGTGAAATGTGGAGGTGGGAGG - Intergenic
1072424490 10:95318327-95318349 TGGAAAAATGTGACGATGGATGG - Exonic
1073446084 10:103581182-103581204 GTGAGAAATTTGAGGCTGGGAGG + Intronic
1074162658 10:110846900-110846922 TGGGGAAATGTGGAGCTGGAAGG - Intergenic
1074719018 10:116248698-116248720 TTGAGAAAACTGAGGCTGGTGGG + Intronic
1075368025 10:121910299-121910321 TCGTGAAATGTGAAGTTGGATGG - Intronic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1076564397 10:131388276-131388298 TTCAGATATGTGAAGCTGAAGGG - Intergenic
1078116099 11:8452537-8452559 TTGGGAAAGGAGAGGCTGGAGGG + Intronic
1078501216 11:11879487-11879509 TTGAGAAAGTTTAAGCAGGAAGG + Intronic
1079436130 11:20453001-20453023 TTGAGAAAGGTTAAGATGCAGGG - Intronic
1079554064 11:21737936-21737958 TTATGAAATCTGAAGCTGAAAGG + Intergenic
1081669634 11:44935789-44935811 TTGAGAAATGTGAATAGGGGCGG - Intronic
1082756703 11:57083708-57083730 GAGAGAAATCTGCAGCTGGATGG + Intergenic
1085226241 11:74923707-74923729 TAGTGATATGTGAACCTGGAGGG - Intronic
1085655419 11:78310144-78310166 CTGAGAAATGTGGGGGTGGAGGG + Intronic
1086880235 11:92145280-92145302 TTGAGATAAATGAAGCTGGATGG + Intergenic
1088314550 11:108494771-108494793 TTGAAATATGTCAAGATGGAAGG - Intronic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089413444 11:118266571-118266593 TTGGGAAATGTGTAGATGGATGG - Intergenic
1090698952 11:129278387-129278409 TTGTGAAACTTGAAGATGGAAGG - Intronic
1092808054 12:12245727-12245749 TTGAGAAAGTTGAAGCTGTTGGG + Intronic
1092830714 12:12441871-12441893 TTGAGAAATGTGAAGCTGGATGG + Intronic
1093163110 12:15772292-15772314 TTGGGAAATGTGAAGTCTGAGGG + Intronic
1093425207 12:19020916-19020938 TTGAGAAATTTGAACATTGAAGG - Intergenic
1094413039 12:30188479-30188501 TAGACAAGTGTGATGCTGGAAGG + Intergenic
1095194071 12:39291880-39291902 ATAATAAATGTGAAGCTGTAAGG + Intergenic
1095932885 12:47646831-47646853 TTTAGAAAGATGAAGGTGGAGGG - Intergenic
1096373233 12:51085623-51085645 TTTAGAAGTGAGAGGCTGGATGG + Intergenic
1097204005 12:57304555-57304577 TGGAGAACTGGGAAGGTGGATGG + Intronic
1097528449 12:60767978-60768000 TAGAGAAATATAAAGCTGGCAGG + Intergenic
1098986841 12:77021545-77021567 TTGAGAAATGTAAACTTGGTAGG + Exonic
1099373755 12:81870918-81870940 TTTAAAAATATGAAGTTGGATGG + Intergenic
1100282279 12:93129104-93129126 TTGAAAAATGTGAAGCAGGAAGG + Intergenic
1100932089 12:99620553-99620575 TTGAGAAATTTGAAATTGAAAGG + Intronic
1101010973 12:100448813-100448835 TAGAGAAATTTGAAGTTGGCCGG + Intergenic
1101328217 12:103735552-103735574 GTGTGAAATGTGGAGCTGGCAGG + Exonic
1103581071 12:121915993-121916015 TTGTTAAACATGAAGCTGGAGGG + Intronic
1104387721 12:128365539-128365561 TTCAGAAATGTGAATTTGGTCGG - Intronic
1104689216 12:130812377-130812399 TGGAGAACTGTGGAGCTGGGGGG + Intronic
1105989312 13:25602624-25602646 TTGAGCAGTGTGTGGCTGGAGGG + Intronic
1106065140 13:26340595-26340617 TTAAGAAATGTAAAGGAGGAAGG - Intronic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107077694 13:36340971-36340993 TTGAAAGATGGGAAGATGGATGG + Intronic
1107511786 13:41092714-41092736 TTAAGAATTGTGAAGATGGCCGG + Intergenic
1107541492 13:41393401-41393423 TTGAGATATTTGAAACTAGAGGG + Intergenic
1107840897 13:44456567-44456589 TTGTGAAAGGTGAAGCCGGCTGG - Intronic
1108014896 13:46064379-46064401 TTTAGAATTTTGAAGCTAGAAGG + Intronic
1108505491 13:51108920-51108942 TTGAGCTATCTGAAGATGGAGGG - Intergenic
1109230202 13:59747606-59747628 CTGAGAAATATCAAGCTGGAAGG + Intronic
1109704477 13:66072055-66072077 TTCTGACTTGTGAAGCTGGATGG + Intergenic
1109995665 13:70121581-70121603 TTCAGAAATAAGAAGCTGGAGGG + Intergenic
1110070631 13:71172503-71172525 TTGCTAAATTTGAAGATGGAAGG - Intergenic
1110763722 13:79258628-79258650 TTGCACAATGTCAAGCTGGATGG - Intergenic
1111710249 13:91802710-91802732 TAGTGAAAGGTGAAGCTGGCTGG - Intronic
1112012382 13:95302830-95302852 ATGAGGAAGGTGAAGCTGAAAGG + Intergenic
1112178832 13:97056298-97056320 TTTAAAAATGTAAACCTGGAAGG + Intergenic
1112572559 13:100607185-100607207 TTAAGGAATGCGAAGGTGGATGG - Intronic
1112659896 13:101496012-101496034 TTGTGGAATTTGAAGCTGGTGGG - Intronic
1112980487 13:105378461-105378483 TTGTGAAATGTGAAATTGAATGG - Intergenic
1113895514 13:113761562-113761584 TTCTGAGATGTGAAGCTGAAGGG - Intronic
1115300609 14:31881130-31881152 CTGAGAAAAGTTGAGCTGGAAGG + Intergenic
1115851730 14:37594947-37594969 TTAGGAACTGTGAAGATGGAAGG - Exonic
1117616412 14:57538007-57538029 GTGAGAAAAGTGAAGCTGACAGG - Intergenic
1118333332 14:64831227-64831249 TTGAGGAATGGGCAGCAGGAAGG - Intronic
1118509463 14:66455130-66455152 TTGAGAATTTTGAAGAAGGAGGG + Intergenic
1118542881 14:66849862-66849884 TTGAGAAATGAGAAAATGAATGG - Intronic
1120375027 14:83694048-83694070 ATGATTAATATGAAGCTGGAGGG + Intergenic
1121241138 14:92430815-92430837 TGCAGAAATCTGAAGGTGGAGGG - Intronic
1121686008 14:95835740-95835762 GTGAGAGATGCCAAGCTGGAAGG + Intergenic
1122362252 14:101174407-101174429 TGGAAAAAAGTGAAGTTGGAGGG - Intergenic
1124927787 15:34088644-34088666 TTCAGAAATGAGAACATGGAAGG + Intronic
1124939296 15:34203195-34203217 TTGAGAAATTGGAAGGAGGATGG - Intronic
1126508404 15:49436395-49436417 TTGATAAAAGGAAAGCTGGAAGG - Intronic
1127325490 15:57890794-57890816 TTCAGACATGTGAAGCTTGTTGG - Intergenic
1127445745 15:59061358-59061380 TGGATAAGTGTGAAGCTAGATGG - Intronic
1128296614 15:66526058-66526080 TAGAAAAATGTGAAGATGGTTGG - Intronic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1129139385 15:73583401-73583423 TTGAGAAAATTGAGGCTTGAGGG - Intronic
1131296634 15:91155122-91155144 TAGTGAAAGGTGGAGCTGGAAGG - Intronic
1131799384 15:96053613-96053635 TTTATAAAGGTGAAACTGGAGGG - Intergenic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133399750 16:5476852-5476874 TTGAGAAAGGTTAACTTGGAGGG - Intergenic
1133834940 16:9359506-9359528 GTGAGAAAGGTGAAACAGGAGGG - Intergenic
1134673798 16:16075326-16075348 TTTAGAAGTGTGGAGCTGGCCGG + Intronic
1136050421 16:27646303-27646325 TTGAGGGATGTGAAGCTAGAGGG - Intronic
1141041888 16:80679635-80679657 TTGTGAAATGAAAAGCTGTAAGG - Intronic
1141112937 16:81285134-81285156 ATGAGAAATGGGAAGCTGGCTGG - Intronic
1144270259 17:13608446-13608468 TTGAGAAACGTGGGGCAGGAGGG + Intergenic
1144994838 17:19260370-19260392 CTTCCAAATGTGAAGCTGGAGGG + Intronic
1146110484 17:30084690-30084712 GAGAGAAATGTGAATCTGGAGGG - Intronic
1147433604 17:40391572-40391594 CTGGGAAATGTGTAGCAGGAGGG + Exonic
1147453700 17:40521453-40521475 TTCAGCAACATGAAGCTGGAAGG - Intergenic
1147618811 17:41848213-41848235 TTGAGGAATATGCAGCTAGACGG + Exonic
1149011923 17:51865665-51865687 TTCAGAAATGAGAAGATGGGTGG + Intronic
1150047550 17:61928102-61928124 TTTAGAAATGTGATTCTGGTAGG + Intergenic
1153736234 18:8071266-8071288 TAGAGAAATGTAAGGCAGGAAGG - Intronic
1155699127 18:28721558-28721580 TTGATTAATGAGAAGATGGAAGG - Intergenic
1155936720 18:31762393-31762415 TTTAGAAATGTGAAGGCAGATGG - Intergenic
1156877033 18:42026936-42026958 TTGAAAAACGGGAAACTGGATGG + Intronic
1157591011 18:48836473-48836495 TTGAGGTGTGAGAAGCTGGAGGG - Intronic
1158092743 18:53734177-53734199 GTGATAAATGGGAAGCTGAATGG + Intergenic
1158849905 18:61485321-61485343 TTCAGAAATGTTAAGTTGGGAGG + Intronic
1159086336 18:63795903-63795925 TTGAAAAATTTGCAGCAGGAAGG + Intronic
1159598497 18:70406224-70406246 GTGAGAAATGGGGAGATGGAGGG + Intergenic
1161171609 19:2815085-2815107 TTCAGAAAAGAAAAGCTGGAAGG + Exonic
1161204596 19:3034421-3034443 TGGAGGAAGGTGAAGCTGGCTGG - Intronic
1163776873 19:19224153-19224175 TTGACAACTGTGATGCTGGCTGG + Exonic
1165307158 19:35009855-35009877 TTGAGAGGTGAGAACCTGGATGG - Intronic
1168472276 19:56649486-56649508 TGGAGAAAAATGAAGCAGGAAGG + Intronic
925254554 2:2472040-2472062 TTCAAAAATGTGAAGCTGGTGGG + Intergenic
925595154 2:5548273-5548295 TTGAGAAAACTGAGGCTGGGAGG + Intergenic
926538253 2:14141488-14141510 TTGAAAACTGGGAAACTGGAAGG - Intergenic
927476421 2:23417702-23417724 CAGAGAAAAGTGAGGCTGGAGGG - Intronic
927786697 2:25979856-25979878 TTCAGAACTGTGACCCTGGATGG + Intronic
930991876 2:57665990-57666012 TTGACAAATGCTAAGTTGGAGGG - Intergenic
932018129 2:68053839-68053861 TTGAAAAAAGTGGAGTTGGAAGG - Intronic
932531304 2:72536357-72536379 TTCAGAAATATGATGCTGGGGGG - Intronic
933264533 2:80168203-80168225 CTGAGAGCTGTGAGGCTGGAGGG - Intronic
933279594 2:80318360-80318382 TTGAGAAATTTCAAACTAGAAGG - Intronic
935040124 2:99418283-99418305 GTGAGAAAGGTTAAGATGGAAGG + Intronic
935347481 2:102121953-102121975 TTTAAAAATGTGAAGCTGCCAGG + Intronic
935812062 2:106808244-106808266 TGGAGAAGTGTGAAGCTCAAGGG + Intronic
936472502 2:112811585-112811607 TTGGGAGGTGTGAACCTGGAGGG + Intergenic
937222169 2:120347916-120347938 GTTAGAAATGTGATTCTGGAAGG + Intronic
937415637 2:121712343-121712365 TAGAAAAATGTGAAACTGAATGG - Intergenic
937503466 2:122509556-122509578 ATGAGAAAAGTGGAGCTGGGTGG - Intergenic
937713906 2:125010272-125010294 TTGAGAAGGTTGGAGCTGGAGGG + Intergenic
937994202 2:127680716-127680738 TGGAAAATTGTGAAGCTCGATGG - Intronic
938759544 2:134411667-134411689 TTTAGAAAGGTTCAGCTGGAGGG - Intronic
940255505 2:151724116-151724138 TTGAGACATGTGAGACTGCAGGG - Intronic
941132808 2:161674931-161674953 TTGAGAAATGTCATGCTTAAAGG - Intronic
942231245 2:173862627-173862649 TGGAGGAATGTAAAGCAGGAAGG + Intergenic
942930295 2:181484056-181484078 TTGAGAAATGAGAGGTTAGATGG - Intronic
942996137 2:182263054-182263076 ATGAGCAATGTTAAACTGGATGG - Intronic
943078691 2:183230348-183230370 TAGAAAAATGTGACCCTGGATGG - Intergenic
943811375 2:192194069-192194091 TTGAGAAATATTAAACGGGATGG - Intronic
944171234 2:196780453-196780475 TTAAGAAATGTGAAACTCTAGGG + Intronic
944285749 2:197948105-197948127 ATGAGAAATGAGAAACAGGATGG + Intronic
944651382 2:201833840-201833862 TTGAAACATGAAAAGCTGGAAGG - Exonic
945150210 2:206783030-206783052 TTCAGAAATCTAAATCTGGAGGG - Intronic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1170582389 20:17709269-17709291 TGGAGACATGTGGACCTGGAGGG + Intronic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1172346555 20:34205940-34205962 TTGTGAGAGGTGAAGCTGGCTGG - Intronic
1172356797 20:34285801-34285823 TTAAGAAATGTTGAGCTGGCCGG + Intronic
1172873569 20:38150676-38150698 TTGGGAACTGTGAAGCTGGTTGG - Intronic
1173074802 20:39807488-39807510 ATGAGACATGAGAAGCTGAATGG + Intergenic
1173453743 20:43188287-43188309 TTGAGGTGTGTGAAGCTGAAAGG - Intronic
1174115263 20:48222632-48222654 TGGAGAAACGTAAAGCAGGACGG + Intergenic
1174392047 20:50223729-50223751 TTGGGAAATGGGAAGATGCAGGG + Intergenic
1177244185 21:18501401-18501423 TTTAGAAATATGAAACAGGATGG + Intergenic
1178288276 21:31344168-31344190 TTGGGACATGTGAAGCCAGACGG - Intronic
1178307154 21:31500355-31500377 TTCAAAAAGGTGAAGCTGCAAGG + Intronic
1178597628 21:33968930-33968952 TAGATTAATATGAAGCTGGAAGG - Intergenic
1178885317 21:36480261-36480283 TGGTGGAATGTGGAGCTGGACGG + Intronic
1179091630 21:38271276-38271298 TTGAGAAAACTGAAGCTCGGAGG + Intronic
1179506226 21:41843609-41843631 GTGAGCAATGTGAGGCTGCAGGG + Intronic
1180015445 21:45079771-45079793 TAGAGAAAGGTGAATATGGATGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180749124 22:18111928-18111950 CTGACAAAACTGAAGCTGGAAGG - Intronic
1182051600 22:27316524-27316546 TGAAGAAATATGAAGCAGGAAGG - Intergenic
1183131864 22:35844832-35844854 TTCAGAAATCTGAAGCTGAAAGG + Intronic
1183133073 22:35858505-35858527 GTGAGAAATAGGAAGATGGATGG - Intronic
1183860783 22:40668402-40668424 TTTAGAAGTGTGTAGCTGGCCGG + Intergenic
1184098798 22:42330794-42330816 TTCAGAAACTTGAAGCTGCAAGG + Intronic
1184533814 22:45072881-45072903 GTGAGAAACCTGAGGCTGGAAGG + Intergenic
949304375 3:2623141-2623163 TTGAAAAACGTGAAGATGAAAGG - Intronic
950546948 3:13643878-13643900 TTTAGAAATGTGATGGTTGACGG - Intergenic
950576315 3:13834141-13834163 TTGAGAAATCTGAATCAGGCAGG + Intronic
951432045 3:22619894-22619916 GAGAGAAATTTGCAGCTGGAAGG + Intergenic
951815574 3:26750457-26750479 TGCAGAAATGGGGAGCTGGAGGG - Intergenic
952653299 3:35752356-35752378 TGAAGAATTGTGAAGTTGGAGGG + Intronic
953105069 3:39869901-39869923 ATGAGATATGTCAAGGTGGAGGG + Intronic
953126229 3:40094048-40094070 TTGGGACATGTGAAGGGGGAGGG - Intronic
953683156 3:45055149-45055171 CTGAGAGATGTGATTCTGGAAGG + Intergenic
954284831 3:49611534-49611556 TTGGGAAATGTGAAGAGGGCTGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
957377612 3:79378911-79378933 ATGAGGAATGTGAAGCTCCAGGG - Intronic
958681634 3:97339463-97339485 TTGTAAAATGTTAAGATGGAAGG - Intronic
958912073 3:100005322-100005344 TTGAAAAAGGTGAAGCTGGGAGG + Intronic
959037243 3:101382282-101382304 CTAAGAAAGCTGAAGCTGGAAGG - Intronic
959512672 3:107232177-107232199 AGGAGAAAAGTGAAGTTGGAGGG - Intergenic
960373303 3:116867605-116867627 TTTTGAAATGTGAAGATGGCTGG + Intronic
962307175 3:134299296-134299318 AGGATAAATGTGAAGCAGGAAGG + Intergenic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
963092133 3:141492985-141493007 TATAGAAATTTAAAGCTGGAAGG + Intronic
963398114 3:144758493-144758515 TTGATAAATGTTATTCTGGAAGG + Intergenic
963716501 3:148810180-148810202 TTGAGATGTGGCAAGCTGGAAGG - Intronic
964034644 3:152180956-152180978 TTGAGAAAAGTGAAAATAGATGG - Intergenic
964155515 3:153580799-153580821 TCAAGAAACCTGAAGCTGGAGGG + Intergenic
964465059 3:156982976-156982998 TTTAGAAATGTGAATTAGGAAGG - Intronic
965114820 3:164476328-164476350 TTGAGCAGTGTGATGTTGGAGGG - Intergenic
966950737 3:184814628-184814650 TTGAAAAATGTGAACCTGTGTGG + Intronic
967263698 3:187671146-187671168 CTGAGAAATTTAGAGCTGGAAGG + Intergenic
967441616 3:189515469-189515491 TTCAGAATTGTAGAGCTGGAAGG + Intergenic
967598252 3:191353399-191353421 TTGAGAAATGGGAGGGTGAAAGG + Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969268092 4:6079027-6079049 TTGTGAGATGTGAGGCTGGCTGG - Intronic
969329957 4:6468861-6468883 TTGAGAAATGTCTAACTAGATGG + Intronic
969819001 4:9706789-9706811 TTTAGAAATGTTAAGCTATATGG - Intergenic
969922849 4:10557257-10557279 TAGAGAAGGGTGAAGGTGGAGGG - Intronic
970305932 4:14732879-14732901 TGGAGAAAAGCAAAGCTGGAAGG + Intergenic
970369871 4:15395813-15395835 ATGAGAAAAATGAAGCTGGGAGG + Intronic
970565396 4:17327243-17327265 CTGACAAATGTGACTCTGGAAGG - Intergenic
970839016 4:20444759-20444781 TGGAGAATTGTGAAACTGGCAGG - Intronic
971201671 4:24514931-24514953 ATGAAAAGTGTGAAGCAGGAGGG + Intergenic
971451896 4:26808434-26808456 TTAAGAAATTTGAAGCTGGCTGG + Intergenic
972860460 4:43162576-43162598 TAGAGAAATGTGAAATTGAATGG + Intergenic
973254051 4:48091301-48091323 CTTAGAAATGTGAAGCATGATGG + Intronic
973718025 4:53696628-53696650 ATGAAAAAAGTGAAGCTGGGAGG + Intronic
973968330 4:56186133-56186155 CAGAGAAATGGGAAACTGGATGG + Intronic
974015259 4:56643392-56643414 TGGAGAGTTGTGAAGATGGAGGG - Intergenic
974090730 4:57308005-57308027 TTGATAAATGTGTATTTGGATGG - Intergenic
974600290 4:64071045-64071067 TAGAGATATCTGAAACTGGAAGG + Intergenic
974713420 4:65633472-65633494 TTAATAAATGGGAAGATGGAAGG + Intronic
975217494 4:71772430-71772452 ATGAGAAATCAGAATCTGGAAGG - Intronic
975988239 4:80226755-80226777 AGGAGAAATGTGATGCAGGATGG - Intergenic
976046134 4:80950292-80950314 TTGAGAACTATGAAGCTTAAAGG + Intronic
976607157 4:86994824-86994846 TAGAGAACTGTGGGGCTGGAGGG + Intronic
976991029 4:91366493-91366515 TTGAGAAATATGAATCCTGATGG - Intronic
977439087 4:97038701-97038723 TCAAGAAATGTGAAGCAGAATGG + Intergenic
978118117 4:105046953-105046975 TTGTGATATGTAAAGCTGAAAGG + Intergenic
978995087 4:115140768-115140790 TTCAGAAATGCGGAGGTGGAAGG - Intergenic
979193177 4:117888709-117888731 TAGTGCAATGTGAAGCTGGTTGG + Intergenic
979719486 4:123882288-123882310 GAGAGAAATGTGAGGATGGATGG + Intergenic
979874603 4:125872085-125872107 TTTAGAAATGTTAAGCTGCATGG - Intergenic
980195214 4:129578975-129578997 TTAAAAAATGTGGAGCTGGAGGG - Intergenic
980202453 4:129674126-129674148 TTGAGAAATATAAAAATGGAAGG - Intergenic
981161296 4:141502244-141502266 CACAGAAATGTGAAGCTGAATGG + Intergenic
981624011 4:146736087-146736109 TGGAGAAATGTGAAGGTTGGAGG + Intronic
981858712 4:149328211-149328233 TAGAGAAAAGTGAATCTGGGTGG + Intergenic
981875662 4:149541475-149541497 TTTAGAAATGTGAACTTTGAAGG - Intergenic
982207342 4:153006470-153006492 CTGAGAAAAATGAGGCTGGAAGG + Intergenic
983101026 4:163625822-163625844 TTAACAATTTTGAAGCTGGAAGG + Intronic
983284239 4:165719260-165719282 TTGAGAAAAATCAATCTGGAAGG - Intergenic
983922209 4:173358180-173358202 TTGAGCAATGTGTAGCTTGCAGG + Intergenic
985258375 4:188091848-188091870 TTGAGACATGGGCAGCAGGATGG - Exonic
985560685 5:584478-584500 TAGATAAATGGGCAGCTGGAAGG + Intergenic
986003380 5:3647914-3647936 TTCAGAGATGTGCAGCTGGTGGG + Intergenic
986160728 5:5226045-5226067 TAGAGAGATGCGAAGATGGAAGG - Intronic
986740174 5:10699150-10699172 TGAACAAATGTGAACCTGGAAGG - Intronic
986825174 5:11512595-11512617 TTGGGAAAATTGAAGCTTGAAGG - Intronic
991966423 5:72096025-72096047 GAGAGAGATGTGAAGATGGAAGG - Intergenic
993204134 5:84858610-84858632 TTGACAAATGTTTAGCTAGATGG - Intergenic
993809415 5:92457413-92457435 TTTAGAAATGTGTAACTGAATGG - Intergenic
994116639 5:96068429-96068451 TTGAAAAATGTGAGGCAGTAGGG - Intergenic
994324245 5:98430725-98430747 CCTAGAAATCTGAAGCTGGAAGG + Intergenic
995246656 5:109942931-109942953 TTCAGAAATGTGAAGATGGCAGG - Intergenic
995362708 5:111316564-111316586 TTGAAGAATGTGAAGATGCACGG + Intronic
996282398 5:121746465-121746487 GTGAGAAATGTAAAGCTCCAAGG + Intergenic
997192532 5:131951328-131951350 TTGGGAAATCTGAAGCAAGAAGG + Exonic
997680509 5:135747049-135747071 TTTGGTAATGTGAAGCTTGATGG + Intergenic
998497287 5:142601740-142601762 TTGAGAAACCTGGAGATGGAGGG + Intronic
999035206 5:148341332-148341354 TTGAGAAATGAGAAGCAGCCAGG + Intergenic
999177248 5:149640099-149640121 TTGGGAAATGGGAAGTGGGATGG + Intergenic
999341186 5:150774737-150774759 TTAAGAAATATGAAGCAGGCTGG + Intergenic
1000191723 5:158917483-158917505 TTGAGAAACATCAAGCCGGATGG - Intronic
1000285929 5:159826236-159826258 CTGAGAAATGGGAGACTGGAGGG - Intergenic
1000609799 5:163361544-163361566 TGGAGAAATATGAAGCATGATGG + Intergenic
1001125814 5:169018303-169018325 TTCAGAAAATTCAAGCTGGAAGG - Intronic
1002557243 5:180052253-180052275 TGGAGAAATGTCAAGCAGGCAGG - Intronic
1006044894 6:31286844-31286866 TTGTCAAATGTAAAGTTGGAAGG - Intronic
1009334301 6:62466900-62466922 TGGAGAAATGTGAAGCCATAAGG + Intergenic
1009543560 6:64997006-64997028 GTGAGAAATGAGGAGCCGGAGGG + Intronic
1010443612 6:75927256-75927278 ATGAGAAATTTGAAGCTTAAGGG + Intronic
1010617186 6:78028378-78028400 TAGAGAAATGTGGAGAAGGATGG - Intergenic
1010656086 6:78513649-78513671 ATGAGAATTGTGGTGCTGGAAGG - Intergenic
1010758512 6:79695072-79695094 TAGTGAAGTGTGAAGCTGGCAGG - Intronic
1012085020 6:94813781-94813803 TTGATAACTTTGAAACTGGAGGG - Intergenic
1012424263 6:99096712-99096734 TTGAGAAATGCAAGGCTGGGAGG + Intergenic
1013398131 6:109764140-109764162 ATGAAAAATGTGTAGCTGGCTGG + Intronic
1014510651 6:122317583-122317605 TTGCTAAATTTGAAGATGGAGGG + Intergenic
1014678523 6:124398872-124398894 TTCAGAAATTTGAAACAGGATGG - Intronic
1015674841 6:135734051-135734073 GAGTGAAATCTGAAGCTGGATGG - Intergenic
1015692990 6:135945997-135946019 TTGAGAAATGAAATGTTGGAGGG - Intronic
1015716297 6:136195794-136195816 TGGGGAAATGTAAAGCTGAATGG - Intergenic
1018944675 6:168339249-168339271 TGTAGAAATGTGACTCTGGAAGG - Intergenic
1019612607 7:1944623-1944645 CTGGGAAATGTGAGGCTGAAGGG + Intronic
1020384939 7:7590797-7590819 GTGAGAAATGTGAAGTATGAGGG - Intronic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1021128444 7:16881066-16881088 TTAAGAAAAGTCAATCTGGAAGG + Intronic
1021873973 7:25031501-25031523 TTGAGAAGTATGAAGCTGTTTGG + Intergenic
1023128872 7:36982874-36982896 TAGGGCAATGTGGAGCTGGATGG - Intronic
1024100818 7:46030929-46030951 TTGAGAAACTGGAGGCTGGAGGG + Intergenic
1024333355 7:48178788-48178810 TTGGTAAATGAGAAACTGGATGG - Intronic
1026102477 7:67394522-67394544 TTGAGAAAGGTCAAACAGGAGGG + Intergenic
1026401789 7:70021401-70021423 TTGAGAAGTGTGAAGCTGGATGG + Intronic
1027485043 7:78750718-78750740 GGGAGAATTGTGAGGCTGGAGGG + Intronic
1028667953 7:93368659-93368681 TTTAGAAATGTGATGCTGTTTGG - Intergenic
1028838537 7:95400681-95400703 TTGAGAAATGTTTAGGTGGAGGG + Intergenic
1028870039 7:95760607-95760629 TTGAGAAATGTCAATTTGCATGG + Intergenic
1032495065 7:132355244-132355266 TTGGGACACGGGAAGCTGGAAGG - Intronic
1033136149 7:138786124-138786146 TGGAGAAGAGGGAAGCTGGAGGG - Intronic
1034160795 7:148993123-148993145 TTGAGAAAAATGAGGCTGGGAGG + Intergenic
1034658029 7:152744790-152744812 TAGAGAAATGTGCAGCATGATGG + Intergenic
1035473421 7:159126046-159126068 TTGTGAAATCTGGACCTGGATGG - Intronic
1035543110 8:457518-457540 CATAGAAATGTAAAGCTGGAAGG + Intronic
1037449589 8:19003422-19003444 GTGAGAAGTGTGAAGTTGGGAGG - Intronic
1037524974 8:19715834-19715856 TAGAGGAATGTGAGGCTGGCAGG - Intronic
1038264422 8:26026738-26026760 TTAAGAGCTGTGAAGATGGAAGG - Intronic
1038531261 8:28319699-28319721 TTGGGAGCTGTGGAGCTGGATGG - Intronic
1038587730 8:28805412-28805434 TTGAGGAATGGGAATCTAGAGGG - Intronic
1041554104 8:59133763-59133785 CAGAGAGATGTGGAGCTGGAAGG - Intergenic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1044197685 8:89397088-89397110 TAAAGAAATGTAAAGCTGAAAGG - Intergenic
1045476984 8:102561442-102561464 TTGAAAAATGACAAGCTGTATGG - Intergenic
1046713482 8:117541160-117541182 TTGACAAATGTCAAGTTGGAGGG - Intergenic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047038881 8:120970612-120970634 ATGAGAGCTGTGAAGCTGCACGG + Intergenic
1047344136 8:124010741-124010763 TAGAGAATTGGGAAGCTGGTGGG + Intronic
1047679859 8:127243478-127243500 GTGTAAAATGTCAAGCTGGAGGG - Intergenic
1047905527 8:129468865-129468887 GTGAGAAAAGTGAAACTTGAAGG + Intergenic
1049329098 8:142040307-142040329 CCGAGAAATGGCAAGCTGGAGGG - Intergenic
1051104310 9:13561151-13561173 TTCAGAGATTTGGAGCTGGAAGG + Intergenic
1051500358 9:17770277-17770299 ATGAGAAAACTGAAGCTGCAAGG + Intronic
1052367953 9:27634533-27634555 GTGAGAACTGTGATGCTTGATGG + Intergenic
1053502978 9:38617143-38617165 TTTAAAAATGGGAAGCTGGCCGG + Intergenic
1054704973 9:68452848-68452870 TTGAGAAAGGAGATGTTGGAAGG - Intronic
1054768304 9:69061076-69061098 TTGAGAGCTGTGGAGCTAGAAGG + Intronic
1056685684 9:88757412-88757434 GTGAGTAATGTACAGCTGGATGG + Intergenic
1056997516 9:91477314-91477336 TTCAGAGATGTGAAGCACGAGGG - Intergenic
1057683437 9:97212580-97212602 TTTAAAAATGTGAAGCTGTCCGG + Intergenic
1059639209 9:116200117-116200139 TTGAGGAAGATGAAGCTGGAGGG - Intronic
1060120275 9:120982347-120982369 TTGAGAAATGGGAAGCAGGAAGG - Intronic
1060428711 9:123528503-123528525 TCAAAAAATGTGCAGCTGGAGGG - Intronic
1060621122 9:125067661-125067683 ATGAGAAATGACAAGCTGGGTGG - Intronic
1061065666 9:128276114-128276136 ATGAGAAATATGAAGCGGAAGGG + Intronic
1185976452 X:4725864-4725886 TAGTGAGATGTGAAGCTGGCTGG - Intergenic
1187081698 X:15996707-15996729 TTGAGAAGGGAGAAGCTGGGAGG - Intergenic
1187572625 X:20520394-20520416 TTGAGAAAAATGAAGGGGGAAGG - Intergenic
1187916483 X:24157377-24157399 TTCAGATATGTGAAGATGTAGGG - Intronic
1187943189 X:24401554-24401576 GTTAGAAATGTCAAGGTGGAAGG - Intergenic
1188349180 X:29105890-29105912 TTCATAAATGTGAGGCTGTAAGG - Intronic
1188506057 X:30886006-30886028 TAGAGAAATTTGAAGCAGGGAGG + Intronic
1189700929 X:43715917-43715939 TTTAGAAAGGTGTAGCAGGATGG + Intronic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1190455920 X:50627810-50627832 CTGAGAAATTTGTACCTGGAGGG + Intronic
1191590486 X:62878850-62878872 TTGATAAATTTGAAGCTGAGGGG - Intergenic
1191926563 X:66317572-66317594 AAGAGACATATGAAGCTGGAAGG - Intergenic
1192444285 X:71198948-71198970 TTGAAAAAGGCGAAGCTGGCTGG - Intergenic
1192551554 X:72058637-72058659 TTAAGAACTGGGAAGCTGGCCGG - Intergenic
1194808929 X:98366102-98366124 TTGAGAACTGTGTAGATGGTGGG + Intergenic
1195332915 X:103820413-103820435 TTGAGTAATTTCAAGCTGGGAGG - Intergenic
1195455516 X:105064820-105064842 TTGAAGGATGTGAAGGTGGAAGG + Intronic
1196132997 X:112177765-112177787 TAGAGAAATAAGAAACTGGATGG - Intergenic
1196334387 X:114514170-114514192 TTCAGAATTTTGAAGTTGGACGG - Intergenic
1196367986 X:114944513-114944535 TTGAGAAAACTGAAGCAGGAAGG - Intergenic
1197701344 X:129602431-129602453 ATGAGAAATGTGATTGTGGAGGG - Intergenic
1197860961 X:130969700-130969722 TTGAGAAATGTGAATGAGAAGGG + Intergenic
1198981482 X:142402077-142402099 TTGAGAAATTTGACCCAGGAGGG + Intergenic
1199276341 X:145947577-145947599 CTGAGAAATTTGAAGCTGGGAGG - Intergenic
1200907942 Y:8503980-8504002 TTGAGATATCAGAATCTGGATGG - Intergenic
1202092198 Y:21204348-21204370 TTGTGAAAATTGATGCTGGAAGG - Intergenic
1202163850 Y:21965999-21966021 GTGAGAAATTTGATGATGGAAGG + Intergenic
1202227506 Y:22620365-22620387 GTGAGAAATTTGATGATGGAAGG - Intergenic
1202315618 Y:23575289-23575311 GTGAGAAATTTGATGATGGAAGG + Intergenic
1202555150 Y:26094785-26094807 GTGAGAAATTTGATGATGGAAGG - Intergenic