ID: 1092832050

View in Genome Browser
Species Human (GRCh38)
Location 12:12453709-12453731
Sequence ACTGAAATGCACACTGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1647
Summary {0: 1, 1: 0, 2: 40, 3: 349, 4: 1257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092832050 Original CRISPR ACTGAAATGCACACTGTAAA AGG (reversed) Intronic
900560997 1:3306235-3306257 ACTGAACTGCCCACTGCAGATGG - Intronic
900672513 1:3864265-3864287 TCTGAATTGTACACTTTAAATGG + Intronic
900966340 1:5961365-5961387 ACTGAACTGTACATTTTAAAAGG + Intronic
901924704 1:12558784-12558806 ACTGAATTGCACACTTGAATAGG + Intergenic
902179459 1:14676914-14676936 ACTGAATTGTATACTTTAAAAGG + Intronic
902196283 1:14800996-14801018 ACTGAATTGTACACTTTAAAAGG + Intronic
902231755 1:15031970-15031992 ACTGAATTGGACACTTAAAATGG - Intronic
902265119 1:15257794-15257816 ACTGAACTGAACACTTAAAATGG - Intronic
903114279 1:21165795-21165817 ACTGAATTATACACTCTAAATGG + Intronic
903335955 1:22624802-22624824 ACTGAAATGCACCCTTAAAATGG + Intergenic
903508869 1:23858521-23858543 GCTAAAATACAAACTGTAAATGG + Intronic
903532321 1:24040982-24041004 ACTGAATTGTAAACTGAAAATGG + Intergenic
904367056 1:30019454-30019476 ATTGAATTGTACATTGTAAATGG - Intergenic
904740782 1:32674178-32674200 ACTGAACTGTACACTTAAAATGG + Intronic
904762517 1:32816173-32816195 ACTGAATTGTGCACTTTAAAAGG + Intronic
904866332 1:33581915-33581937 ACTGCCATGCAAACTGTGAAGGG + Intronic
905303063 1:36998766-36998788 ACTGAAATTCAAACTGTCACTGG - Intronic
905330267 1:37190167-37190189 ACTGAAATCCACATTGCAATAGG - Intergenic
905505937 1:38479711-38479733 ACTGAATTGTACACTTTAAAAGG + Intergenic
905560124 1:38919884-38919906 ACTGAATTGTACACTCTAAATGG - Intronic
905686376 1:39911754-39911776 CCTGAATTGCACACTTTAAATGG - Intergenic
905700953 1:40013422-40013444 ACTGAATTGTACGCTGAAAAGGG + Intergenic
905795028 1:40810992-40811014 TCTGAACTGAACACTTTAAAAGG - Intronic
906116791 1:43362502-43362524 ACTAAACTGTACACTTTAAAAGG + Intronic
906268477 1:44454708-44454730 ACAGAACTGTACACTGTAAAGGG - Intronic
906363831 1:45188553-45188575 ACTGAATTGTACACTTTAAATGG + Intronic
906768416 1:48458892-48458914 ACTAAATTGTACACTTTAAAAGG + Intronic
906817787 1:48897072-48897094 ACTGAACTGAACACTTAAAATGG - Intronic
906934237 1:50197999-50198021 TCTGAAATGCACACTGAAGTGGG - Intronic
907068040 1:51505625-51505647 ACTGAATTGTACACTTTATAGGG + Intronic
907392882 1:54169965-54169987 AGTGAAATGTACATTGTGAAAGG - Intronic
907736714 1:57120484-57120506 ACTGAACTGTACACTTAAAATGG - Intronic
907826546 1:58022491-58022513 ATTGAAGTGCACAGTGGAAAAGG - Intronic
908054999 1:60276182-60276204 ATTGAAATGCACACTGGACTTGG + Intergenic
908172442 1:61519427-61519449 ATTGAATTTTACACTGTAAATGG - Intergenic
908568836 1:65387331-65387353 ACTGCATTGTACACTTTAAAAGG - Intronic
908875145 1:68665287-68665309 ACTGAATTGCAGGCTTTAAAAGG - Intergenic
909029968 1:70528185-70528207 ACTGACATGCACAATGTCAAAGG + Intergenic
909425411 1:75518962-75518984 ACTGAACTGCATACTTTAAATGG + Intronic
910262994 1:85309469-85309491 ATTGAATTGCACATTTTAAATGG - Intergenic
910738138 1:90484944-90484966 ACTGAAATGTACACTTGAAATGG + Intergenic
910862280 1:91753478-91753500 ACTGAATTGTACAGTTTAAAAGG - Intronic
910890887 1:92018680-92018702 ACTGAATTTCACACTTTAAAGGG - Intergenic
910958906 1:92739554-92739576 ACTGAATTATACACTTTAAAAGG + Intronic
911606013 1:99906022-99906044 ACTGAATTGTACACTTAAAATGG - Intronic
911695252 1:100883248-100883270 ACTGAACTGTATACTTTAAATGG - Intronic
911810389 1:102269670-102269692 ACTGAATTCTACACTTTAAAGGG - Intergenic
912037711 1:105342198-105342220 ACAGAAATAGAAACTGTAAAGGG + Intergenic
912462002 1:109840955-109840977 ATTGAATTGTACACTTTAAATGG + Intergenic
912689104 1:111790601-111790623 ATTGAAATGCATAATTTAAATGG - Intronic
912854105 1:113152107-113152129 GCTGAATTGTACACTTTAAAAGG - Intergenic
912883467 1:113443871-113443893 ACTGAAATGCATACTATAAAAGG - Intronic
913302859 1:117390943-117390965 ACTGAATTGTATACTTTAAATGG - Intronic
913305256 1:117423793-117423815 ACTGAACTGCACACTTAAAATGG - Intronic
913350690 1:117855444-117855466 ACTGGACTGTACACTTTAAATGG + Intergenic
913439903 1:118886256-118886278 ACTGGAATAAAGACTGTAAATGG + Intronic
913941457 1:125111982-125112004 ACTGAACTGTACACTTAAAATGG - Intergenic
913955952 1:143293511-143293533 ACTGAACTGTACACTTAAAATGG - Intergenic
913981482 1:143521929-143521951 ACTGAACTGTACACTTAAAATGG + Intergenic
914075853 1:144348584-144348606 ACTGAACTGTACACTTAAAATGG + Intergenic
914103325 1:144617912-144617934 ACTGAACTGTACACTTAAAATGG - Intergenic
914215386 1:145622499-145622521 ATTGAATTGTACACTTTAAATGG + Intronic
914404008 1:147351913-147351935 ACTGAATTGCTCACTTAAAAAGG - Intergenic
914467336 1:147942884-147942906 ATTGAATTGTACACTTTAAATGG + Intronic
915386048 1:155493125-155493147 ACTGAATTGTGCACTTTAAAAGG - Intronic
915387148 1:155505686-155505708 ACTGAACTGTACATTTTAAAAGG + Intronic
915657575 1:157374435-157374457 ATTGAAATGTACACTTTAAATGG + Intergenic
915671504 1:157492551-157492573 ATTGAAATGTACACTTTAAATGG - Intergenic
916514689 1:165505172-165505194 ATTGAATTGCACATTCTAAATGG + Intergenic
916532080 1:165666365-165666387 ACTGAATTGTACACTTTAAGTGG + Intronic
916879522 1:169006279-169006301 ATTGAATTGTACACTTTAAATGG - Intergenic
917047381 1:170876384-170876406 ATTGAAATGTACACTTAAAACGG - Intergenic
917130272 1:171734564-171734586 ACTGAATTGTACACTTTAAGTGG + Intronic
917401646 1:174656154-174656176 CCTGAATTGTACACTTTAAAGGG - Intronic
917672865 1:177289760-177289782 ACTGAATTGTACACCTTAAAGGG - Intergenic
917681472 1:177372466-177372488 ACAAACAAGCACACTGTAAAAGG - Intergenic
917705362 1:177627805-177627827 ACTGGACTGCACACTTTAAAAGG + Intergenic
917865127 1:179187038-179187060 ACTGAAAAGTACACTATAAATGG - Intronic
917961235 1:180146717-180146739 ACTGAATTGTATACTTTAAAGGG + Intergenic
918382869 1:183974339-183974361 ACTGAACTATACACTGAAAAAGG + Intronic
918609925 1:186477561-186477583 AGTGAAATGCAGCATGTAAAAGG - Intergenic
918630996 1:186718386-186718408 ACTGAAATGCTGATTGTTAAAGG + Intergenic
919119589 1:193322312-193322334 CATAAAATGCACACTTTAAAGGG + Intergenic
919345541 1:196371461-196371483 ATTGAATTGTACACTTTAAATGG + Intronic
919622137 1:199874756-199874778 ACTGAACTGGACACTGTAAGTGG + Intergenic
919827921 1:201517009-201517031 ATTGAAATGTACACTTTAAAAGG - Intergenic
920267847 1:204738356-204738378 ACTGAATTATACACTTTAAATGG - Intergenic
920330583 1:205204617-205204639 ACTGAATTGTACACTTAAAAGGG - Intronic
920384018 1:205554897-205554919 ACTGGATTGTACACTTTAAAAGG + Intergenic
920520663 1:206622556-206622578 ACTGAATTGTCCACTTTAAATGG - Intergenic
920578078 1:207077726-207077748 ACAGTTATGCACACTTTAAATGG - Exonic
920583031 1:207130913-207130935 ATTGAATTGCACATTCTAAATGG + Intronic
920611742 1:207446708-207446730 ATTGAATTGCATACTTTAAATGG - Intergenic
920939010 1:210463199-210463221 ACTGAACTGTACACTTTAAATGG - Intronic
921342847 1:214151908-214151930 ACTGAATTGTACACTTAAAATGG + Intergenic
922018909 1:221684134-221684156 AATAAAATGCACTGTGTAAAGGG - Intergenic
922132186 1:222790782-222790804 ACTGAACTGCACACTAAAAATGG + Intergenic
922305620 1:224341472-224341494 ACTGAACTGTACACTTAAAATGG - Intergenic
922429961 1:225541509-225541531 ACTGAATTGTACCCTTTAAATGG + Intronic
922554071 1:226519775-226519797 GCAGAAAGGCACACTGTGAAGGG - Intergenic
922773303 1:228201577-228201599 ACTGAACTGGACACTTAAAATGG - Intergenic
922908548 1:229196031-229196053 ACTGAATTGTACATTTTAAATGG + Intergenic
923053846 1:230409750-230409772 ACTGAATTGTACACACTAAATGG + Intronic
923536245 1:234854178-234854200 ACTGCAATGGACAGTGTACATGG + Intergenic
923583617 1:235243993-235244015 ACTAAACTGTACACTTTAAAAGG + Intronic
923592767 1:235334473-235334495 GCTGAAATGTACACTTTAAATGG - Intronic
923752632 1:236760392-236760414 ACTGAAGTATACACTTTAAATGG - Intronic
923763823 1:236873497-236873519 ATTGAATTGCACACTTGAAATGG + Intronic
924047908 1:240051492-240051514 ATTGAATTGTACACTTTAAATGG - Intronic
924061068 1:240174863-240174885 ACTGAATTGGACACTTAAAATGG - Intronic
924171042 1:241341459-241341481 ACTAAAATGTTCAGTGTAAAAGG + Intronic
924275136 1:242378475-242378497 ACTGAACTGTACACTTAAAATGG + Intronic
924333022 1:242959015-242959037 ACTTAATTGTACACTTTAAATGG - Intergenic
924356170 1:243178629-243178651 ACTGAATTGTATACTTTAAATGG + Intronic
924366029 1:243294886-243294908 AGTGAGATTAACACTGTAAATGG + Intronic
924433440 1:244017453-244017475 ACTGAATTGTACACTTTAAATGG + Intergenic
924505045 1:244674389-244674411 ACTGAATTGTACATTTTAAATGG - Intronic
924634638 1:245774592-245774614 ACTGAAGTATACACTTTAAATGG + Intronic
924644466 1:245864725-245864747 ACTGAACTGTACACTTTAACTGG + Intronic
924694728 1:246387060-246387082 ACTGCTTTGCACACGGTAAAGGG + Intronic
924781861 1:247157263-247157285 ACAGTAATGCACACTGGAAATGG - Intronic
1062777657 10:167300-167322 ACTGAATTGTACACTTCAAATGG + Intronic
1062942077 10:1430219-1430241 ACTGATAAGAAAACTGTAAAAGG + Intronic
1063234153 10:4095071-4095093 ACTGAACTACACACTTAAAATGG + Intergenic
1063392317 10:5658663-5658685 ACTGAAGTGGACACTTGAAATGG + Intronic
1063521564 10:6746103-6746125 ACTGAATTGTACACTTAAAAAGG - Intergenic
1064158244 10:12921595-12921617 ACTGAAGTGTACACTTAAAATGG - Intronic
1064181389 10:13119121-13119143 ACTGAAATGTATACTTTAAATGG - Intronic
1064738157 10:18405135-18405157 ACTGAATTATACACTTTAAATGG - Intronic
1064947957 10:20813498-20813520 ATTGAATTGAACACTTTAAATGG + Intronic
1065071479 10:22028996-22029018 ATTGAATTGTACACTTTAAATGG + Intergenic
1065542381 10:26783405-26783427 ACTGAACTGCACACTTAAAATGG + Intronic
1065885989 10:30077461-30077483 ACTGAAACGTATACTTTAAATGG - Intronic
1065980978 10:30896789-30896811 ACTGAAATGTACACTTAAAAAGG + Intronic
1066169148 10:32822738-32822760 ATTGAATTGGACACTTTAAATGG + Intronic
1066211546 10:33244330-33244352 ACATTAATGCACTCTGTAAAAGG + Intronic
1066352827 10:34652622-34652644 ACTGAAATGCACGCTGTTTGGGG + Intronic
1066397679 10:35041944-35041966 ATTGAATTGCACACTTTAAATGG - Intronic
1066451572 10:35534625-35534647 ACTAAAATGCTCACTTTAAATGG - Intronic
1066746513 10:38606900-38606922 ACTGAATTGTGCACTTTAAAGGG + Intergenic
1066951234 10:42119558-42119580 ACTGAACTGTACACTTAAAATGG + Intergenic
1067187948 10:44045883-44045905 ACAGAACTGTAAACTGTAAAAGG + Intergenic
1067353311 10:45498198-45498220 ACTGAACTGTACACTTAAAATGG - Intronic
1067516885 10:46956255-46956277 ACTGAAATATACACTTAAAATGG - Intronic
1067531761 10:47079345-47079367 ACTGAATTGTACACTTTAAGTGG - Intergenic
1067645366 10:48095571-48095593 ACTGAAATATACACTTAAAATGG + Intergenic
1068053056 10:51976722-51976744 ACTGAACTGTACAGTTTAAAAGG + Intronic
1068195669 10:53712930-53712952 ACTAAAATGTAAACTCTAAAAGG - Intergenic
1068372511 10:56136102-56136124 AATGACATGCAAATTGTAAATGG - Intergenic
1068742389 10:60488442-60488464 ATTGAAATTTACACTTTAAATGG - Intronic
1069048534 10:63767886-63767908 ACTGAATTGTACACTTGAAATGG - Intergenic
1069220068 10:65872142-65872164 TATGGAATGCACACTGTAATGGG - Intergenic
1069257885 10:66357367-66357389 ACTGAATTGTACACTTTAAAGGG - Intronic
1069390555 10:67930291-67930313 ACTGAAGTGTACACTTAAAATGG - Intronic
1069517743 10:69092484-69092506 ACTGAATTGAACACTTTTAATGG - Intronic
1069540113 10:69287716-69287738 ACTGAATTATACACTTTAAAGGG + Intronic
1069689748 10:70342375-70342397 ACTGAATTGTACACTTTAAGTGG + Intronic
1069711453 10:70491618-70491640 ACTGAACTGTACACTTTAAAAGG - Intronic
1069742546 10:70694397-70694419 ACTGAATTGCATATTTTAAATGG - Intronic
1069851918 10:71411836-71411858 ACTGAACTGCACACTGAAAAAGG - Intronic
1069853700 10:71426759-71426781 ATTGAATTGTACACTTTAAATGG - Intronic
1070036631 10:72731481-72731503 ACTGAATTGTATACTTTAAAAGG - Intronic
1070070702 10:73086564-73086586 ACTGAAATGTATACTTTAAAGGG + Intronic
1070099205 10:73368939-73368961 GCTGAATTGTACACTTTAAAAGG + Intergenic
1070124086 10:73606253-73606275 ACTGAACTGTACACTTAAAATGG + Intronic
1070472107 10:76791315-76791337 ACTCATATGCACACTGTTATGGG + Intergenic
1070482542 10:76896873-76896895 ACTGAATCGTACACTTTAAATGG + Intronic
1070625862 10:78050541-78050563 ATTGAATTGCACACTTTACAAGG - Intronic
1070737175 10:78871121-78871143 AGAGAAATGCACAATGTACAGGG - Intergenic
1070763616 10:79043816-79043838 ACTGAACTGTACAGTGAAAATGG + Intergenic
1070832669 10:79429695-79429717 ACTGAATTGTACACTTCAAATGG + Intronic
1070968601 10:80545123-80545145 ACTGAATTACACACTTTAAATGG - Intronic
1070974070 10:80590749-80590771 ACTAAATTGTACACTTTAAAAGG - Intronic
1071031201 10:81183405-81183427 ACTGAACTGTACACTTAAAAAGG + Intergenic
1071234654 10:83631385-83631407 ACTGAATTGAACACTTTAAATGG + Intergenic
1071453579 10:85823267-85823289 ACTGAAATATACACTTGAAATGG + Intronic
1071843971 10:89502718-89502740 ACTGAAATGCACACTCCTTATGG - Intronic
1072465780 10:95661153-95661175 ACTGAATTGTACACTTTAAGAGG + Intergenic
1072471216 10:95715706-95715728 ACTGAATTGTACACTTTAAAGGG - Intronic
1072571665 10:96663277-96663299 ATTGAATTGTACACTTTAAATGG + Intronic
1072692235 10:97579518-97579540 ACTGAATTGTACACTTAAAATGG - Intronic
1072796582 10:98360480-98360502 ACTGAATTGTATACTTTAAATGG + Intergenic
1072851835 10:98903381-98903403 ATTGAATTGTACACTTTAAATGG + Intronic
1072970253 10:100010802-100010824 ACTGAACTGTACACTTAAAAAGG - Intergenic
1072975595 10:100054917-100054939 ACTGAACTGTACACTTAAAATGG - Intronic
1072981195 10:100099147-100099169 ATTGAATTGTACACTTTAAATGG + Intergenic
1073222310 10:101885740-101885762 ACTGAACTGTACACTTAAAAAGG + Intronic
1073340436 10:102740184-102740206 ACTGAATTGTACACTTTAAAAGG - Exonic
1073514408 10:104064189-104064211 ACTGGAAAGAACACTGAAAATGG - Intronic
1073521795 10:104137886-104137908 ACTGACTTGCACACTTTAAATGG + Intronic
1073522741 10:104149800-104149822 ACTGAATTTTACACTGTAAATGG - Intronic
1073536980 10:104286125-104286147 AGTGAATTGTACACTGGAAAAGG - Intronic
1073941052 10:108698730-108698752 ACTGAATTGTGCACTTTAAAGGG + Intergenic
1074014936 10:109525187-109525209 ATTGAACTGTACACTTTAAATGG + Intergenic
1074349267 10:112719471-112719493 ACTGAATTGTACATTTTAAATGG - Intronic
1074387702 10:113029946-113029968 ACTGAACTGTACACCTTAAATGG - Intronic
1074392621 10:113070813-113070835 ACTGAATTGCATGCTTTAAATGG - Intronic
1074582213 10:114730690-114730712 ACTAAATTGTACACTTTAAAAGG - Intergenic
1074590799 10:114810984-114811006 ACTGAAGTCCTCACTTTAAAAGG + Intergenic
1074758270 10:116644085-116644107 ATTGAATTGCACACTTTAAATGG - Intronic
1074769821 10:116725940-116725962 ACTGAGTTGCATTCTGTAAACGG - Intronic
1074844073 10:117381228-117381250 ACTGAACTGTACACTTTAAATGG - Intergenic
1074846204 10:117400393-117400415 AATGAACTGTACACTTTAAATGG - Intergenic
1075009481 10:118855626-118855648 ACTGAACTATGCACTGTAAAAGG + Intergenic
1075134440 10:119770974-119770996 ACTTAACTGCACACTTTAAAAGG - Intronic
1075436928 10:122451445-122451467 ACTGAAATGTATACTTTAAATGG - Intergenic
1075678916 10:124318526-124318548 ACGAAAAGGCACTCTGTAAAAGG + Intergenic
1075769883 10:124924353-124924375 ACTGAATTGTATACTTTAAAGGG - Intergenic
1076067111 10:127457640-127457662 ATTGAATTGCACCCTTTAAAGGG + Intergenic
1076908624 10:133376488-133376510 ATTGAATTGAACACTTTAAACGG + Intergenic
1077699474 11:4427627-4427649 ACTGAACTGCACACTTTAAATGG + Intergenic
1078092510 11:8275258-8275280 ATTGAATTGTACACTTTAAATGG + Intergenic
1078260219 11:9699269-9699291 ACTGAATTGTATACTTTAAAAGG + Intronic
1078410484 11:11112153-11112175 ATTGAGTTGTACACTGTAAATGG + Intergenic
1078487954 11:11741287-11741309 ACTGAATTGTACACTTCAAAAGG + Intergenic
1078492224 11:11780210-11780232 ACTGAATTGTACACTTTAAATGG + Intergenic
1078566541 11:12419156-12419178 ACTGAACTGTACACTTAAAATGG - Intronic
1078635712 11:13047936-13047958 ACTGAATTGTACACATTAAATGG - Intergenic
1078815682 11:14820093-14820115 ATTAAATTGCACACTTTAAAAGG - Intronic
1079046704 11:17110843-17110865 CCTGAACTGTACACTTTAAAAGG + Intronic
1079215922 11:18511666-18511688 ACTGAAATGTATACTTTAAAAGG - Intronic
1079261404 11:18885637-18885659 ACTGGATTGTACACTGAAAATGG - Intergenic
1079263654 11:18909119-18909141 ACTGAATTGTACACTTTAAATGG - Intergenic
1079418532 11:20263928-20263950 ACTGAATTGTATACTTTAAAAGG + Intergenic
1079500923 11:21100328-21100350 ACTGAACTGTACACTTAAAATGG - Intronic
1079933085 11:26589466-26589488 ATTGAATTGGACACTTTAAATGG - Intronic
1080228705 11:29991118-29991140 ATTGAATTGTACACTTTAAATGG + Intergenic
1080509226 11:32950589-32950611 ACTGAACTGTACACTTTAAATGG - Intronic
1080520241 11:33062170-33062192 ACTGAGTTGTACACTTTAAAAGG - Intronic
1080562883 11:33480120-33480142 ACTGAATTACACACTTTAAACGG - Intergenic
1081024903 11:37998994-37999016 ACTGAGTTGTACACTTTAAAAGG + Intergenic
1081150129 11:39617989-39618011 ACTGAGTTGCACACTTGAAATGG + Intergenic
1081359825 11:42161958-42161980 ATAGAAATCTACACTGTAAAGGG + Intergenic
1081411903 11:42769314-42769336 ACTGAACTGTACACTTAAAATGG - Intergenic
1082016840 11:47495515-47495537 ACTGAATTGCTCACTTTAAAGGG + Intronic
1082272782 11:50190087-50190109 ACTGAATTACACACTGTATTAGG - Intergenic
1083076577 11:60045718-60045740 ACTGAACTGTACACTTAAAATGG - Intronic
1083235767 11:61349858-61349880 ACTGAAATGCACACCTTTATGGG + Exonic
1083389927 11:62340956-62340978 AGTCAAATGCACACTGAAACAGG - Intronic
1083844850 11:65325390-65325412 ACTGAAATGTATACTTAAAATGG - Intergenic
1083984034 11:66198715-66198737 ATTGAATTGTACACTTTAAATGG + Intronic
1084139028 11:67211249-67211271 ACTGAAATGCACACTTAAAATGG - Intronic
1084220705 11:67675801-67675823 ACTGAATTGTACACTGTAAATGG + Intronic
1084300924 11:68251785-68251807 ACTGAATTGTACACTTAAAATGG + Intergenic
1084375824 11:68776825-68776847 ACTGAATTGTACACTTTTAAAGG + Intronic
1084533674 11:69744518-69744540 ACTGAACTGTAAACTTTAAAAGG - Intergenic
1084544138 11:69805551-69805573 ACTCAATTGCACACTTAAAATGG - Intergenic
1084626257 11:70309964-70309986 ACTGAATTGTACACTTAAAATGG + Intronic
1085124854 11:73993171-73993193 ACTGAATTGTACACTTTGAATGG + Intergenic
1085142131 11:74155829-74155851 ACTGAATTGTGCACTTTAAAAGG + Intronic
1085161413 11:74350489-74350511 ATTGAATTGCACACTTTAAATGG - Intronic
1085179382 11:74520802-74520824 ACTGAACTGTACACTTAAAAAGG + Intronic
1085304845 11:75479554-75479576 ACTGAATTGTATACTTTAAAAGG - Intronic
1085485062 11:76856198-76856220 ACTGAAGTGTATACTTTAAATGG - Intergenic
1085496042 11:76970756-76970778 ACTGACTTGTACACTTTAAAAGG - Intronic
1085599533 11:77842764-77842786 ATTGAATTGCATACTTTAAAAGG - Intronic
1085655300 11:78309262-78309284 ACTGAATTGTACACTGTAAAGGG - Intronic
1086308771 11:85512070-85512092 AATGTAATCCACACTGAAAATGG - Intronic
1086735054 11:90295957-90295979 ACTGAACTGTACACTTAAAATGG + Intergenic
1086923428 11:92613776-92613798 ACTGAACTGTACACTTTAAAAGG - Intronic
1087213040 11:95462420-95462442 ACTTAAATACACACTTAAAATGG - Intergenic
1087322604 11:96681383-96681405 TCTGAAATGCACTTTTTAAAAGG + Intergenic
1088204914 11:107381198-107381220 ACTGAATTGTATACTGTAAATGG + Intronic
1088412174 11:109546524-109546546 ACTGAACTGTACACTTTAAAGGG + Intergenic
1088845713 11:113664645-113664667 ACTGAATTGTACACTTTAAAAGG - Intergenic
1089153493 11:116383518-116383540 ACTGAACTGCACACTCTAAAAGG + Intergenic
1089281211 11:117375873-117375895 ACAGAAATGCACCCTGTGATGGG - Intronic
1089310343 11:117554258-117554280 ACTGAACTGGACACTTAAAATGG + Intronic
1089547041 11:119236092-119236114 ACTAAATTGTACACTTTAAAAGG - Intronic
1089580549 11:119479260-119479282 ACTAAATTGTACACTTTAAAGGG - Intergenic
1089851521 11:121501252-121501274 ACTAAATTGCACACTTAAAAAGG - Intronic
1090217044 11:124977747-124977769 AATGAATTGTACACTTTAAATGG - Intronic
1090288924 11:125524893-125524915 ACTGAATTGTATACTGTAGATGG + Intergenic
1090309476 11:125722130-125722152 ACTGAATTGTACATTTTAAATGG - Intergenic
1091250854 11:134142651-134142673 CCTGAACTGCACACTTTAAAAGG - Intronic
1091492863 12:948386-948408 ACTGAATTGCACACTTTAAAAGG + Intronic
1091940531 12:4476452-4476474 ACTGAATTTTACACTTTAAAAGG + Intergenic
1092535656 12:9384422-9384444 ACTGAATTGTACACTTAAAAGGG - Intergenic
1092826748 12:12407515-12407537 ACTGAATTGTACACTCAAAAAGG - Intronic
1092832050 12:12453709-12453731 ACTGAAATGCACACTGTAAAAGG - Intronic
1092912532 12:13160163-13160185 ATTGAAATGTACATTTTAAATGG - Intergenic
1093027317 12:14256884-14256906 ACTTAATTGCACACTTTAGAAGG - Intergenic
1093241592 12:16683564-16683586 ACTGAAATACAAAGGGTAAAAGG - Intergenic
1093372931 12:18386318-18386340 ACTGAATCGCACACTTTAAATGG - Intronic
1093491226 12:19707007-19707029 ACAGAATTGCATACTATAAAGGG - Intronic
1093496126 12:19760255-19760277 AGTGAATTGAACACTTTAAATGG + Intergenic
1093626455 12:21354022-21354044 ACTCAAATGCTCACTGTAAAAGG + Intronic
1094109333 12:26844636-26844658 ACTGAACTGCATACTTAAAATGG + Intergenic
1094128921 12:27053858-27053880 ATTGAATTGTATACTGTAAATGG + Intronic
1094189481 12:27683000-27683022 ACTGAAGTGTACACTTTGAATGG + Intronic
1094422524 12:30286145-30286167 ATTGAATTGCACACTTAAAATGG - Intergenic
1094557798 12:31519823-31519845 ACTGAATTGTATACTTTAAAAGG - Intronic
1094684053 12:32693565-32693587 ACTGAATTACACATTGTAAATGG - Intronic
1095158174 12:38884062-38884084 ACTGGATTGTACACTTTAAAAGG - Intronic
1095300253 12:40576136-40576158 ACTGAATTGCACATTTTAAGAGG - Intergenic
1095323966 12:40864381-40864403 AGTGAATTGTACACTTTAAATGG - Intronic
1095431083 12:42135388-42135410 ATTGAATTACACACTTTAAAAGG - Intronic
1095556058 12:43506433-43506455 ACTGAAGTGCACACGTAAAAAGG + Intronic
1096158594 12:49357610-49357632 ACTGAATTGTACACTTTTAAAGG - Intergenic
1096206702 12:49728673-49728695 ACTAAAATGTACACTTTAAAAGG + Intronic
1096224789 12:49860150-49860172 ATTGAATTGCACATTTTAAATGG + Intergenic
1096671888 12:53204655-53204677 ACTGAATTGTACACTTAAAAGGG + Intronic
1097082119 12:56439696-56439718 CCTGAATTGTACACTTTAAAAGG + Intronic
1097371862 12:58792911-58792933 ACTGAATTGTTCACTTTAAAAGG + Intronic
1097554369 12:61118785-61118807 ACTAATATCCACAGTGTAAAAGG - Intergenic
1097609278 12:61798424-61798446 ACTGAAGTGTACACTAAAAATGG - Intronic
1097670346 12:62529589-62529611 CATGAATTGTACACTGTAAATGG - Intronic
1097829802 12:64212183-64212205 ATTGAATTGTACACTTTAAAAGG - Intronic
1097833092 12:64246233-64246255 ACTGAACTGCACACTTTAAAAGG - Intergenic
1097894247 12:64808619-64808641 ACTGAATTGTACACTTAAAATGG - Intronic
1097951191 12:65429923-65429945 ACTGAACTGGTCACTGGAAATGG - Intronic
1097988339 12:65807795-65807817 AGTGAATTGTATACTGTAAATGG - Intergenic
1098179287 12:67828870-67828892 GCTTTAATGCACACTGAAAATGG - Intergenic
1098502861 12:71214113-71214135 ACTGAGTTGAACACTCTAAATGG + Intronic
1099201573 12:79684104-79684126 ACTGAACTGTACACTTTAAAAGG + Intronic
1099259853 12:80364441-80364463 ATTGAACTGTACACTTTAAATGG - Intronic
1099306132 12:80958623-80958645 ACTCAGTTGCACACTTTAAATGG - Intronic
1099308725 12:80991260-80991282 ACTGGATTGTGCACTGTAAATGG + Intronic
1099330857 12:81284849-81284871 ACTGAATCACACACAGTAAAAGG - Intronic
1099344709 12:81483641-81483663 ACTGAACTATACACTTTAAAAGG + Intronic
1099395261 12:82130763-82130785 ACTGAATTGCACACTTAAAATGG + Intergenic
1100350503 12:93776993-93777015 ACTGAATTGCATACTTTAAATGG + Intronic
1100573306 12:95863344-95863366 ACTGAATTGTACACTTTAAAAGG + Intronic
1100574829 12:95880931-95880953 ACTGTAATGCACACTTAAAATGG + Intronic
1100672305 12:96829740-96829762 ACTGAACTGTACACTTAAAATGG - Intronic
1100992423 12:100265917-100265939 ACTGAATTGTACACTTTAAAAGG - Intronic
1101051207 12:100866044-100866066 ACTGGAATGGACTCTGTCAATGG - Intronic
1101424593 12:104577314-104577336 ACTGAACTGTACACTAAAAATGG - Intronic
1101523786 12:105508823-105508845 ACTGAAATGTACACTTTTAAAGG - Intergenic
1101550985 12:105761858-105761880 ACTGAATCGTACACTTTAAATGG - Intergenic
1101677420 12:106931069-106931091 ACTGAACTGTACACTTTCAATGG + Intergenic
1101844769 12:108354020-108354042 ATTGAAATGTACACTTTAAATGG + Intergenic
1101892345 12:108728561-108728583 ACAGAACTGTACACTTTAAACGG + Intronic
1102083944 12:110120771-110120793 CCTGAATTGTACACTTTAAATGG + Intergenic
1102087108 12:110151050-110151072 ACTGAAGTGTACACTTTAAATGG - Intronic
1102120270 12:110434801-110434823 AGTGAATTGTACACTTTAAAAGG + Intergenic
1102136077 12:110576808-110576830 ACTGAACTGTACACTTTAAAAGG + Intronic
1102212454 12:111137267-111137289 ACTGTAAAGTCCACTGTAAAGGG + Intronic
1102358326 12:112259997-112260019 ACTGAAATGTACACTTAAAATGG - Intronic
1102442342 12:112972968-112972990 ACTGAATTGTACACTTTAGAAGG - Exonic
1102510389 12:113411343-113411365 TCTGAAATTCATACTCTAAATGG - Intronic
1102662482 12:114541783-114541805 ATTGAATTGCACACTTCAAATGG + Intergenic
1102665258 12:114566518-114566540 ATTGAATTGCACACTTCAAATGG - Intergenic
1102815423 12:115861431-115861453 ACTGAATTGTACACTTAAAATGG + Intergenic
1102901564 12:116642030-116642052 ACTGAAATGTACACTTTAACAGG + Intergenic
1103110277 12:118271184-118271206 ATTGAATTGTACACTTTAAATGG - Intronic
1103142550 12:118562140-118562162 ACTGAATTGTATACTTTAAAAGG - Intergenic
1103291518 12:119850194-119850216 CCTGAAAGGCATACTGTAATTGG + Exonic
1103437101 12:120935393-120935415 ACTGAATTGCACACTTTAAAAGG - Intergenic
1103442827 12:120976302-120976324 AATGAATTGCACATTTTAAAAGG - Intergenic
1103594157 12:122013459-122013481 ACTGAATTATACACTTTAAAAGG + Intergenic
1103652955 12:122447362-122447384 ACTGAATTGTACACTTTAAATGG + Intergenic
1103688101 12:122748641-122748663 ATTGAATTGCTCACTTTAAATGG + Intergenic
1103820125 12:123691178-123691200 AATGAATTGTACACTTTAAAAGG - Intronic
1104006756 12:124898432-124898454 ACTGAACTGTACACTCAAAATGG + Intergenic
1104014226 12:124951575-124951597 ACTGAATTGAACACTTTAAATGG + Intronic
1104196720 12:126546946-126546968 ACTGAGTTGCACACTTGAAATGG + Intergenic
1104650615 12:130529580-130529602 ACTGAATTGTTCACTATAAATGG + Intronic
1104800803 12:131554229-131554251 ACTGAAATGCCAACTTCAAACGG - Intergenic
1105267332 13:18832991-18833013 ACTGAGTTGCACATTTTAAATGG + Intergenic
1105452775 13:20515295-20515317 ACTGAATTGTACACTTTAAATGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105738413 13:23296455-23296477 ACTGAACTGTACACTAAAAATGG - Intronic
1106066699 13:26359319-26359341 ACTGAACTGTACACTTAAAATGG + Intronic
1106163785 13:27224178-27224200 ACTGAATTGTACACTTAAAATGG + Intergenic
1106278963 13:28245551-28245573 ACTGAATTACATACTTTAAAAGG - Intronic
1106327458 13:28707713-28707735 ACTGAATTGCAGACTTTAAAAGG - Intronic
1106362785 13:29047819-29047841 ACTGAAATGTACACTTTGAAAGG - Intronic
1106392871 13:29352507-29352529 ACTGAAATGTACACTTGAAAAGG - Intronic
1106435340 13:29718655-29718677 ACTGAACTGTACACTTCAAAAGG - Intergenic
1106518300 13:30474154-30474176 ATTGAATTGTACACTGTAAGTGG + Intronic
1106665324 13:31845878-31845900 ACTGAATTGTACATTTTAAAGGG - Intergenic
1107156990 13:37179429-37179451 ATTGAACTGTACACTTTAAATGG - Intergenic
1107561024 13:41557703-41557725 GCTGAATTGTACACTTTAAAAGG + Intergenic
1107714348 13:43184575-43184597 ACTGAATTATACACTTTAAATGG - Intergenic
1108161212 13:47641771-47641793 ACTGAAAGGCATACTGGAAGGGG + Intergenic
1108175970 13:47792556-47792578 ATTAAAATGTACACTTTAAATGG + Intergenic
1108198429 13:48018383-48018405 ACAGAACTGTACACTTTAAAAGG - Intergenic
1108203480 13:48064579-48064601 ACTGAATTGCACACTTTAAAAGG - Intronic
1108240748 13:48461044-48461066 ACTGAATTGTACATTTTAAATGG - Intronic
1108288221 13:48929727-48929749 ATTGAAATTCACATTTTAAATGG - Intergenic
1108411412 13:50151293-50151315 AGTGAAATATACATTGTAAATGG - Intronic
1108431969 13:50362342-50362364 ACTGAACTGTACACTTAAAAAGG - Intronic
1108448335 13:50532314-50532336 ACTGAATTGTACCCTTTAAACGG - Intronic
1109249814 13:60005780-60005802 CCTGAAACGCACATTTTAAATGG + Intronic
1109454685 13:62569245-62569267 ACTGTAATGTACAAAGTAAAAGG - Intergenic
1110031909 13:70626488-70626510 TCTGAAATGCACAGTGTGTATGG + Intergenic
1110559376 13:76894169-76894191 ACTAAAATGGACAGGGTAAATGG + Intergenic
1110862993 13:80364710-80364732 AGTTAAATGAACACTGTATATGG - Intergenic
1111152287 13:84270526-84270548 ACTGAACTGTACACTTAAAATGG - Intergenic
1111269781 13:85866205-85866227 ATTGAAATATACACTTTAAAGGG + Intergenic
1112758103 13:102662371-102662393 ATTGAAATTCACACTTAAAATGG + Intronic
1113405304 13:110033325-110033347 ACTGATAGGCACACCATAAAAGG + Intergenic
1113568003 13:111330607-111330629 ACTGAATTGTATACTTTAAAAGG - Intronic
1113643854 13:111978387-111978409 GCTGAACTGTACACTGAAAATGG + Intergenic
1113647223 13:112007087-112007109 ACTGAACCGTACACTGAAAATGG + Intergenic
1113745240 13:112740083-112740105 ACTGAATTGTACATTGTAAAGGG + Intronic
1113944714 13:114037634-114037656 ACTGAATTGGACATTTTAAATGG + Intronic
1113975135 13:114222312-114222334 ACTAAAATATACACTATAAAGGG + Intergenic
1114145179 14:19967260-19967282 ACTGAATTGTACACTTTAAAAGG + Intergenic
1114507496 14:23228896-23228918 ACTGAATTGCACACTAACAATGG - Intronic
1114509597 14:23247281-23247303 ACTGAATTGCATACTTTAAAAGG - Intronic
1114702272 14:24691015-24691037 ACTGATTTGCACACTTTAAACGG - Intergenic
1115030657 14:28789313-28789335 AAAGAAATGTACACTGAAAATGG + Intronic
1115128932 14:30029932-30029954 ATTGAAGTGTACACTTTAAATGG - Intronic
1115263983 14:31482048-31482070 ACTGAAATGTTCACTAAAAATGG + Intergenic
1115273842 14:31584482-31584504 ACTGAATTGTACACTTCAAATGG - Intronic
1115309837 14:31967943-31967965 ACTGAATTGAACACTTTAAAAGG + Intergenic
1115529060 14:34309805-34309827 CCTGAAATGCACTTTCTAAATGG - Intronic
1115625328 14:35186399-35186421 ACTGAATTGTGCACTTTAAAAGG - Intronic
1115959755 14:38822091-38822113 ACTGAAATGTATACTTAAAATGG - Intergenic
1116003581 14:39269221-39269243 ACTGAAATGGACATTATAAAAGG - Intronic
1116086465 14:40245257-40245279 ACTGAAGTACACACTTAAAATGG - Intergenic
1116839654 14:49806906-49806928 ACTGAATTGTATACTTTAAAGGG - Intronic
1116857422 14:49965333-49965355 ACTGAATTGTACACTTAAAATGG + Intergenic
1117043931 14:51793382-51793404 ACTGAATTGTACACTTAAAATGG + Intergenic
1117109586 14:52436534-52436556 ACTGAATTGTACACTCTAAAAGG + Intronic
1117515495 14:56496631-56496653 ACTGAAATGTATACTTTATAGGG - Intronic
1117789216 14:59321399-59321421 ACTGAATTGTACACTTTAAAAGG + Intronic
1117825751 14:59701789-59701811 ACTGAATTGTACACTTTAAAAGG + Intronic
1117876788 14:60260559-60260581 ACTGAACTGTAAACTTTAAATGG - Intronic
1118316147 14:64727373-64727395 ACTGAACTGTACACTTAAAATGG - Intronic
1118660198 14:68000790-68000812 ACTGAAATCCACATGGTCAAGGG - Intronic
1118797583 14:69157305-69157327 ACTGAATTGTACACTTTAAAAGG - Intergenic
1119048929 14:71346727-71346749 ACTAAATTGTACACTTTAAATGG - Intronic
1119091839 14:71790061-71790083 ACTGAATTGCACACTTTAAAAGG - Intergenic
1119259650 14:73230208-73230230 ACTGAAAGGCAGACTGTGACGGG - Intergenic
1119367635 14:74107903-74107925 ACTGAATTGCACACTATAAATGG - Intronic
1119452071 14:74720225-74720247 ACTGAACTGTACACTTTAAAGGG - Intronic
1119495960 14:75079489-75079511 AATGAAATGTACACTTTAAGTGG + Exonic
1119581293 14:75784045-75784067 ACTGAATTGTACATTTTAAAAGG - Intronic
1120020260 14:79522167-79522189 ACTGTAATGCACAGGGGAAAAGG + Intronic
1120549977 14:85858527-85858549 AGAGAAATGCACACTGTATATGG + Intergenic
1121034275 14:90687158-90687180 ACTGAATTGCACACCTTCAATGG + Intronic
1121042992 14:90765427-90765449 ACTGAATTGTACACTTTAAAGGG + Intronic
1121044992 14:90781402-90781424 ACTGAAGTGGACACTCTGAATGG + Intronic
1121168277 14:91830669-91830691 ACTGAATTGTACATTTTAAAGGG + Intronic
1121233909 14:92378639-92378661 AATGAAATGCACAGTGGATAAGG - Intronic
1121642178 14:95492866-95492888 ACTGAATTGTACACTTTAAATGG + Intergenic
1122430778 14:101640462-101640484 ACTGACTTGTACACTTTAAATGG + Intergenic
1122536412 14:102466691-102466713 ACTGAGCTGCACACTGTAGAAGG - Intronic
1123124238 14:105934061-105934083 ACTGGAAAGCTCACTGGAAAAGG + Intergenic
1202938460 14_KI270725v1_random:117036-117058 ACTGAACTGTACACTTAAAATGG - Intergenic
1123505058 15:20933664-20933686 ACTGAATTGGACACTTTAAATGG + Intergenic
1123562303 15:21507359-21507381 ACTGAATTGGACACTTTAAATGG + Intergenic
1123598548 15:21944646-21944668 ACTGAATTGGACACTTTAAATGG + Intergenic
1123792843 15:23739979-23740001 ACTGAATTGTACACTCTAAAAGG - Intergenic
1123902167 15:24888021-24888043 ACTGAACTGTACACTTAAAATGG + Intronic
1124012016 15:25846269-25846291 ACGGAACTGCACACTTAAAAGGG + Intronic
1124260567 15:28186127-28186149 ACTGAACTGTACACTTAAAATGG + Intronic
1124388370 15:29228561-29228583 ACTGAATTGCACACTTAACATGG + Intronic
1124594924 15:31084233-31084255 ACTGAACTGCAGACTTTAATAGG - Intronic
1124969230 15:34468697-34468719 AATGAAATGTACAATGAAAAGGG + Intergenic
1124993581 15:34700299-34700321 ACTGAAATGTACAGTTAAAATGG - Intergenic
1125157698 15:36607736-36607758 ACTGAATTGTACACTTAAAAAGG - Intronic
1125163361 15:36673873-36673895 TCAGAAACACACACTGTAAAGGG + Intronic
1125431705 15:39602003-39602025 ATTGAATTGCACACTTTTAATGG + Intronic
1125471301 15:40006897-40006919 ACTGAAGTACATACTTTAAAGGG + Intronic
1125623950 15:41090742-41090764 ACTGAATTGCACACTATATAAGG + Intronic
1125692674 15:41609123-41609145 ACTGAATTGCATACTTTAAAGGG - Intergenic
1125696362 15:41640869-41640891 ACTGAATTATACACTTTAAATGG - Intronic
1125968408 15:43892791-43892813 ACTGAATTGTACACTTTAAAAGG + Intronic
1125977123 15:43964272-43964294 ACAGAAATGAACACGGAAAAAGG - Intronic
1125995385 15:44154888-44154910 ACTTAATTGTACACTTTAAATGG + Intronic
1126205828 15:46043581-46043603 ACAGAAAAGCAAACTGCAAATGG - Intergenic
1126458279 15:48888579-48888601 ACTGAACTGTACACTTAAAAAGG + Intronic
1126499820 15:49333192-49333214 ACTGAACTGTACACTTTAATGGG - Intronic
1126535531 15:49758502-49758524 ACTGAATTGTACACTTTAAATGG + Intergenic
1126746973 15:51836170-51836192 ACTGAACTGTACACTTTAAATGG - Intronic
1127047935 15:55047146-55047168 ATTGAAATACATACTTTAAATGG - Intergenic
1127072646 15:55301462-55301484 ACTGAATTGTACACTTTTAAGGG - Intronic
1127178990 15:56395006-56395028 ATTGAATTGCATACTTTAAAAGG - Intronic
1127185867 15:56480143-56480165 ACTGAACTGTACACTTAAAATGG + Intergenic
1127197473 15:56605057-56605079 ACTGAATTGTACACTGAAAATGG - Intergenic
1127952974 15:63828081-63828103 ACTGAATTGTACACTTTAAAAGG + Intronic
1128159182 15:65411952-65411974 ACTGAGTTGAACACTGTAAAGGG + Intronic
1128381579 15:67117049-67117071 ACTGAAACACACACTGAAAAGGG + Intronic
1128396065 15:67227435-67227457 ACTGAAATGCATATTTTAAATGG + Intronic
1128402954 15:67303390-67303412 ACTGAATTGTACACTTTAAAGGG + Intronic
1128585420 15:68845236-68845258 ACTGAACTGTACACTTGAAATGG - Intronic
1129261267 15:74368917-74368939 ATTGAATTGCATACTTTAAATGG + Intergenic
1129315976 15:74744423-74744445 ACTGAAATGTATACTTAAAATGG + Intergenic
1129517199 15:76163914-76163936 ACGGAATTGTCCACTGTAAAAGG - Intronic
1129557114 15:76522775-76522797 ACTGAATTGTACAGTTTAAATGG + Intronic
1129620727 15:77142941-77142963 ACTGAATTGCACACTTTAGTAGG + Intronic
1129988819 15:79943748-79943770 ACTGAATTGAACATTTTAAAAGG + Intergenic
1130029600 15:80299587-80299609 ATTGAATTGAACACTTTAAAAGG - Intergenic
1130035316 15:80355190-80355212 ACTTAATTGTACACTTTAAAAGG + Intronic
1130113329 15:80984704-80984726 ACTAAAATGTACACTTTACATGG + Intronic
1130504889 15:84529977-84529999 ACTGAACTGTACACTTCAAAGGG + Intergenic
1130703923 15:86213790-86213812 ACTGAATTGTACACTTTAAAAGG - Intronic
1130828933 15:87579906-87579928 ACGGAATTGTACAATGTAAACGG + Intergenic
1131608992 15:93941151-93941173 ACTGAAATGCAAAATGTAAATGG - Intergenic
1132050458 15:98603654-98603676 ACTGAATTTAACACTTTAAATGG + Intergenic
1132199081 15:99935791-99935813 ACTGAATTGTACACTCTGAATGG - Intergenic
1132349563 15:101131146-101131168 ACTGAACTGCACACCTAAAAAGG + Intergenic
1202970648 15_KI270727v1_random:234500-234522 ACTGAATTGGACACTTTAAATGG + Intergenic
1132562726 16:605388-605410 ACTGTATTGCAGACTTTAAAGGG - Intronic
1132860051 16:2066026-2066048 ACTGAACTGTTCACTGTGAATGG - Intronic
1133006589 16:2885021-2885043 GCCGAAATGTACACTTTAAATGG - Intronic
1133194744 16:4161015-4161037 ATTGAATTGTACACTTTAAATGG - Intergenic
1133255987 16:4516366-4516388 ACTGAATTGTACACTTTAAATGG + Intronic
1133410414 16:5563710-5563732 ACTGAATTGTACACCTTAAATGG - Intergenic
1134110504 16:11512675-11512697 ACTGAAGTGTACACTTTAAATGG + Intronic
1134114582 16:11538538-11538560 GCTGAATTGTACACTTTAAATGG + Intergenic
1134178931 16:12031875-12031897 ACTGAATTGTACACTTCAAATGG - Intronic
1134196789 16:12165296-12165318 ACTAGAAAGCACACTGCAAAAGG - Intronic
1134298146 16:12965275-12965297 ACTGAATTGTACACCTTAAAAGG - Intronic
1134666286 16:16021381-16021403 ACTGAATTGCATACTTAAAATGG - Intronic
1134780784 16:16893406-16893428 ACTGAATTGTACACTTTAAATGG - Intergenic
1134845187 16:17434070-17434092 ACTGAAGTGGATACTGTAATGGG - Intronic
1135127409 16:19822804-19822826 ACTGAACTGTATACTTTAAAAGG + Intronic
1135305676 16:21365627-21365649 ACTGAATTGTACACTTCAAATGG - Intergenic
1135385048 16:22031400-22031422 AATGAAATGTACACTTTAAAGGG - Intronic
1135615888 16:23910694-23910716 ACTGAATTGTACATTTTAAATGG - Intronic
1135942304 16:26832778-26832800 ACTGAAATGCAAAGAGAAAAGGG + Intergenic
1136302418 16:29344781-29344803 ACTGAATTGTACACTTCAAATGG - Intergenic
1136531565 16:30873479-30873501 ATTGAACTGTACACTTTAAATGG + Intronic
1136697098 16:32092140-32092162 ACTGAACTGTACACTTAAAATGG + Intergenic
1136700831 16:32139271-32139293 ACTGAACTGTACACTTAAAATGG + Intergenic
1136736553 16:32472743-32472765 ACTGAATTGTGCACTTTAAAGGG - Intergenic
1136766824 16:32788188-32788210 ACTGAACTGTACACTTAAAATGG - Intergenic
1136797597 16:33035431-33035453 ACTGAACTGTACACTTAAAATGG + Intergenic
1136801271 16:33082190-33082212 ACTGAACTGTACACTTAAAATGG + Intergenic
1136945091 16:34640170-34640192 ACTGAACTGTACACTTAAAATGG + Intergenic
1136955418 16:34779196-34779218 ACTGAACTGTACACTTAAAATGG + Intergenic
1137084995 16:36108838-36108860 ACTGAACTGTACACTTAAAATGG + Intergenic
1137087880 16:36151121-36151143 ACTGAACTGTACACTTAAAATGG + Intergenic
1137092324 16:36209278-36209300 ACTGAACTGTACACTTAAAATGG + Intergenic
1137221507 16:46456325-46456347 ACTGAACTGTACACTTAAAATGG - Intergenic
1137262352 16:46842030-46842052 ACTGAATTGCACACTTTAAGTGG - Intergenic
1137302279 16:47163165-47163187 ACTTAACTGTACACTTTAAACGG - Intronic
1137441189 16:48499601-48499623 ACTGAATTGCACTCTTTAAAAGG + Intergenic
1137656688 16:50165463-50165485 ACTGAACTGTACACTTTAAAAGG - Intronic
1138450294 16:57089919-57089941 ACTGACTTACACACTTTAAAAGG - Intergenic
1138468616 16:57212990-57213012 ACTGAAATTCTCAATTTAAATGG + Exonic
1138628112 16:58268922-58268944 ACTGAACTGTACACTTTAAATGG - Intronic
1138694170 16:58796150-58796172 ACAGAAATATACACTCTAAAGGG - Intergenic
1139066063 16:63316351-63316373 ACTGAAATGTAAACTTAAAATGG - Intergenic
1139112872 16:63913284-63913306 AAAGAAATGCACACTTTGAAAGG + Intergenic
1139488830 16:67275386-67275408 ACTGAACTGTACACTTAAAATGG - Intergenic
1139495530 16:67314316-67314338 ACTGAATTGCATGCTTTAAATGG - Intronic
1139500421 16:67359587-67359609 ACTGAATTGTACACTATAAAAGG + Intronic
1139567804 16:67790419-67790441 ACTGAATTACACACTGAAAATGG + Intronic
1139737773 16:69006813-69006835 ATTGAGGTGTACACTGTAAATGG - Intronic
1139775351 16:69313293-69313315 ACTGAATTATACACTTTAAATGG - Intronic
1139796322 16:69485938-69485960 ACTGAATTGTAAACTTTAAAAGG - Intergenic
1139811384 16:69621307-69621329 ACTGAATTGTACCCTCTAAATGG - Intronic
1139963701 16:70733016-70733038 ACTGAATTGCACACTTTAAAAGG - Intronic
1140140714 16:72254648-72254670 ATTGAATTGTACACTTTAAATGG - Intergenic
1140317600 16:73914079-73914101 ACTGAATTGTGCACTTTAAATGG + Intergenic
1140416432 16:74776937-74776959 ACTGAACTGTACACTGAAAATGG + Intergenic
1140861715 16:79024216-79024238 ACTGAACTGTACACTTTAAGTGG + Intronic
1140932601 16:79641547-79641569 ACTGAATTGTACACTTTAAAGGG - Intergenic
1140968120 16:79987125-79987147 ACTGAAACGCAACCTGAAAATGG + Intergenic
1141028111 16:80566762-80566784 ACTGAATTGTACACATTAAAAGG + Intergenic
1141036663 16:80632527-80632549 ACTGAATTGTACATTTTAAAAGG + Intronic
1141108955 16:81256477-81256499 AATGAAATGCGTTCTGTAAAAGG + Intronic
1141163272 16:81643476-81643498 GCTGAAGTGTTCACTGTAAATGG + Intronic
1141250274 16:82349923-82349945 ACTGAATTGAACACTTTAAATGG + Intergenic
1141411117 16:83833779-83833801 CCTGAAAACCACACTGTGAAAGG + Intergenic
1141446884 16:84065529-84065551 ACCGAATTGTACACTTTAAAAGG + Intronic
1141607363 16:85162124-85162146 ATTGAATTGTACACTTTAAATGG + Intergenic
1141610612 16:85179032-85179054 ACTGAACTGTACACTTTCAAAGG - Intronic
1141612598 16:85191333-85191355 ATTGAATTGTACACTTTAAAGGG - Intergenic
1141709869 16:85692068-85692090 ACTGAATTGTACACTTTAAAAGG + Intronic
1141861147 16:86717319-86717341 ACTGAATTGTCCACTTTAAATGG + Intergenic
1141883628 16:86876505-86876527 ACTGAATTGTACACATTAAATGG + Intergenic
1141924863 16:87161415-87161437 ACTGAGTTGTACACTTTAAATGG + Intronic
1141928184 16:87182901-87182923 ACTGAATTGCATACTTTAAAAGG - Intronic
1142022486 16:87792489-87792511 ACTGAATTGCGCACTCTAAATGG - Intergenic
1142217474 16:88836955-88836977 ACAGAACTGCACACTTCAAATGG + Intronic
1142293436 16:89203147-89203169 ACTGAACTGCACACTTAAAATGG - Intergenic
1203016515 16_KI270728v1_random:356835-356857 ACTGAATTGTGCACTTTAAAGGG + Intergenic
1203034850 16_KI270728v1_random:629993-630015 ACTGAATTGTGCACTTTAAAGGG + Intergenic
1203069219 16_KI270728v1_random:1050440-1050462 ACTGAACTGTACACTTAAAATGG - Intergenic
1142878896 17:2869405-2869427 ACTGAATTGCAAACTTAAAAAGG + Intronic
1143003367 17:3810114-3810136 ACTCAAGTGTACACTTTAAATGG + Intergenic
1143051428 17:4129128-4129150 ACTGAATTATACACTTTAAAAGG - Intronic
1143294391 17:5859844-5859866 GCAGAAATGCACACTGGGAATGG - Intronic
1143690269 17:8556726-8556748 ACTGAACTGTACACTGAAAAAGG + Intronic
1143956303 17:10672519-10672541 ACTGAACTGCGCACTTTAAAAGG - Exonic
1144097108 17:11909782-11909804 TTTGAATTGCACACTTTAAATGG - Intronic
1144385502 17:14745693-14745715 ACTGAATTGTACACTTAAAATGG - Intergenic
1144433857 17:15221687-15221709 AATGAATTGTACACTGTAACTGG - Intergenic
1144434635 17:15229533-15229555 GCTGAAATGGAGGCTGTAAATGG - Intergenic
1144438121 17:15259343-15259365 ACTTAAAAGCACCTTGTAAATGG + Intronic
1144562642 17:16334004-16334026 ACTGAATTGTACACGTTAAAGGG + Intronic
1144788112 17:17842965-17842987 ACTTAATTGTACACTTTAAATGG + Intergenic
1144800694 17:17924395-17924417 ACTGACTTGTACATTGTAAATGG + Intronic
1145012399 17:19377338-19377360 ACTGAATTGTACACTATAAAAGG + Intronic
1145108600 17:20141585-20141607 ACTGGATTGCACACTGTAAATGG - Intronic
1145326605 17:21835671-21835693 ACTGAACTGTACACTTAAAATGG - Intergenic
1145689581 17:26724837-26724859 ACTGAACTGTACACTTAAAATGG - Intergenic
1145897531 17:28469053-28469075 ACTGAGCTGTACACTGAAAAAGG + Intronic
1146114340 17:30121525-30121547 AGTGAATTGTACACTTTAAAAGG - Intronic
1146147829 17:30437249-30437271 ATTGAATTGTACACTTTAAATGG + Intronic
1146199220 17:30841513-30841535 ACTGAATTGTACACTTTAAATGG - Intronic
1146241188 17:31228469-31228491 ACTGAATTGGACACTTTAAATGG - Intronic
1146483259 17:33222525-33222547 ATTGAATTGCACACTTTAAATGG + Intronic
1146600152 17:34207068-34207090 ACTGAACTGTACACTTTAAAGGG - Intergenic
1146795615 17:35778415-35778437 ACTGAATTGTACACTTTAAATGG + Intronic
1147152294 17:38524627-38524649 ACTGAACTGTAGACTTTAAAAGG + Intergenic
1147222692 17:38948001-38948023 ACTGAATTGTACACTTTAAATGG - Intronic
1147222907 17:38949956-38949978 ATTGAATTGCACACTTTAAATGG - Intronic
1147422398 17:40328459-40328481 ACTGAATTGTACACTTTAATGGG - Intronic
1147983655 17:44291327-44291349 ACTGAATTGTGCACTTTAAATGG - Intergenic
1148318831 17:46731453-46731475 ACTGAATTGTACACTTTAAATGG + Intronic
1148405959 17:47416155-47416177 ACTGAATGGTACACTTTAAAAGG - Intronic
1148427262 17:47610061-47610083 ACTGAATTGTATACTTTAAAAGG - Intronic
1148474763 17:47920814-47920836 ACTGAATTGTATACTTTAAAAGG - Intronic
1148803479 17:50249780-50249802 ATTGAATTGTACACTTTAAATGG - Intergenic
1149041109 17:52189360-52189382 ACTGAGTTGCACACTTTGAAAGG - Intergenic
1149066672 17:52488974-52488996 CATGAAAGGCACACTGTAAACGG - Intergenic
1149080353 17:52648934-52648956 ACTGAAATGAACATTGTTATTGG - Intergenic
1149831672 17:59877796-59877818 ATTGACTTGCACACTTTAAATGG + Intronic
1149919955 17:60648689-60648711 ACTGAATTATACACTTTAAAAGG - Intronic
1149985310 17:61342686-61342708 ACAGAAATAAACACAGTAAAGGG + Intronic
1150191595 17:63246352-63246374 ACTGAATTGTACACTTGAAATGG - Intronic
1150310495 17:64125089-64125111 ACCGAATTGTACACTTTAAATGG + Intronic
1150381257 17:64721909-64721931 ACTGAAATGTACAGTTTACAAGG + Intergenic
1150581483 17:66477754-66477776 CCTGAAGTGTACACTTTAAATGG - Intronic
1150775244 17:68076194-68076216 ACTGAATTGTACACTTTACAAGG - Intergenic
1150935356 17:69629199-69629221 ACTGAATTGTACACATTAAAAGG + Intergenic
1151246841 17:72801592-72801614 ATGGAATTGCACATTGTAAATGG + Intronic
1151339757 17:73463317-73463339 AGTGGAATGCACACTTTACAAGG - Intronic
1151396850 17:73828457-73828479 ACTGAATTGTACACCTTAAAAGG - Intergenic
1151432293 17:74071691-74071713 ACTGAATTGCACGCTTTAAGTGG - Intergenic
1151809939 17:76433549-76433571 CTTGAACTGCACACTTTAAAAGG + Intronic
1151873483 17:76852338-76852360 ACTGAATTGTACACTCTAAAGGG - Intergenic
1152154848 17:78626224-78626246 ATTGAATTGTACACTTTAAATGG + Intergenic
1152219296 17:79053083-79053105 ACTGAATTCTACACTTTAAATGG + Intergenic
1152324676 17:79628580-79628602 CCTCAATTGCACACTTTAAATGG - Intergenic
1152385275 17:79970387-79970409 ACTGCATTGTACACTTTAAAAGG + Intronic
1203182874 17_KI270729v1_random:80799-80821 ACTGAACTGTACACTTAAAATGG + Intergenic
1203190797 17_KI270729v1_random:186264-186286 ACTGAACTGTACACTTAAAATGG - Intergenic
1153070150 18:1096161-1096183 ACTGAACTGTACACTGAAAATGG - Intergenic
1153081192 18:1227217-1227239 ACTGAATTGTACACTTTAAATGG - Intergenic
1153112808 18:1612818-1612840 AATTAAATGCACACTGAAATAGG - Intergenic
1153132176 18:1866904-1866926 ACTGAAATGTACACTTAAAAAGG + Intergenic
1153318883 18:3752233-3752255 ACTGAAGTACACACTTTAAAAGG - Intronic
1153674065 18:7440034-7440056 ATGGAATTGCACACTTTAAATGG - Intergenic
1153727716 18:7974584-7974606 ACTGAACAACAAACTGTAAAGGG - Intronic
1153942500 18:9990227-9990249 CCTGAAATGGACAATATAAAAGG - Intergenic
1154275382 18:12954830-12954852 ACTAAATTGTACACTTTAAATGG - Intronic
1154316694 18:13309908-13309930 ACTGAACTTCAAACTGTCAATGG + Intronic
1154421081 18:14228439-14228461 ACTGAGTTGCACATTTTAAATGG - Intergenic
1154462289 18:14604700-14604722 ACTGAATTGTACACTTTAAAAGG + Intergenic
1154516412 18:15171509-15171531 ACTGAACTGTACACTTAAAATGG + Intergenic
1155173049 18:23281253-23281275 ACTGAATTGTACACTTCAAATGG + Intronic
1155182709 18:23361907-23361929 ACTGAAGTGTACACTTTAAAAGG - Intronic
1155308626 18:24502655-24502677 ATTGAACTGTACACTTTAAATGG + Intergenic
1155520931 18:26668453-26668475 ACTGAATTGGACCCTGCAAAAGG + Intergenic
1155820730 18:30371823-30371845 ACTGAATCGCACTCTTTAAATGG - Intergenic
1156364557 18:36413781-36413803 ACTGAAATGTACACTTAAAATGG - Intronic
1156371147 18:36472435-36472457 ACTGAATTGCACACTTTAAAAGG - Intronic
1156394921 18:36690790-36690812 ACTGAAATACACATTTAAAATGG - Intronic
1156736619 18:40267332-40267354 ACTAAAATGAGCACTTTAAAAGG + Intergenic
1156839815 18:41598163-41598185 ACTGAATTGTACACTTTAAAAGG - Intergenic
1157388465 18:47280530-47280552 ACTGAAATGTACACTTCAAAGGG - Intergenic
1157744540 18:50123382-50123404 ACTGAACTGTACACTTTAAATGG + Intronic
1157809828 18:50687064-50687086 ACTGAACTGTACAATTTAAATGG - Intronic
1157832524 18:50869805-50869827 ACAGCAATGCACAATGCAAATGG + Intergenic
1158046094 18:53157200-53157222 AAGGGAATGCACACAGTAAATGG - Intronic
1158193952 18:54863544-54863566 ACTGAACTGTACTCTTTAAAAGG - Intronic
1158296327 18:56000962-56000984 CCTGAACTGTACACTGTAAAAGG + Intergenic
1158330210 18:56354171-56354193 ACTGAAATGTATACTTTAAATGG - Intergenic
1158376709 18:56878598-56878620 ACTGAATTCCACATTTTAAAAGG - Intronic
1158477808 18:57795819-57795841 ACTGAACTGTGCACTGAAAAAGG + Intronic
1158513388 18:58110996-58111018 ATTGAATTATACACTGTAAATGG - Intronic
1158713328 18:59856314-59856336 GCTGAATTGCACACTTTAAAGGG - Intergenic
1159063129 18:63538224-63538246 ACTGAGTTACACACTTTAAAAGG - Intergenic
1159148846 18:64493806-64493828 AATGAAATGGACACAGAAAATGG + Intergenic
1159363888 18:67441018-67441040 ACTGAACTGTACACTTAAAATGG - Intergenic
1159554129 18:69927421-69927443 ACTGAACTGTACATTTTAAAAGG - Intronic
1160214294 18:76913983-76914005 ACTGAATTGTACACTTTAAGTGG - Intronic
1160333479 18:78016464-78016486 ACTGACATGTACACTTTAGAAGG + Intergenic
1160561626 18:79762164-79762186 ACTGAATTGTACACATTAAAGGG + Intergenic
1160730131 19:638296-638318 ACTGAACTGTACAGTGTAAGTGG + Intergenic
1160893565 19:1392357-1392379 ACTGAACTGCTCGCTTTAAAAGG - Intronic
1161052673 19:2172998-2173020 ACTGAAATGTACACTTAAAACGG - Intronic
1161062895 19:2223856-2223878 TCTGAATTGCACACTTTAAATGG - Intronic
1161174072 19:2829729-2829751 ACTGAACTGCACACTTAAAAGGG - Intronic
1161438088 19:4275871-4275893 ACTGAATTGTACACTCTAAATGG + Intergenic
1161906296 19:7159213-7159235 ACAGAACTGCACACTTAAAATGG - Intronic
1161940868 19:7402989-7403011 ATTGAATTGTACACTGTAAAAGG - Intronic
1162010278 19:7809137-7809159 ACTGAATTGTATACTTTAAATGG + Intergenic
1162061741 19:8100305-8100327 ACTGAACTGCACACTAAAAATGG + Intronic
1162663928 19:12194039-12194061 ACTGAATTGTACACTTAAAAGGG + Intergenic
1162867922 19:13562861-13562883 ACTGAATTGTACACTTTAAAGGG + Intronic
1163001046 19:14367475-14367497 ACTGAACTGTACACTTAAAATGG - Intergenic
1163052674 19:14696227-14696249 ACTGAACTGCACACTTTAAAGGG - Intronic
1163111540 19:15164161-15164183 ATTGAATTGTACACTTTAAATGG + Intronic
1163166780 19:15503827-15503849 ACTGAATTCTACACTTTAAAGGG - Intergenic
1163249227 19:16116433-16116455 ACTGAATTGTACACTGCAAATGG - Intronic
1163553287 19:17978064-17978086 ACTGAATTGTGCACTTTAAATGG + Intronic
1163639584 19:18454132-18454154 ACTGAGCTGCTCACTTTAAATGG + Intronic
1163811814 19:19437464-19437486 ACTGAATTGCACACTTCAAATGG - Intronic
1164251554 19:23481871-23481893 TTTTAAATGCACACTTTAAAAGG - Intergenic
1164999058 19:32745395-32745417 ACTGTAATACACACGTTAAAAGG - Intronic
1165382799 19:35493067-35493089 ACCACAATGGACACTGTAAAGGG - Intronic
1165551252 19:36588202-36588224 ATTGAATTGTACACTTTAAATGG + Intronic
1165577071 19:36829156-36829178 ATTGAATTGTTCACTGTAAATGG - Intronic
1165801611 19:38554933-38554955 ACTGAACTGTACATTTTAAATGG - Intronic
1166153758 19:40894827-40894849 ACTGAACTGGACACTTAAAATGG - Intronic
1166534983 19:43567609-43567631 GCTGAAATGTGCACTTTAAATGG + Intronic
1166574280 19:43822591-43822613 ACTGAATTGTACACTTTAAATGG + Intronic
1166574287 19:43822755-43822777 ACTGAATTGTACACTTTAAATGG + Intronic
1166606096 19:44144043-44144065 ACTGAATTGTACACTTGAAATGG - Intronic
1166617467 19:44263190-44263212 ACCGAATTGCACACTTTAAAAGG - Intronic
1166695632 19:44849914-44849936 ACTGAACTGTACACTTTAAATGG + Intronic
1166710687 19:44935257-44935279 ATTGAACTGTACACTTTAAAAGG + Intergenic
1167216451 19:48168818-48168840 ACTGACTTGTACACTTTAAATGG + Intronic
1167416926 19:49378949-49378971 ACTGAATTATACACTTTAAATGG + Intergenic
1167487474 19:49771388-49771410 GCTGAATTGTTCACTGTAAAAGG + Intronic
1167876123 19:52414182-52414204 ACTGAAATTCACAAGGTGAATGG - Intronic
1168236247 19:55065020-55065042 ACTGAATTGTACACTTAAAATGG + Intronic
1168278419 19:55289769-55289791 ACTGAATTACACACTCTAAAAGG - Intronic
1168399472 19:56076688-56076710 ACAGAAATGCTCACTGCAACTGG - Intergenic
1168429719 19:56268660-56268682 ACTGAATTGTACACTTAAAATGG - Intronic
1168548482 19:57273701-57273723 ACTGAACTACACACTGTATTTGG + Intergenic
1168636091 19:57998672-57998694 ACTGAATTACACACTTTAAAAGG + Intronic
1168688052 19:58360259-58360281 ACTGAATTACACACTTTAAAAGG + Intronic
925472601 2:4179030-4179052 ACTGAACTGCACACTTAAGATGG + Intergenic
925633616 2:5920772-5920794 ATTGAATTGTACACTTTAAAGGG + Intergenic
925680176 2:6412066-6412088 ACTGATGTGTACACTTTAAATGG - Intergenic
925895378 2:8467611-8467633 ACTGGAATGTACACTTTAAGTGG - Intergenic
925957440 2:8981287-8981309 ATTGAATTGTACACTTTAAATGG + Intronic
926123765 2:10258697-10258719 ACTGCAAAGCACACAGGAAATGG + Intergenic
926174421 2:10576825-10576847 ACTGAATTGTACACTTTAAAAGG + Intronic
926459984 2:13117143-13117165 ACTGAATTGTATACTTTAAAAGG + Intergenic
926767670 2:16336509-16336531 ACTGAGATGTACACTGGGAATGG - Intergenic
926983271 2:18594095-18594117 ATTGAATTGTACACTTTAAATGG - Intergenic
927115264 2:19894098-19894120 ATTGAACTGTACACTTTAAATGG + Intergenic
927387896 2:22557394-22557416 CATGACATGCACAGTGTAAATGG - Intergenic
927414382 2:22862638-22862660 ACTGAATTGTAGACTTTAAATGG + Intergenic
927590345 2:24350965-24350987 ACTGAACTGTAAACTTTAAAAGG + Intronic
927829317 2:26335070-26335092 ATTGAAATGTACTCTTTAAAAGG - Intronic
927848072 2:26481634-26481656 ACTGAAATGTACACTTTAAAAGG - Intronic
927915518 2:26933693-26933715 CCTGAAATGCCCACTGAAACTGG - Intronic
928064078 2:28145604-28145626 ACTGAACTGTACACTTTAAATGG - Intronic
928539684 2:32272937-32272959 ACTGAATTGTACACTTTAAATGG - Intergenic
928764403 2:34625869-34625891 ACTGAATTGCATAATTTAAAGGG + Intergenic
929068093 2:38000371-38000393 ACTGAACTGTACACTTAAAATGG - Intronic
929191412 2:39143900-39143922 ACTGAATTGCACACTTAAGATGG - Intergenic
929405376 2:41636016-41636038 ACTGAATTGTACACTTAAAATGG + Intergenic
929634733 2:43506684-43506706 ACTGAATTGTACACTTTAAAAGG + Intronic
929661539 2:43790633-43790655 ACTGAAAGACACAAAGTAAAAGG + Intronic
929713462 2:44287962-44287984 ACTGAATTACACACTCAAAAGGG - Intronic
929842383 2:45482073-45482095 ACTGACTTGTACACTTTAAAAGG + Intronic
929844697 2:45511115-45511137 ACTGAATTGCAGGCTGTACAAGG + Intronic
929932136 2:46266224-46266246 ACTGAATTGTACAATTTAAAAGG - Intergenic
930258788 2:49121384-49121406 ACTGTAAAGTACCCTGTAAATGG + Intronic
930401666 2:50897042-50897064 GCTAAAATGCACAGTGTTAATGG - Intronic
930663048 2:54074512-54074534 ACTGAATTGTACATTTTAAATGG + Intronic
930792843 2:55352517-55352539 ACTGAATTGTTCACTCTAAAAGG + Intronic
930854997 2:56005841-56005863 ACAGAAATGGACAATGTGAATGG - Intergenic
931141980 2:59470060-59470082 ACAGAAAAGCAAACTGCAAACGG + Intergenic
931310422 2:61074364-61074386 ACTGAACTACACACTTTAAAAGG - Intronic
931487830 2:62711228-62711250 ACTGAACTGTACACTTAAAATGG - Intronic
931489417 2:62727347-62727369 ACTGAATTGTACACTTTAAAAGG - Intronic
931577477 2:63733783-63733805 ACTGAATTGTACACTTTCAAGGG - Intronic
931643118 2:64398812-64398834 ACTGAACTGTACACTTAAAATGG + Intergenic
932186731 2:69703292-69703314 ACTGAATTGCATACTTTAAAAGG - Intronic
932283639 2:70515273-70515295 ACTGAAATGTACAATTAAAATGG - Intronic
932370559 2:71183878-71183900 ACTGAAATGTACACTTGAAATGG + Exonic
932680528 2:73820775-73820797 ACTGAATTGTACACTTAAAATGG - Intergenic
933243794 2:79952472-79952494 ACTGAATTGAACACTTTCAAGGG + Intronic
933465803 2:82649718-82649740 ACTGAATTGTACACTTTAAATGG + Intergenic
933795995 2:85919988-85920010 ACAGAACTGCATACTTTAAAAGG - Intergenic
933914009 2:86970350-86970372 ACTGAACTGTACACTTTAAATGG - Intronic
933984585 2:87580226-87580248 ACTGAACTGTACACTTAAAATGG + Intergenic
934008984 2:87799548-87799570 ACTGAACTGTACACTTTAAATGG + Intronic
934308913 2:91846086-91846108 ACTGAATTGTGCACTTTAAAGGG + Intergenic
934534300 2:95120538-95120560 ACTGAAATGTACACTTTAAACGG + Intronic
934546706 2:95223742-95223764 ACTGAATTGTACATTTTAAATGG - Intronic
934794471 2:97088841-97088863 ACTGAAATAGACACTTTATAAGG - Intronic
934878111 2:97945415-97945437 ACTGAATTATACACTTTAAAAGG + Intronic
934924476 2:98372373-98372395 TCTGGAATGCACACTGACAAGGG + Intronic
935188851 2:100759440-100759462 ACTGAATTGTACACTCAAAAAGG + Intergenic
935190484 2:100774262-100774284 ATTGAATTGTACACTTTAAAGGG + Intergenic
935772573 2:106440239-106440261 ACTGAACTGTACACTTTAAATGG + Intronic
935907499 2:107855675-107855697 ACTGAACTGTACACTTTAAATGG - Intronic
935993902 2:108747830-108747852 ACTGAACCGTACACTTTAAATGG - Intronic
936046599 2:109193322-109193344 ACTGAATTGTACACTTTGAATGG - Intronic
936129289 2:109820817-109820839 ACTGAACTGTACACTTTAAATGG - Intronic
936215408 2:110550668-110550690 ACTGAACTGTACACTTTAAATGG + Intronic
936309268 2:111370574-111370596 ACTGAACTGTACACTTAAAATGG - Intergenic
936383345 2:112007070-112007092 ACTGAATTGTACACTTAAAATGG - Intronic
936424545 2:112405241-112405263 ACTGAACTGTACACTTTAAATGG + Intronic
936467665 2:112767574-112767596 ATTGAATTGTACACTGTAAGTGG - Intergenic
936620435 2:114090804-114090826 ACTGAAATGTACATTTTTAAAGG - Intergenic
937128945 2:119492581-119492603 ACTAAATTGTACACTTTAAATGG - Intronic
937130616 2:119509688-119509710 ACTGAATTGCACACATTAAATGG - Intronic
937181357 2:119998474-119998496 ACTGAATTGTACACTTTAAATGG + Intergenic
937195242 2:120149229-120149251 ATTGAATTGCACACTTTAAATGG - Intronic
937373736 2:121320916-121320938 ACTGAATTGTATACTTTAAAAGG - Intergenic
937400511 2:121578939-121578961 ACTGAATTGTACACTTTAACAGG - Intronic
937545590 2:123014755-123014777 ACTGAACTGTACACTGAAAATGG + Intergenic
937569818 2:123343237-123343259 ACTGAATTGGACACTTAAAATGG - Intergenic
937923368 2:127147725-127147747 ATTGAATTGTACACTTTAAATGG - Intergenic
938168300 2:129052068-129052090 ACTGAAAGGCACACTTAAAATGG + Intergenic
938368329 2:130753472-130753494 ACTGAACTGTACACTTAAAAAGG + Intergenic
938396851 2:130957109-130957131 ATTAAATTGCACACTTTAAAAGG - Intronic
938426307 2:131192313-131192335 ACTGAATTGGACACTTTGAATGG + Intronic
938716415 2:134026345-134026367 ACTGAACTGTACACTTAAAATGG + Intergenic
938850481 2:135254673-135254695 ATTGAATTGGACACTATAAAAGG - Intronic
938898363 2:135775744-135775766 ACTGAACTGTACACTTTAAAAGG + Intronic
939797127 2:146659296-146659318 ATTGAATTGCACACTTTTAAAGG + Intergenic
939847240 2:147262297-147262319 ACTGAAGTGTACACTTAAAATGG - Intergenic
940058584 2:149539697-149539719 ACTGAATTGTACACTTTGAAGGG - Intergenic
940277691 2:151956641-151956663 CCTGAATTGTACACTTTAAACGG + Intronic
940546715 2:155098627-155098649 ATTGAAATGTACACTTTAAATGG + Intergenic
940853607 2:158711613-158711635 ACTGAACTGTACACTACAAATGG - Intergenic
940936577 2:159502268-159502290 ACTGAATTGTATACTTTAAATGG + Intronic
941259366 2:163277203-163277225 ACTAAAATGCAAACTCCAAAAGG + Intergenic
941631858 2:167892831-167892853 CCTGAATTGAACACTGTAAAGGG - Intergenic
941752554 2:169148411-169148433 AGTGAATTGTACACTTTAAATGG + Intronic
941793895 2:169579457-169579479 ATTGAATTGTACACTTTAAATGG - Intergenic
941979187 2:171435860-171435882 ATTGAACTGTACACTTTAAATGG - Intronic
942009099 2:171740829-171740851 ACTGAATTGTATACTTTAAAAGG - Intronic
942201982 2:173580430-173580452 ACTGAATTGTACACTTTAAAAGG - Intergenic
942282866 2:174384481-174384503 ACTGAATTGCACACTTAAAATGG + Intronic
943216239 2:185039737-185039759 ACTGAAATACACAGAGAAAAAGG + Intergenic
943300140 2:186188131-186188153 ACTGAACTGTACACTTAAAATGG + Intergenic
943667520 2:190625520-190625542 ACTGAATTGCACACGTTGAAAGG + Intergenic
943749742 2:191499087-191499109 ACTGAACTGTACACTTAAAATGG - Intergenic
943752781 2:191527090-191527112 ACTGAATTGTACAATTTAAAGGG - Intergenic
944500260 2:200352017-200352039 ACTGAGATGTACACTGAAATGGG - Intronic
944572094 2:201055229-201055251 ACTGAAATGTACATTAAAAATGG - Intronic
944633043 2:201646900-201646922 ACTGAACTGTACACTTAAAACGG + Intronic
944687172 2:202127846-202127868 ACTGGACTGCACACTAAAAATGG - Intronic
944703718 2:202268093-202268115 AGTGAATTGTACACTTTAAAAGG + Intronic
945004798 2:205393202-205393224 TCTGAAATTCACCCTATAAAAGG - Intronic
945511723 2:210711508-210711530 ATTGAATTGTACACTTTAAATGG - Intergenic
945623969 2:212176753-212176775 ACTGACATACACATTATAAAAGG - Intronic
945726940 2:213481935-213481957 ACTGAAATACATACTATAATTGG + Intronic
946031583 2:216709141-216709163 ATTGAATTGTACACTTTAAATGG - Intergenic
946063900 2:216969433-216969455 ACTGAATTGTACACTTTAAATGG - Intergenic
946184377 2:217970841-217970863 ATTGAATTGTACACTTTAAATGG + Intronic
946315882 2:218911903-218911925 ATTGAACTGCACATTTTAAATGG - Intergenic
946483975 2:220083150-220083172 ACTGAACTGCACATTTTTAATGG - Intergenic
946647879 2:221858340-221858362 ACTGAATTGTACACTTTAAATGG - Intergenic
946739412 2:222787285-222787307 ACAGAATTACACACTTTAAATGG + Intergenic
946741238 2:222803980-222804002 ACTGAATTGTACACTTCAAATGG - Intergenic
946929648 2:224659192-224659214 ATTGAATTGCACACTTTACATGG - Intergenic
947272053 2:228347550-228347572 ACTGAATTGGACACTTTAAAAGG - Intergenic
947296914 2:228641242-228641264 ATTGAAAGTCACACTGAAAATGG + Intergenic
948032063 2:234826907-234826929 ACTGAAGTGCATACTTTAAATGG + Intergenic
948240710 2:236431064-236431086 ATTGAATTGCACACTTGAAATGG - Intronic
948546730 2:238737635-238737657 ACTGAAATGCAGAGAGGAAAAGG - Intergenic
948769328 2:240240422-240240444 ATTGAATTGTACACTTTAAATGG - Intergenic
948929336 2:241121297-241121319 ACTGAACTGTTCACTCTAAATGG + Intronic
1169281546 20:4271553-4271575 ACTGAAGTGTATACTTTAAATGG - Intergenic
1169324287 20:4662678-4662700 ACTGAGACAGACACTGTAAAGGG + Intergenic
1169334674 20:4746471-4746493 ACTGAATTGCACACTTTATGAGG + Intergenic
1169472565 20:5900806-5900828 ACTGAATTTTACACTTTAAAGGG + Intergenic
1169742841 20:8914058-8914080 ACTGCATTGTACACTTTAAATGG - Intronic
1170189903 20:13635106-13635128 ACTGAATTGTACACTTTGAATGG + Intronic
1170209301 20:13832088-13832110 ACTGAATTGTTCACTATAAAAGG - Intergenic
1170220141 20:13933286-13933308 ATTGAATTGTACACTTTAAATGG - Intronic
1170687497 20:18582513-18582535 ACTGAACTGCACACATAAAATGG - Intronic
1170909741 20:20554025-20554047 ACTGAATTGTACACTTTATAGGG - Intronic
1170992252 20:21313955-21313977 ACTGAGTTGTACACTTTAAATGG - Intronic
1171129356 20:22634828-22634850 ACTGAATTTTACACTTTAAAAGG - Intergenic
1172440409 20:34961520-34961542 ACTGAATTGCACACTTTAAAGGG - Intergenic
1172571998 20:35977816-35977838 ACTGAATTGTACACTTTAAATGG + Intronic
1172726196 20:37043970-37043992 ACTGAATTGTACACTTAAAATGG + Intronic
1172774785 20:37400747-37400769 ACTGAACTGAACACTTAAAAGGG - Intronic
1172797941 20:37556094-37556116 ACTGAATTGTATACTTTAAAGGG + Intergenic
1172811807 20:37653519-37653541 ACCCAAGTGCACACTTTAAAAGG + Intergenic
1173053329 20:39586688-39586710 GCTGAATTGCTCACTTTAAAAGG - Intergenic
1173352924 20:42261561-42261583 AATGAAATGCAAACTCTAAAAGG + Intronic
1173461148 20:43244372-43244394 ACGGAATTGCACACCGAAAATGG + Intergenic
1173496224 20:43519963-43519985 ACTGAATTGTACACTTCAAATGG - Intronic
1173532390 20:43780350-43780372 ACTGAGATGATCAATGTAAAAGG - Intergenic
1173653041 20:44679632-44679654 CCTGAATTGTACACTTTAAATGG - Intergenic
1174038698 20:47684101-47684123 ACAGAATTGCACACTTTAATTGG + Intronic
1174213991 20:48902075-48902097 ATTGAATTGTACACTTTAAAAGG - Intergenic
1174214740 20:48907656-48907678 ACTGAATTGTACACTTTAAATGG - Intergenic
1174267550 20:49342867-49342889 ATTGAACTGTACACTTTAAATGG - Intergenic
1174464538 20:50707082-50707104 ACTGAACTGTACAATTTAAAGGG + Intergenic
1174903893 20:54529594-54529616 ACTGAATTATACACTTTAAAAGG - Intronic
1175516383 20:59572945-59572967 ACTGAATTGTTCACTTTAAAAGG - Intergenic
1175969507 20:62677250-62677272 ACCGAATTGTACACTTTAAAGGG + Intronic
1176185788 20:63778147-63778169 TCTGAACTGCAGACTTTAAATGG + Intronic
1176584853 21:8572100-8572122 ACTGAACTGTACACTTAAAATGG + Intergenic
1176812270 21:13553985-13554007 ACTGAATTGTACACTTTAAAAGG - Intergenic
1176852392 21:13931522-13931544 ACTGAATTGTACATTTTAAATGG + Intergenic
1177003093 21:15637372-15637394 ACTGAACTGTATACTTTAAAAGG - Intergenic
1177346250 21:19875236-19875258 ACTGAATTGCACACTTTAAAAGG + Intergenic
1177738547 21:25123760-25123782 ACTGAATTGAACACTGTAAAAGG + Intergenic
1177963487 21:27698383-27698405 ATTGAATTGTACACTTTAAATGG - Intergenic
1178045774 21:28693113-28693135 ATTGAAATGTACACTTTAAAAGG + Intergenic
1178221122 21:30661309-30661331 ACTGAATTGTGCACTTTAAAAGG + Intergenic
1178272775 21:31208056-31208078 ACAGAAATAAACACTTTAAAGGG + Intronic
1178541880 21:33458700-33458722 ACTGAACTGCATATTTTAAATGG + Intronic
1178598823 21:33978394-33978416 ACTGAACTGCATACTTAAAATGG - Intergenic
1178748705 21:35279876-35279898 GCTGAATTGCATACTTTAAAGGG - Intronic
1178956598 21:37028286-37028308 CCTGAACTGTACACTTTAAAAGG - Intergenic
1179040576 21:37798865-37798887 ACTGAATTGTACAATTTAAATGG + Intronic
1179174632 21:38999559-38999581 ACTGAATTGTACACTTAAAAAGG + Intergenic
1179192556 21:39135842-39135864 CCTCAAATGCACACTGCTAAGGG + Intergenic
1179202486 21:39237768-39237790 ACTGAACTGCATGCTTTAAATGG + Intronic
1179228705 21:39480220-39480242 ATTGAATTGTACACTTTAAATGG - Intronic
1179492320 21:41748882-41748904 ACTGAATTATACACTTTAAATGG + Intronic
1179533689 21:42037840-42037862 AGTGAATTGTACACTTTAAATGG + Intergenic
1179676097 21:42983167-42983189 ACTGAACTGCACACTGAAAATGG - Intronic
1180204818 21:46252780-46252802 ACTGAAATGTACACTTTAAATGG + Intronic
1180221649 21:46362932-46362954 ACTGCAAGGCACACTGTAAAGGG - Intronic
1180267664 22:10549002-10549024 ACTGAACTGTACACTTAAAATGG + Intergenic
1180535995 22:16393181-16393203 ACTGAATTGTGCACTTTAAAGGG + Intergenic
1180924859 22:19546514-19546536 ACTGAACTGCATACTGAAAATGG + Intergenic
1180924944 22:19547176-19547198 ACTGAACTGCATACTGAAAATGG - Intergenic
1180964575 22:19780152-19780174 ACTGAAATGTACACTTACAAAGG - Intronic
1181100878 22:20538033-20538055 ACTGAAATGTAAACTTTAAAGGG - Intronic
1181296123 22:21840773-21840795 GCTGAATTGTACACTTTAAACGG + Intronic
1181663904 22:24376880-24376902 ACTGAAATGTACATTTTAAGTGG - Intronic
1181923191 22:26336642-26336664 ATATAAATGCACATTGTAAACGG - Intronic
1182005736 22:26957980-26958002 ACTGCATTGCAGACTGTAAATGG - Intergenic
1182277157 22:29197174-29197196 ACTGAATTGTACACATTAAAGGG - Intergenic
1182340456 22:29616279-29616301 ACTGAATTATACACTTTAAATGG + Intronic
1182387891 22:29962285-29962307 ACTGAACTGTACACTTTAAATGG - Intronic
1182388379 22:29967581-29967603 ACTGAATTGTATACTTTAAAAGG - Intronic
1182627595 22:31659399-31659421 ACTGCAAACCACACTGTCAACGG - Intronic
1182631494 22:31689495-31689517 ACTGAATTGTACATTTTAAATGG - Intronic
1182881283 22:33735678-33735700 ACTGAAATGTACACATTAAAAGG - Intronic
1183670967 22:39272526-39272548 ACTGAATTCTACACTTTAAATGG - Intergenic
1183766887 22:39885919-39885941 ACTGAATTGCACACTTACAAAGG + Intronic
1184107237 22:42375136-42375158 ATTGAATTGTACACTTTAAAAGG - Intergenic
1184267009 22:43353541-43353563 ACTGAACTGTACACTTAAAATGG - Intergenic
1184392124 22:44209625-44209647 ACTGAATTGTACACTTAAAATGG - Intronic
1184522597 22:45004196-45004218 ACTGAATGGTACACTTTAAATGG + Intronic
1184814104 22:46857526-46857548 ACTGAATTGTACACTTTAAATGG - Intronic
1185323349 22:50212997-50213019 AAAGACATGCACAGTGTAAATGG - Intronic
1203331541 22_KI270738v1_random:97042-97064 AGTTGAATGCACACAGTAAAAGG + Intergenic
949232813 3:1771625-1771647 ACAGATATGCCCACTATAAATGG - Intergenic
949413552 3:3793000-3793022 ACTGAACTGTACACTTAAAATGG - Intronic
949992981 3:9594547-9594569 ACTGAAATGTACACTTTAAATGG + Intergenic
950055496 3:10020930-10020952 ACTGAATTGTACACTTAAAATGG + Intergenic
950208573 3:11099374-11099396 ATTGAACTGTACACTTTAAAAGG - Intergenic
950278747 3:11686617-11686639 ACTGAACTGTACACTTAAAATGG + Intronic
950290138 3:11777488-11777510 GCTGAACTGTACACTTTAAATGG - Intergenic
950322106 3:12066087-12066109 ACTGAATTGCACACTTTAAAAGG + Intronic
950338339 3:12218747-12218769 ACTGAATTGCACACATAAAATGG + Intergenic
950469723 3:13177162-13177184 ACTGGATTACACACTTTAAAAGG + Intergenic
950597898 3:14001365-14001387 ACTGAAATGTACACTTTAAGGGG - Intronic
950635901 3:14314366-14314388 ATTGAACTGTACACTTTAAAGGG - Intergenic
950653237 3:14420836-14420858 ACTGAATTGTACACTTTCAAGGG - Intronic
950706740 3:14787433-14787455 ACTGAATTGTACACTTTAAATGG + Intergenic
951417502 3:22442901-22442923 AGTGTAATGCACCCAGTAAACGG - Intergenic
951481039 3:23162819-23162841 ACTGAATTATACACTGTAAATGG + Intergenic
951654241 3:24987461-24987483 TCTTAAATACACACTGCAAAGGG + Intergenic
952015877 3:28957107-28957129 ACTCAATTGTACACTTTAAAAGG - Intergenic
952320546 3:32273802-32273824 ACTGAATTCTACACTTTAAACGG + Intronic
952450352 3:33426465-33426487 ACTGAATTTCAGACTTTAAAAGG - Intronic
952486753 3:33819883-33819905 ACTGAAGTGTACACTTAAAATGG - Intronic
952779356 3:37080035-37080057 ACTGAATTGTACACTTTAAATGG + Intronic
952910376 3:38179512-38179534 GCTGAATTGTACACTTTAAAAGG - Intronic
953014481 3:39060113-39060135 ACTGAATTGTACACTTTGAAAGG - Intronic
953062223 3:39436588-39436610 ACTGAGTTGTACACTTTAAATGG - Intergenic
953110242 3:39929630-39929652 ACTGAATTTTACACTTTAAAAGG - Intronic
953245141 3:41184248-41184270 ACTGAATTGTACACTTTAAATGG - Intergenic
953278088 3:41524219-41524241 ACTGAATTATACACTCTAAATGG + Intronic
953419378 3:42742618-42742640 CCTGAAATTCTCATTGTAAAAGG - Intronic
953479869 3:43242008-43242030 ACTGAATTACACACTTTAAAAGG + Intergenic
953507762 3:43503045-43503067 ACTGAATTGTACACTTAAAATGG + Intronic
953633014 3:44635942-44635964 ACTGAACTGTACACTTTAAATGG - Intronic
953973531 3:47365365-47365387 TCTGAATTGTACACTTTAAAAGG - Intergenic
953988219 3:47462144-47462166 ACTGAACTGTACACTTAAAAGGG - Intronic
954175254 3:48839897-48839919 ACTGAATTGTACACTTAAAATGG - Intronic
954188586 3:48939834-48939856 ACTGAATTGTATACTTTAAATGG - Intronic
954359338 3:50111232-50111254 ACTGATTTGTACACTCTAAAAGG - Intronic
954649602 3:52153131-52153153 ACTGAAATGTACACTTTAAAAGG + Intronic
954986323 3:54796728-54796750 ACGGAAGTGAACACAGTAAATGG - Intronic
955460568 3:59178270-59178292 ACTGAACTGTACACTTGAAATGG - Intergenic
955533930 3:59903395-59903417 ACTGAATTGTACATTTTAAATGG + Intronic
955682930 3:61520865-61520887 ACTGAAATGCATGCTGAATATGG - Intergenic
955880289 3:63537087-63537109 ACTGAAACGTGCACTTTAAAAGG + Intronic
955885905 3:63598008-63598030 ACTCTCATCCACACTGTAAATGG - Intronic
955907711 3:63825063-63825085 ACAGAACTGCACAATATAAAGGG - Intronic
956151285 3:66245843-66245865 ACTGAATTGTACACTTTAAAGGG - Intronic
956182758 3:66532853-66532875 ACTGAGCTGTACACTTTAAAAGG + Intergenic
956261458 3:67347700-67347722 ATTGAATTGCACACTTTAAACGG + Intergenic
956520898 3:70103008-70103030 ACTCAAATGCACAGTGAAATGGG + Intergenic
956733636 3:72218912-72218934 ACTAAATGGCACACTTTAAATGG - Intergenic
956926848 3:73998613-73998635 ACTGAATTGTACACTTTAAATGG + Intergenic
956997082 3:74839225-74839247 CCTTAAATACACACTGTAATTGG + Intergenic
957828530 3:85484390-85484412 ACTGAAGTACATACTGTTAAAGG - Intronic
959204342 3:103285335-103285357 ACTAAATTGTACACTTTAAAAGG - Intergenic
959976649 3:112468201-112468223 ACTGAATTGTACACTTAAAAGGG - Intronic
960742193 3:120846532-120846554 ACTGAATTGTATACTTTAAATGG - Intergenic
961303247 3:125935801-125935823 ACTAAAATGTACAATGAAAATGG - Intronic
961481846 3:127185770-127185792 ACTGAATTGCACACTTTAAAAGG - Intergenic
961764885 3:129201922-129201944 ACTGAATTGTACATTTTAAAAGG - Intergenic
962143016 3:132810417-132810439 ACTGAACTGTACACTTAAAATGG - Intergenic
962426520 3:135273393-135273415 AGTGAAGTGCACAGTGAAAAAGG - Intergenic
962507030 3:136057563-136057585 ACTGAACTGTACACTTAAAATGG + Intronic
962571625 3:136719463-136719485 ACTGAATTGTACACTTAAAATGG + Intronic
962671482 3:137713319-137713341 ACTGAAATGTACACTTTACAGGG - Intergenic
962992176 3:140588005-140588027 TCTCAAATGCACATGGTAAATGG + Intergenic
963699578 3:148607635-148607657 ACTGAACTATACACTTTAAAAGG - Intergenic
963881306 3:150532125-150532147 ACTGAAATGTACACTTTAAAAGG + Intergenic
964081006 3:152756759-152756781 ACTGAATTTCATACTTTAAATGG + Intergenic
964417741 3:156466002-156466024 AATGAAATGTACACTTTAAATGG - Intronic
964797633 3:160516999-160517021 ACTGAATTGTACACTTTGAAAGG - Intronic
964800688 3:160554240-160554262 ACTGAATTGTATACTTTAAATGG - Intronic
965033138 3:163399937-163399959 ACTGAACTGTACACTTAAAATGG + Intergenic
965448612 3:168808027-168808049 TCTGAAAGGCACACTGTCAAAGG + Intergenic
965611733 3:170550917-170550939 ACTGAAATATATACTTTAAAAGG - Intronic
965801942 3:172503684-172503706 ACTGAATTGTACACTCAAAAAGG + Intergenic
966275474 3:178160676-178160698 ACTGAAATGCAAAAAGAAAAAGG + Intergenic
966302013 3:178489733-178489755 AATGAAATCCACACTCTAACTGG + Intronic
966524965 3:180910757-180910779 ACTGAATTGTACATTATAAATGG + Intronic
966625609 3:182013169-182013191 ACTAAACTGTACACTTTAAAAGG - Intergenic
966707497 3:182932430-182932452 ATTGAATTGTACACTATAAAGGG + Intergenic
966956955 3:184891558-184891580 ACTGAATTGTATACTTTAAAAGG - Intronic
967048521 3:185760418-185760440 ATTGAACTGTACACTTTAAATGG - Intronic
967150718 3:186646878-186646900 ACTGAACTGTACACCTTAAATGG - Intronic
967167282 3:186793038-186793060 ACTGAATTGTACATTTTAAATGG - Intronic
967523212 3:190460229-190460251 ATTGAATTGTACACTTTAAATGG - Intergenic
967695959 3:192530768-192530790 ACTGAACTGTACACATTAAAAGG + Intronic
968526980 4:1064672-1064694 AGTGAACTGTACACTGAAAATGG - Intronic
968692865 4:2004431-2004453 ACTGAAGTGTACATTTTAAATGG + Intronic
969030862 4:4212496-4212518 ACTGAATTGCACACGTTAAATGG + Intronic
969352731 4:6606964-6606986 ACTGAATTGCCCACTTTAAATGG - Intronic
969519742 4:7669109-7669131 TGTAAAATGCACACTGTCAAGGG - Intronic
969551467 4:7870891-7870913 AATGAACTGTACACTTTAAATGG + Intronic
969683865 4:8658045-8658067 ACAGAATTACACACTTTAAATGG - Intergenic
970167076 4:13250106-13250128 ACTGCAATGCAGAGAGTAAATGG + Intergenic
970180663 4:13389408-13389430 ACTGAACTGTACACTTGAAATGG + Intronic
970320015 4:14866117-14866139 ACTGAACTGTACACTTTAAAGGG + Intergenic
970888562 4:21015243-21015265 ACTGAACTGAACACTTAAAATGG + Intronic
971188601 4:24405185-24405207 ACTGAAAAGCACTTTGAAAACGG + Intergenic
971568024 4:28169955-28169977 ACAGAAACGTACACAGTAAATGG - Intergenic
971732444 4:30402851-30402873 ACATAAATGCAGACTGTACATGG + Intergenic
971805062 4:31347014-31347036 ACTGAACTGTACACTTTAAAAGG + Intergenic
973227195 4:47800205-47800227 ACTGAATTGTAGACTTTAAATGG + Intronic
973259532 4:48148208-48148230 ACTGAATTGTATACTTTAAATGG + Intronic
973647708 4:52966874-52966896 ACTGAACTGTACACTTAAAATGG - Intronic
973710586 4:53626361-53626383 AATGAATTGTACACTTTAAAAGG + Intronic
973916702 4:55641117-55641139 ATTGAATTGTACACTGTAAAAGG + Intergenic
974008337 4:56583428-56583450 ACTGAATTGTATACTTTAAAAGG + Intronic
975588520 4:75976681-75976703 ACTGAATTGTACACTTTAAGTGG + Intronic
975785404 4:77882355-77882377 AATGAACTGTACACTTTAAATGG - Intronic
975921574 4:79396942-79396964 ACTGAATTGTACACTTAAAATGG - Intergenic
975953538 4:79806163-79806185 ACTGAATTATACACTGTAAAAGG + Intergenic
976040435 4:80877702-80877724 ACTCAACTGTACACTTTAAACGG - Intronic
976253480 4:83077179-83077201 ACTGAAATGCAAAGAGAAAAAGG + Intergenic
976797688 4:88953066-88953088 ATTGAATTGTACACTCTAAATGG - Intronic
976953261 4:90860974-90860996 ACTGAAGTGTACACTTTGAAAGG + Intronic
977277073 4:94991013-94991035 ACTGAAATGCACAATTTAAAAGG - Intronic
977470081 4:97432094-97432116 ACTGAAGTGTACACTTAAAATGG + Intronic
977577183 4:98687553-98687575 ACTAAATTGCATACTTTAAATGG - Intergenic
977740463 4:100474951-100474973 TCTGAATTGTACACTTTAAAAGG + Intronic
977846605 4:101774193-101774215 ACTGAATTGCACACCTGAAAGGG - Intronic
978135138 4:105248680-105248702 ACTGAATTGTATACTTTAAAAGG - Intronic
978171412 4:105675349-105675371 ACTGCCATGCGCTCTGTAAAAGG + Intronic
978175596 4:105728252-105728274 ACTGAATTGGATACTTTAAAAGG + Intronic
978606925 4:110490814-110490836 ACTGAATTACACACTGTATCAGG - Intronic
978747578 4:112211066-112211088 ACTGAATTGTACACTTTAAAGGG + Intergenic
978766169 4:112407258-112407280 GCCGAAATGCATACTGAAAAAGG + Intronic
978860157 4:113439359-113439381 ATGGAAATGCGCACTTTAAATGG + Intergenic
979245646 4:118501010-118501032 ACTGAATTGTATACTTTAAATGG - Intergenic
979586442 4:122423959-122423981 GCTGAATTGTACACTTTAAAGGG + Intronic
979646687 4:123077813-123077835 ACTGAATTGTACACTTAAAATGG - Intronic
980069922 4:128233308-128233330 ACTGAATTGTACACTTAAAATGG + Intergenic
980954248 4:139412212-139412234 ACTGAACTGTACACTTAAAATGG - Intronic
981503944 4:145480354-145480376 ATTAAATTGCACACTTTAAATGG - Intergenic
981751333 4:148095125-148095147 ACTGAATTGTACACTTAAAATGG + Intronic
982753092 4:159185765-159185787 ACTGAATTGTTCACTTTAAAGGG + Intronic
982812416 4:159842829-159842851 ACTGAATTCTACACTTTAAATGG - Intergenic
982943728 4:161591424-161591446 ACTGAATTGCACACTTCGAATGG + Intronic
983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG + Intergenic
983478579 4:168245055-168245077 ACTGAACTGTACACTTAAAATGG + Intronic
983549285 4:168998646-168998668 ACTGAATTGTAAACTTTAAATGG + Intronic
983580661 4:169306529-169306551 ACTGAACTGTACACTTTAGAAGG + Intergenic
983669888 4:170224223-170224245 ATTGAACTGTACACTTTAAATGG - Intergenic
983706717 4:170669704-170669726 ACTGAAATGCAAACAGAAAAAGG - Intergenic
983758475 4:171373560-171373582 ACTGAATTGTACACTTTAAGTGG - Intergenic
983931440 4:173457288-173457310 ACAGAAAGGCACACAATAAATGG + Intergenic
984646040 4:182220741-182220763 ACATAAATGTACACTGTACATGG - Intronic
984754802 4:183315042-183315064 ACAGAACTTCACACTGTACATGG - Intronic
984937926 4:184905670-184905692 ACTGAAATGTACACTTGAAATGG - Intergenic
984991074 4:185381902-185381924 TCTGAATTGTACACTTTAAAAGG - Intronic
985243821 4:187959227-187959249 ACAGAAATGTACACTTAAAAAGG - Intergenic
985374327 4:189317972-189317994 ATTGAATTGTACACTATAAATGG + Intergenic
985889005 5:2701202-2701224 CCTCAAATGCACATTGTGAAAGG - Intergenic
987156559 5:15095467-15095489 ACTGAACTGTATACTTTAAAAGG - Intergenic
987321400 5:16773025-16773047 ACTGAAATGTATACTTTAAATGG + Intronic
987715636 5:21566130-21566152 ACTGAATTGCTCACTTTAAATGG - Intergenic
987736506 5:21850995-21851017 ACTGAATTGTACACTTAAAATGG + Intronic
987737619 5:21866907-21866929 CCTAAACTGCACACAGTAAAGGG - Intronic
988570911 5:32364870-32364892 ACTGAATTGTACAGTTTAAAAGG - Intronic
988590355 5:32543554-32543576 ACTGAATTGGACACTTCAAAAGG + Intronic
988625603 5:32871380-32871402 ACTGAAATCCAGACTGCAAGTGG + Intergenic
988850552 5:35176365-35176387 ACAGAACTGTACACTGTAAAAGG - Intronic
988897308 5:35691712-35691734 ACTGAAATGTATCCTTTAAATGG + Intronic
989010340 5:36864467-36864489 ACTGAATTGTACACTTTAAATGG - Intergenic
989051421 5:37323885-37323907 ACTAAACTGCACACTTTAAAAGG + Intronic
989080706 5:37617377-37617399 ATTGAATTGCACACTTAAAATGG + Intronic
989480883 5:41928677-41928699 ACTGAAATTCAGACTGTAAGTGG + Intronic
990734554 5:58845731-58845753 ACTGAATTGTACACTTCAAATGG - Intronic
990853385 5:60233994-60234016 ACTGAATTGTACACTTCAAATGG - Intronic
990952318 5:61310648-61310670 ACTAAACGGCACACTTTAAATGG + Intergenic
991055944 5:62320799-62320821 ACTGAATTGTGCACTTTAAAGGG - Intronic
991105302 5:62836169-62836191 ACTGAAGTGTACATTTTAAATGG + Intergenic
991200579 5:63986977-63986999 AAGGAAAGGCACACTGGAAAAGG + Intergenic
991714098 5:69435363-69435385 ACTGAATTGTACACTTTAAAAGG - Intronic
991729073 5:69565287-69565309 ACTGAATTGTACATTGGAAATGG - Intronic
991805504 5:70420436-70420458 ACTGAATTGTACATTGGAAATGG - Intergenic
991865881 5:71062587-71062609 ACTGAATTGTACATTGGAAATGG + Intronic
991941378 5:71855733-71855755 ACTGAATTGTACACTTTAAATGG - Intergenic
992167765 5:74071758-74071780 ACTGAATTGTACACTTTAAGTGG - Intergenic
992606601 5:78463810-78463832 ATTGAATTGTACACTTTAAAGGG + Intronic
992727544 5:79624456-79624478 ACTGAACTCTACACTTTAAAAGG - Intronic
992829148 5:80577560-80577582 CCTGAATTGAACACTTTAAATGG + Intergenic
992836465 5:80646460-80646482 ACTGAACTATACACTTTAAAAGG - Intronic
993699050 5:91096742-91096764 ACTGAAGTGTACACTTAAAATGG - Intronic
994067701 5:95561849-95561871 ATTGAATTGTACACTTTAAATGG + Intronic
995118282 5:108506590-108506612 AATGAAATGCAAGCTTTAAAGGG - Intergenic
995461579 5:112409446-112409468 ACTGAATTGGACAATTTAAATGG + Intronic
995570817 5:113479421-113479443 ATTGAAATATACACTTTAAATGG + Intronic
995773884 5:115703752-115703774 ACTGAATTGTACACTTTAAGTGG + Intergenic
995799462 5:115978438-115978460 ACTAAATTTCCCACTGTAAAAGG - Intronic
995933671 5:117483041-117483063 ACTCTAGGGCACACTGTAAATGG + Intergenic
996067238 5:119092528-119092550 ACTAAAATTTACACTTTAAAAGG - Intronic
996571985 5:124941574-124941596 ATTGAGTTGCACACTTTAAATGG + Intergenic
996676977 5:126187469-126187491 ACTGAATTATACACTTTAAAAGG + Intergenic
996838216 5:127817730-127817752 GCTGAATTGTACACTTTAAAAGG + Intergenic
997100737 5:130966159-130966181 AGTGAAAAGCAAACTGTAGAGGG + Intergenic
997308621 5:132860386-132860408 ACTGAATTGTACACTTTAAATGG + Intergenic
997573297 5:134951005-134951027 AATGAAGTTCCCACTGTAAAGGG - Intronic
997925685 5:138029106-138029128 ACTGGAAAGTACACTGGAAATGG - Intronic
997978852 5:138456648-138456670 ACTGAATTGTACACTTAAAATGG + Intergenic
998171742 5:139876442-139876464 ACTGAATTGTATACTTTAAAAGG + Intronic
998178463 5:139917190-139917212 ATTGAATTGTACACTTTAAATGG - Intronic
998189763 5:140013489-140013511 ACTGAACTGCACACTTAAAATGG + Intronic
998773849 5:145576147-145576169 ATTGACTTGCACACTTTAAATGG - Intronic
998854720 5:146383435-146383457 ACTGAATTGTACACTTTTAATGG + Intergenic
999067839 5:148710395-148710417 ATTGAATTGTACACTTTAAATGG + Intergenic
999175664 5:149630147-149630169 TCTGAATTGTACACTTTAAAAGG + Intronic
999630445 5:153565474-153565496 ACTGAACTGAACACTTTAAATGG - Intronic
999706586 5:154278210-154278232 ACTGGATTGCACACTGCCAAGGG + Intronic
999925995 5:156378448-156378470 ATTGAACTACACACTTTAAAAGG + Intronic
999955512 5:156697205-156697227 ACTGAATTGCACACTTTACATGG + Intronic
1000017619 5:157291932-157291954 ACTGAATTGTACACTTCAAATGG - Intronic
1000035952 5:157448022-157448044 ACTGAATTGTACACTTTAAAAGG - Intronic
1000228175 5:159290075-159290097 ATTGAACTGCACACTTCAAATGG - Intergenic
1000248180 5:159467803-159467825 AATGAAACCCACACTGGAAAAGG - Intergenic
1000272271 5:159697301-159697323 ACCAAAATGCACACTTTAAGAGG + Intergenic
1000608738 5:163352339-163352361 ACAGAATTGTACACTGTAAATGG + Intergenic
1000617988 5:163451239-163451261 ACTGAATTACACACCTTAAATGG + Exonic
1000657913 5:163904182-163904204 ATTGTAATTCACATTGTAAATGG + Intergenic
1001538662 5:172521078-172521100 ACTGAATTGTACACTTTAAGTGG + Intergenic
1001595635 5:172896967-172896989 ACAGAAATGCAAACTGTTAAGGG - Intronic
1001640377 5:173239539-173239561 ACTGAACTGTATACTTTAAATGG - Intergenic
1001783583 5:174391926-174391948 ACTGAATTGTACATTTTAAAAGG - Intergenic
1002052359 5:176578300-176578322 TCTGAAATTCACACTGAAATGGG + Intronic
1002089046 5:176793692-176793714 AGAGAAATGCAAACTGTAAAGGG + Intergenic
1002546920 5:179954672-179954694 ACTGAAATACACACTTTAAACGG + Intronic
1002590075 5:180284735-180284757 TCTAAAATGCACACTGTGGATGG + Intronic
1002850985 6:996144-996166 ACTGAAGTCTACACTTTAAATGG + Intergenic
1003077688 6:2997747-2997769 ACTGAATTGTACACTTAAAATGG + Intronic
1003086015 6:3062459-3062481 ACTGAATTGCATGCTTTAAAAGG + Intergenic
1003168130 6:3699275-3699297 ACTAAAATCCTTACTGTAAATGG - Intergenic
1003321120 6:5052695-5052717 ACTGAACTGTACACTGAAAATGG + Intergenic
1003371727 6:5534308-5534330 ACTGAATTGTACACTTAAAATGG - Intronic
1003468844 6:6409558-6409580 TCTGAAATGCCCAGTGCAAAGGG - Intergenic
1003562293 6:7191270-7191292 ACTGAAGTGCACACTTTACACGG - Intronic
1003593041 6:7451777-7451799 ACTGAACTGTACACTTTAAAAGG + Intergenic
1004321124 6:14632517-14632539 ACTGAAATGTACATTTTAAATGG + Intergenic
1004640462 6:17510275-17510297 ATGGAATTGCACACTGGAAATGG + Intronic
1004737114 6:18418685-18418707 ACTGAATTGTACACTTTAGATGG + Intronic
1004912959 6:20304430-20304452 ACTGAATTGTACACTTTAACAGG + Intergenic
1004958116 6:20753044-20753066 AATGAATTGTACACTTTAAATGG - Intronic
1005016477 6:21379599-21379621 ACTGAAATGTACACTTAAAGTGG + Intergenic
1006058326 6:31402034-31402056 ACTGAGCTGCACACTTTAAAAGG - Intronic
1006243693 6:32709940-32709962 ACTGAACTGTACACTTAAAAAGG - Intergenic
1006256204 6:32834607-32834629 ACTGAACTGTACACTTCAAATGG + Intronic
1006662674 6:35661287-35661309 CCTGAATTGTACACTTTAAAGGG + Intronic
1006866663 6:37214142-37214164 ACTGAATTGCACATTCAAAAAGG - Intronic
1007048304 6:38799636-38799658 ATTGAGATGTACACTTTAAATGG - Intronic
1007175075 6:39890694-39890716 ACTGAACTGCACATTTAAAATGG + Intronic
1007315473 6:40984917-40984939 ATTGAATTATACACTGTAAATGG + Intergenic
1007643303 6:43361041-43361063 ACTGAACTGTACACTTCAAATGG + Intronic
1007650458 6:43417165-43417187 ACTGAATTTTACACTTTAAAGGG + Intergenic
1007878101 6:45130050-45130072 ACTAAACTGTACACTTTAAATGG - Intronic
1008117786 6:47572355-47572377 ACTGAAATGCATATTTAAAACGG + Intronic
1008522890 6:52379399-52379421 ACTGAACTGTACACTTAAAATGG + Intronic
1008934828 6:56979367-56979389 ATTGAATTGTACACTTTAAATGG + Intronic
1009388405 6:63114966-63114988 ACTAAAAAGCACAGTGTAAATGG - Intergenic
1009432708 6:63584175-63584197 ACTGAAATGCCCAACATAAAGGG + Intergenic
1009433868 6:63595855-63595877 ATTGAGTTGTACACTGTAAATGG + Intergenic
1009560929 6:65242167-65242189 ACTGAATTGCAAACTTTAAATGG - Intronic
1009878130 6:69531764-69531786 ACTGAATTGTACACTTAAAATGG - Intergenic
1010254679 6:73744655-73744677 ATTAAAATGCACACTGCCAAAGG - Intronic
1010666766 6:78640018-78640040 ACTTAAATGAACACTCTAATGGG + Intergenic
1011169611 6:84490883-84490905 ACTGAATTGTATACTTTAAAAGG + Intergenic
1011497467 6:87950596-87950618 CCTGAAATGAACACAGTGAAGGG - Intergenic
1011600331 6:89053913-89053935 ACTGAATTGTAAACTTTAAAAGG - Intergenic
1011714066 6:90085856-90085878 ACCGAAATGCACACTTAAAATGG - Intronic
1011882784 6:92051680-92051702 ATAGAAATGCAGACTATAAAAGG + Intergenic
1013320293 6:108981360-108981382 ACTGAACTGTACACTTAAAATGG - Intergenic
1013485471 6:110592197-110592219 AATGAAATACACATTGTAGACGG + Intergenic
1013487576 6:110612003-110612025 ACTGAAATATAAACTGTAAGGGG - Exonic
1013526704 6:110981220-110981242 ACTGAATTGTACACTGTAAAGGG + Intergenic
1013604595 6:111736069-111736091 ACAGGAATGCCCACTGAAAAGGG + Intronic
1014158980 6:118144991-118145013 ATTGAATTGTACACTTTAAATGG - Intronic
1014244656 6:119054919-119054941 ACTGAATTGTACACTTTAAAGGG - Intronic
1014504938 6:122243186-122243208 CCTGAAAGGCACACTGAAGAAGG + Intergenic
1014601395 6:123417649-123417671 ATTTAAATGCACAATGTCAAAGG + Intronic
1015335392 6:132031522-132031544 ACTGAACTGTACACTTAAAATGG - Intergenic
1015455400 6:133421517-133421539 ACGGAAATGCACAATGTCTAAGG - Intronic
1015642069 6:135345769-135345791 ACTGAATGGTACACTTTAAAAGG + Intronic
1015762521 6:136680299-136680321 ACTGAACTGTACACTTAAAATGG + Intronic
1015904021 6:138097775-138097797 ACTGAATTATACACTTTAAAAGG - Intronic
1015976226 6:138794097-138794119 ACTGAATTGTACACTTTAAAGGG - Intergenic
1016156391 6:140814449-140814471 ATTGAATTGCACACATTAAATGG + Intergenic
1016224036 6:141711604-141711626 ACTAAATTGTACACTGTAAAAGG + Intergenic
1016271762 6:142298241-142298263 ACTCACATGCACACAGGAAAGGG + Intergenic
1016493626 6:144634598-144634620 ACTGAAATGCACAATTTCAATGG - Intronic
1016501323 6:144724145-144724167 CCTGAATTGCACACTTTAAATGG - Intronic
1016515490 6:144888723-144888745 AGGGAAATGAAAACTGTAAATGG + Intergenic
1016588443 6:145716256-145716278 ACTGAACTGTGCACTTTAAATGG + Intronic
1016602276 6:145876035-145876057 ACTGACTTGTACACTTTAAATGG - Intronic
1016606076 6:145928653-145928675 ACTGAACTACACACTTAAAAAGG - Intronic
1016662374 6:146596475-146596497 ACTGAAATGCAGACAGGAAATGG - Intergenic
1016827714 6:148403896-148403918 ACTGAATTGTACACTTAAAAGGG - Intronic
1016867230 6:148779221-148779243 TCTGAAATCCACACTTGAAAAGG - Intronic
1016882198 6:148922120-148922142 ACTGAATTGTACACTTTAAAAGG - Intronic
1017083246 6:150688813-150688835 ATTGAATTGTACACTTTAAATGG - Intronic
1017083251 6:150688910-150688932 ACTGAATTGCACATTTAAAATGG - Intronic
1017149476 6:151265276-151265298 ACTGACCTGTACACTTTAAAGGG - Intronic
1017383274 6:153855354-153855376 ACTGAAATGCATGCTTCAAATGG + Intergenic
1017520808 6:155200491-155200513 ACTGAATGGTACACTGTAAAAGG - Intronic
1017554895 6:155552749-155552771 ACTGAAGTGCCCACTGTCAATGG - Intergenic
1017722573 6:157254061-157254083 ACTGAATTGCACACTTTAAATGG - Intergenic
1017745206 6:157440927-157440949 ACTGAATTGCATACTTTAAATGG + Intronic
1017757913 6:157545313-157545335 ACTGAATTGCACACTTTCTATGG + Intronic
1018591410 6:165427606-165427628 ACTGAATCGCACACTTTAAATGG + Intronic
1018715277 6:166527591-166527613 ATTGAATTGTACACTTTAAATGG - Intronic
1019836657 7:3392487-3392509 ACTGAACTGCACTTTTTAAATGG - Intronic
1019932408 7:4233007-4233029 ACTGAACTGGACACTTGAAATGG - Intronic
1019980286 7:4616499-4616521 ACTGAATTGTACACTTTAAAAGG + Intergenic
1020041269 7:5003911-5003933 ACTGAATTGCATACTTTAAAAGG - Intronic
1020400896 7:7776085-7776107 ATAGAACTGCACACTGAAAAGGG + Intronic
1020876813 7:13706335-13706357 ATTAGAATGCACACTGTAGATGG + Intergenic
1020917823 7:14218776-14218798 ACTGAATTTCACACTTTAAATGG - Intronic
1021020523 7:15592694-15592716 ACTGAATTGTTCACTTTAAAAGG + Intergenic
1021044188 7:15902521-15902543 ACTGAAATGTCTACAGTAAAGGG - Intergenic
1021539382 7:21740255-21740277 ACTGAACTGTACACTTGAAATGG - Intronic
1021677211 7:23093039-23093061 ACTGAATTGTATATTGTAAAGGG - Intergenic
1021707717 7:23384410-23384432 ACTGATTTGTACACTTTAAATGG + Intronic
1021770324 7:23994143-23994165 ACTGAACTGCACACTTAAAATGG + Intergenic
1021984119 7:26082375-26082397 AATGAAATGATCACTGTAAGAGG - Intergenic
1022392341 7:29954371-29954393 ACTGAACTGTACAGTTTAAATGG - Intronic
1023010119 7:35918519-35918541 GCTGAGAGGCACACTGGAAAAGG - Intergenic
1023037039 7:36140705-36140727 ACCGAATTACACACTTTAAATGG + Intergenic
1023083958 7:36551389-36551411 ACTGAATTGTACACTCAAAAGGG - Intronic
1023449507 7:40268132-40268154 ACTGAATTGTATGCTGTAAATGG - Intronic
1023465192 7:40446986-40447008 ACTGAATTGTGCACTATAAATGG - Intronic
1023508520 7:40925243-40925265 GCTAAAATTCACACTGAAAATGG + Intergenic
1024067226 7:45750093-45750115 TCTGAAATGCATATTGAAAAAGG + Intergenic
1024080706 7:45853060-45853082 GCTGAGAGGCACACTGGAAAAGG + Intergenic
1024090512 7:45936001-45936023 ACTGAATTGTACACTATAAAAGG - Intergenic
1024631524 7:51252233-51252255 ATTGAATTGTACAATGTAAATGG - Intronic
1024807150 7:53155940-53155962 ACTGAACTGTACACTTAAAATGG + Intergenic
1024897487 7:54277544-54277566 ATTGAATTGTACACTTTAAATGG - Intergenic
1025319539 7:58080250-58080272 ACTGAACTGTACACTTAAAATGG - Intergenic
1025473650 7:60891860-60891882 ACTGAACTGTACACTTAAAATGG + Intergenic
1025477953 7:60950720-60950742 ACTGAACTGTACACTTAAAATGG - Intergenic
1025483386 7:61014979-61015001 ACTGAACTGTACACTTAAAATGG + Intergenic
1025489116 7:61089811-61089833 ACTGAACTGTACACTTAAAATGG - Intergenic
1025513355 7:61598006-61598028 ACTGAACTGTACACTTAAAATGG - Intergenic
1025537704 7:62026845-62026867 ACTGAACTGTACACTTAAAATGG - Intergenic
1025554174 7:62283221-62283243 ACTGAACTGTACACTTAAAATGG + Intergenic
1025560607 7:62370053-62370075 ACTGAACTGTACACTTAAAATGG - Intergenic
1025624805 7:63211457-63211479 ACTGAATTACACACTGTATTAGG - Intergenic
1025802238 7:64797144-64797166 ACTGAAATGTACCCTGAAAAAGG - Intronic
1026023269 7:66727076-66727098 ACTGAATGGTACACTTTAAATGG + Intronic
1026210671 7:68301370-68301392 ATTGAATTGTACACTTTAAATGG - Intergenic
1026357095 7:69567619-69567641 ATTGAATTGTACACTTTAAATGG + Intergenic
1026375774 7:69749284-69749306 ACTGAAGTGTACACTTTAAATGG - Intronic
1026888059 7:73966276-73966298 ACTCAATTGTACACTTTAAATGG + Intergenic
1027193876 7:76014844-76014866 TTTGAATTGCACACTTTAAATGG - Intronic
1027242576 7:76341843-76341865 ATTAAATTGCACACTTTAAATGG + Intronic
1027491614 7:78834226-78834248 ACTGACCTGTACACTTTAAAAGG - Intronic
1027870637 7:83702464-83702486 ATTGAATTGTACACTGTAAGTGG - Intergenic
1028195304 7:87899985-87900007 ACTGAATTGTACACTTAAAATGG + Intronic
1028583624 7:92432030-92432052 AGTGAATTGTACACTGAAAAGGG + Intergenic
1028584828 7:92442547-92442569 ACTGAAAGGCACTGTGCAAAAGG - Intergenic
1028632920 7:92955603-92955625 CCTGAACTGTACACTTTAAATGG - Intergenic
1029164625 7:98578629-98578651 ACTGACCTGTACACTTTAAACGG - Intergenic
1029181191 7:98703137-98703159 ACTGAATTGTACACTTAAAATGG - Intergenic
1029230466 7:99063620-99063642 ACTGTATTGCACACTTTAAATGG - Intronic
1029234478 7:99102407-99102429 ACTGATATTTACACTTTAAAGGG + Intronic
1029858732 7:103546023-103546045 ACTGATGTGTACACTTTAAATGG - Intronic
1030063992 7:105645213-105645235 ACTGAAATGTACATTAAAAACGG + Intronic
1030082556 7:105790268-105790290 ACTGAACTGTACACTTTAAATGG + Intronic
1030102349 7:105957598-105957620 ACTGAATTGTACACTTTAACTGG + Intronic
1030324079 7:108201525-108201547 ACTGAACTGTACACTTAAAATGG + Intronic
1030693192 7:112556017-112556039 AATGAATTGTACACTTTAAATGG + Intergenic
1030770311 7:113466585-113466607 AGTGAAATGCGCACAGGAAAAGG - Intergenic
1030847743 7:114442433-114442455 ACTGAATTGTACATTGAAAATGG + Intronic
1030873318 7:114783856-114783878 ACTGAACTGTACACTTGAAAAGG + Intergenic
1031119020 7:117699420-117699442 ACTGAACTGTATACTTTAAATGG - Intronic
1031542739 7:123014963-123014985 ACTGAACTGTACACTTTAAATGG - Intergenic
1032204957 7:129855125-129855147 ACTGAATTACACACTTTAAATGG + Intronic
1032573498 7:133027300-133027322 ACTGAACTGCACACTCTGAATGG + Intronic
1032579053 7:133086944-133086966 ATTGAAATGTACACTTCAAATGG + Intergenic
1032918762 7:136522167-136522189 ACTGAACTGTACAATTTAAATGG - Intergenic
1033139188 7:138809618-138809640 ACTGCTATGCACATTTTAAAGGG - Intronic
1033154459 7:138944967-138944989 ACTGAATTGAACACTTTGAAAGG + Intronic
1033294996 7:140124339-140124361 ACTGAGCTGTACACTTTAAAAGG + Intronic
1033432542 7:141302098-141302120 ACTGAACTGTACACTGAAAATGG + Intronic
1033643168 7:143281981-143282003 ACTGCATTGTACACTTTAAAAGG - Intronic
1034026771 7:147713205-147713227 ATAGAAATGTACACTGAAAAGGG - Intronic
1034523131 7:151636199-151636221 ACTGGGCTGCACACTTTAAATGG - Intronic
1034677287 7:152900941-152900963 ACAGACATACACACAGTAAAGGG + Intergenic
1034788084 7:153943604-153943626 ACTGAGATTGACACTGGAAAGGG - Intronic
1034875955 7:154724886-154724908 ACTGAACTGGACACTTAAAATGG + Intronic
1034979923 7:155468985-155469007 ACTGAAGTGTACACTTAAAATGG - Intergenic
1035033235 7:155878222-155878244 ACTGAAATGGAGACAGTAAATGG + Intergenic
1035176143 7:157052599-157052621 ACTGAATTGTACAGTTTAAATGG + Intergenic
1035197352 7:157232922-157232944 ACTGAACTGTACACTTTAAAAGG - Intronic
1035564429 8:631679-631701 GCTGAACAGCACACTGAAAAAGG - Intronic
1035755707 8:2030387-2030409 ACTGAACTGTACACTTAAAATGG - Intergenic
1035914316 8:3602108-3602130 ATTGAACTGCACACTTAAAATGG + Intronic
1036987361 8:13550129-13550151 ACTGTAATGCTCATTGTCAAGGG + Intergenic
1037014421 8:13884754-13884776 GCTGAAATTCAAAATGTAAATGG - Intergenic
1037087967 8:14876546-14876568 ACTGAACCGTACACTTTAAACGG + Intronic
1037140783 8:15517879-15517901 ACTGAATTGTACAATTTAAAAGG - Intronic
1037285956 8:17300638-17300660 ACTGAATTGTATACTTTAAAAGG - Intronic
1037531979 8:19785315-19785337 ACTGAAATGTACACTTAAAATGG + Intergenic
1037923591 8:22827264-22827286 ATTGAAATGTACACTTAAAATGG - Intronic
1038157924 8:25008319-25008341 AAAGAAATGTACACTGGAAAAGG + Intergenic
1038311131 8:26447131-26447153 ACTGAACGGCACACTTAAAATGG + Intronic
1038321646 8:26532405-26532427 ACTGAATTATACACTTTAAAGGG - Intronic
1038334544 8:26635653-26635675 TCTGAAATGAACATTATAAAAGG + Intronic
1038386450 8:27152443-27152465 ACTAAAATATACACTTTAAAGGG + Intergenic
1038427391 8:27472766-27472788 ACCGAATTGCACACTTTAAATGG + Intronic
1038977995 8:32723253-32723275 ACTGAAATGAACACTGAAGTTGG - Intronic
1039358580 8:36848990-36849012 ATTGAATTGTACACTGTAAATGG - Intronic
1039386317 8:37138982-37139004 ACACAAATGCATACTGTAATTGG - Intergenic
1039522005 8:38179055-38179077 ACTGAATTGTACATTTTAAAAGG + Intronic
1039654229 8:39381874-39381896 ACTGAATTGTACACTTAAAAAGG - Intergenic
1039672675 8:39619731-39619753 ATTGAAATAGACACAGTAAATGG + Intronic
1039680400 8:39729298-39729320 ACTGAACTGTACACTAAAAATGG + Intronic
1040422866 8:47256882-47256904 ACTGAATGGTACACTTTAAAGGG - Intergenic
1040729792 8:50430198-50430220 ATTGAATTGCACGCTTTAAATGG + Intronic
1040838044 8:51753191-51753213 ATTGAAATGGACAATGGAAAGGG - Intronic
1040868954 8:52080185-52080207 CCTGAAAAGCACAGTGCAAAAGG + Intergenic
1041370528 8:57154974-57154996 ATTGAACTGTACACTTTAAATGG - Intergenic
1041541066 8:58985599-58985621 ACTGAATTGCACACTTAAAGTGG + Intronic
1041750533 8:61255989-61256011 ACTGAAATATACACTTAAAATGG - Intronic
1041883843 8:62785549-62785571 ACTGAATTGTGCACTTTAAATGG + Intronic
1042077115 8:65008105-65008127 TCTGAAAGTCAAACTGTAAAAGG - Intergenic
1042094748 8:65201563-65201585 ACTAAATTGTACACTTTAAATGG - Intergenic
1042188308 8:66159065-66159087 ACTGAACTGTACACTTAAAATGG - Intronic
1042322855 8:67496448-67496470 AGTAAATTGCACACTATAAAAGG - Intronic
1042327484 8:67543658-67543680 ACTGAATTGTATACTGAAAATGG - Intronic
1042444277 8:68865867-68865889 ATTGAACTACACACTTTAAATGG + Intergenic
1042609491 8:70582069-70582091 ACTGAAATGTATACTTTAAAGGG + Intronic
1042730865 8:71933171-71933193 ACTGAATTGCACACCTCAAATGG + Intronic
1042900771 8:73725122-73725144 ACTTAAATGCTCAATTTAAATGG - Intronic
1042915388 8:73870103-73870125 ACTGAACTGTATACTTTAAAAGG + Intronic
1042951855 8:74208535-74208557 ACTGAATTGTACACTTAAAATGG - Intergenic
1043277615 8:78419557-78419579 ACTGAAAGGCAGAATTTAAAAGG - Intergenic
1043558934 8:81467963-81467985 ACTGAAATGCATGCTTAAAATGG - Intergenic
1043618300 8:82155608-82155630 ACTGAATTGTACAATTTAAATGG - Intergenic
1043685279 8:83076950-83076972 ACTGAATTGTACACTGTAAAAGG + Intergenic
1043842201 8:85120556-85120578 ACTGAATTGCACACTTCAAATGG - Intronic
1043851037 8:85216911-85216933 ATTGAAATGCACAATTTGAAAGG - Intronic
1043930607 8:86086630-86086652 ACTGAATTGCACACTTTAAATGG + Intronic
1043932304 8:86105036-86105058 ACTTAAATGAAGACTTTAAAGGG - Intronic
1044705406 8:95003829-95003851 AGTGAATTGCACACTTAAAATGG - Intronic
1045299290 8:100897205-100897227 ACTGAACTGTACACTTAAAATGG + Intergenic
1046186648 8:110730338-110730360 ACTGAAATGAACTCTCTTAAAGG - Intergenic
1046349803 8:112992998-112993020 ACTGGAATGCACATTTGAAAAGG + Intronic
1046384530 8:113491770-113491792 ATTGAATTGCACATTTTAAATGG - Intergenic
1046582026 8:116104679-116104701 ACTGAATTGCAAATTATAAAAGG - Intergenic
1046637630 8:116689369-116689391 ACAGAATTGTACACTTTAAACGG + Intronic
1046694534 8:117324676-117324698 ACTGAAACGTACACTTTAAAAGG + Intergenic
1046974943 8:120263999-120264021 ATTGAACTGCACACTTAAAATGG - Intronic
1046993175 8:120484677-120484699 ACTGAATTGTAAACTTTAAAAGG - Intronic
1047456000 8:125012292-125012314 ACTGTACTGTACACTTTAAATGG - Intronic
1047839068 8:128728236-128728258 ACTGAACTGTTCACTTTAAAAGG - Intergenic
1048129546 8:131679545-131679567 ACTGAATTGTACAATTTAAAAGG - Intergenic
1048177640 8:132167389-132167411 ACTGAACTGTTCACTTTAAAAGG + Intronic
1048188032 8:132262342-132262364 ATTGAATTGTACACTTTAAATGG + Intronic
1048781305 8:138005336-138005358 AAATAAATGAACACTGTAAAAGG - Intergenic
1048939025 8:139380706-139380728 AATGAAATGCCCAGTGAAAAAGG + Intergenic
1048987320 8:139741548-139741570 ACTGAATTGTACACTTTAAATGG - Intronic
1049150591 8:141032897-141032919 AGAAAAATGCACACTTTAAAGGG - Intergenic
1049226437 8:141453241-141453263 ATTGAATTGTACACTTTAAATGG + Intergenic
1049467691 8:142759848-142759870 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467698 8:142759897-142759919 ACTGAATTACCCACTGTAAATGG - Intergenic
1049467706 8:142759946-142759968 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467712 8:142759995-142760017 ACTGAATTAGCCACTGTAAACGG - Intergenic
1049467718 8:142760044-142760066 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467725 8:142760093-142760115 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467731 8:142760142-142760164 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467738 8:142760191-142760213 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467745 8:142760240-142760262 ACTGAGTTACCCACTGTAAATGG - Intergenic
1049467752 8:142760289-142760311 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467759 8:142760338-142760360 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467766 8:142760387-142760409 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467772 8:142760436-142760458 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467778 8:142760485-142760507 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467786 8:142760534-142760556 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467793 8:142760583-142760605 ACTGAATTAACCACTGTAAACGG - Intergenic
1049467801 8:142760632-142760654 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467808 8:142760681-142760703 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467814 8:142760730-142760752 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467820 8:142760779-142760801 ACTGAATTAGCCACTGTAAACGG - Intergenic
1049467827 8:142760828-142760850 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467833 8:142760877-142760899 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467840 8:142760926-142760948 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467846 8:142760975-142760997 ACTGAATTAGCCACTGTAAACGG - Intergenic
1049467853 8:142761024-142761046 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467859 8:142761073-142761095 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467866 8:142761122-142761144 ACTGAATTACCCACTGTAAACGG - Intergenic
1049467872 8:142761171-142761193 ACTGAATTAGCCACTGTAAACGG - Intergenic
1049467878 8:142761220-142761242 ACTGAATTAGCCACTGTAAACGG - Intergenic
1049467884 8:142761269-142761291 ACTGAATTACCCACTGTAAATGG - Intergenic
1049467891 8:142761318-142761340 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049479202 8:142812183-142812205 ACTGAACTGTTCACTTTAAATGG - Intergenic
1049611292 8:143556881-143556903 ACAGAATTGCACACTTTAAATGG - Intronic
1050105047 9:2156739-2156761 ACTGAAATGTACACTTGAAATGG - Intronic
1050382584 9:5045441-5045463 ACTGAACTGTACACTTAAAATGG - Intronic
1050484553 9:6119950-6119972 ACTGAATTGTACTCTTTAAAAGG - Intergenic
1050556500 9:6793905-6793927 ACTGAATTGCACACTTTAAATGG - Intronic
1050967309 9:11821954-11821976 ACACACATGCACACTATAAAAGG - Intergenic
1051299640 9:15634678-15634700 ACTGAATTGTACACTTCAAATGG - Intronic
1051308378 9:15741161-15741183 ACTGAACTGTATACTTTAAAAGG - Intronic
1051392219 9:16577694-16577716 AATGAAATGCATGCAGTAAAAGG + Intronic
1051441643 9:17089886-17089908 ACTGAATTGCACAGTTAAAATGG - Intergenic
1051491133 9:17667239-17667261 ACTGAATTGTACACTTTTAAAGG - Intronic
1051546861 9:18285873-18285895 AGTCAATTGCACACTTTAAATGG - Intergenic
1051703417 9:19850499-19850521 ATTGAATTGTACACTTTAAAAGG - Intergenic
1051711308 9:19934084-19934106 ACTGAATAGTACACTTTAAAAGG + Intergenic
1051773884 9:20613251-20613273 ACAGACTTGCACACTTTAAAAGG + Intronic
1051796148 9:20872686-20872708 ACTAAATTGCATACTTTAAAGGG - Intronic
1051806750 9:21002672-21002694 ACTGAACTGCACACTTAAAAAGG + Exonic
1051871756 9:21746001-21746023 ACTGAATTAGACACTTTAAACGG - Intergenic
1051924221 9:22304192-22304214 ACTGAGCTGCACACTTAAAATGG - Intergenic
1052168762 9:25367526-25367548 ACTGAACTGCATACTTTAAATGG - Intergenic
1052339247 9:27349102-27349124 ACTTAGATGCACAATGTAATAGG + Intronic
1052439644 9:28478947-28478969 GCTAAAATGTATACTGTAAAAGG - Intronic
1052512992 9:29445695-29445717 ATTGAATTGTACACTTTAAATGG + Intergenic
1052683705 9:31727789-31727811 ACTGAATTGTACACTTAAAATGG - Intergenic
1052704326 9:31976349-31976371 ATTTAATTGCACACTGTAAATGG + Intergenic
1052985790 9:34486655-34486677 ACTGAATTGTACACTTTAAGTGG - Intronic
1053154278 9:35764543-35764565 ACTGAATTGTACATTTTAAATGG - Intergenic
1053221047 9:36313471-36313493 ACTGAATTGTATACTTTAAACGG + Intergenic
1053223379 9:36330347-36330369 ACTGAATTGTACACAGTAAGTGG - Intergenic
1053254987 9:36609228-36609250 ACTAAAATCTACACTTTAAAAGG + Intronic
1053374114 9:37590583-37590605 ACTGAATTGTACACCTTAAATGG + Intronic
1053564241 9:39231486-39231508 ACTGAACTGTACACTTAAAATGG - Intronic
1053586101 9:39460663-39460685 ACTGAATTCTACACTTTAAATGG + Intergenic
1053619888 9:39804085-39804107 ACTGAATTGTACACTTAAAATGG - Intergenic
1053830027 9:42069358-42069380 ACTGAACTGTACACTTAAAATGG - Intronic
1053853110 9:42309725-42309747 ACTGAAGTGTATACTTTAAATGG + Intergenic
1053878065 9:42563400-42563422 ACTGAATTGTACACTTAAAATGG - Intergenic
1053894597 9:42730965-42730987 ACTGAATTGTACACTTAAAATGG + Intergenic
1053945433 9:43304434-43304456 ACTGAACTGTACACTTAAAATGG - Intergenic
1054132907 9:61387548-61387570 ACTGAACTGTACACTTAAAATGG + Intergenic
1054233629 9:62538294-62538316 ACTGAATTGTACACTTAAAATGG + Intergenic
1054264269 9:62903359-62903381 ACTGAATTGTACACTTAAAATGG + Intergenic
1054442677 9:65281658-65281680 ACTGAACTGTACACTTAAAATGG - Intergenic
1054487602 9:65739843-65739865 ACTGAACTGTACACTTAAAATGG + Intergenic
1054580208 9:66904567-66904589 ACTGAATTCTACACTTTAAATGG - Intronic
1054600531 9:67118095-67118117 ACTGAACTGTACACTTAAAATGG + Intergenic
1054796826 9:69309980-69310002 ACTGAACTGTACACTTAAAATGG - Intergenic
1054829683 9:69609706-69609728 ACAGAAATGGACATTGCAAAGGG - Intronic
1054856398 9:69904082-69904104 ACTGAATTGTACACTTTAAAAGG - Intronic
1055062598 9:72085673-72085695 TCTGAAATACAGACTGTAAAAGG + Intergenic
1055391755 9:75829235-75829257 ACTGAATTGTACCCTTTAAAAGG + Intergenic
1055789225 9:79903776-79903798 CCTAAAATGCAAAATGTAAAAGG - Intergenic
1055898422 9:81206968-81206990 ATTGAATTGTACACTTTAAATGG + Intergenic
1055984316 9:82040677-82040699 ACTGAATTGTATACTTTAAATGG - Intergenic
1056081630 9:83101092-83101114 ACTGAAATGCACATTTAAAGGGG - Intergenic
1056084763 9:83135521-83135543 GCTGAATTGCACACTTTAAAAGG + Intergenic
1056131158 9:83587909-83587931 ACTGAACTGTACACTCAAAATGG + Intergenic
1056147922 9:83752676-83752698 ACTGAATTGTACACTTTAAATGG + Intronic
1056262950 9:84867143-84867165 ACTGAATTGTATACTTTAAATGG + Intronic
1056406552 9:86281567-86281589 ACTGAATTGTACCCTTTAAAAGG + Intronic
1056510904 9:87304729-87304751 ACTGAATTGTACACTTTAAAGGG + Intergenic
1056651625 9:88469851-88469873 ACAGAAATGCACATTTTAAATGG - Intronic
1056880075 9:90382860-90382882 ACTGAATTGCACACTTACAATGG + Intergenic
1056933336 9:90896626-90896648 ACTCAAATTCACACTCCAAAAGG - Exonic
1057143430 9:92742302-92742324 ACTGAATGGTACACTTTAAAAGG - Intronic
1057269119 9:93637340-93637362 ACCGAACTGCACACTTTAAATGG - Intronic
1057295327 9:93831517-93831539 ACTGAATTTTACACTTTAAATGG - Intergenic
1057324839 9:94052105-94052127 ACTGAAATGTATACTTAAAATGG - Intronic
1057574483 9:96231100-96231122 ACTGAATTGTATACTTTAAATGG + Intergenic
1057603697 9:96482525-96482547 ACTGAATTGTACACTTTAAAAGG - Intronic
1057740479 9:97706939-97706961 ATTGAATTGTACACTTTAAATGG - Intergenic
1057752283 9:97802773-97802795 ACTGAACTGCACACTTAAAATGG + Intergenic
1057807686 9:98232102-98232124 ACTGAATTACACATTTTAAATGG + Intronic
1057827128 9:98379837-98379859 ACTGAATTGTACACATTAAAAGG + Intronic
1057862337 9:98651038-98651060 ACTGAACTGTACACTTAAAATGG + Intronic
1057914083 9:99042233-99042255 ACTGAATTGTACAATTTAAAGGG - Intronic
1058529076 9:105888205-105888227 ACTGAATTGTACACTTTAAATGG - Intergenic
1058584614 9:106493634-106493656 ATTGAATTGTACACTTTAAATGG + Intergenic
1058609493 9:106759848-106759870 ACTAAACTGTACACTTTAAAGGG + Intergenic
1058677373 9:107411963-107411985 ACTGAATTGTACACTTAAAATGG + Intergenic
1059109827 9:111545452-111545474 ACTGAATTGTACACTTGAAATGG - Intronic
1059279761 9:113122535-113122557 ACTGAATTGTCCACTTTAAAAGG + Intergenic
1059462927 9:114446461-114446483 ACTGATTTGCACACTTTAAAAGG + Intronic
1059737209 9:117113949-117113971 ATTGAATTGCATACTCTAAATGG + Intronic
1059764298 9:117369346-117369368 CCTGAAAAGCACACAATAAATGG - Intronic
1060036402 9:120259754-120259776 ACTTAAATGCCCCCTGTAGATGG + Intergenic
1060090318 9:120737004-120737026 ACTGACTTGTACACTTTAAAAGG - Intergenic
1060263429 9:122094630-122094652 ACTGAATTGTACACTAAAAATGG - Intergenic
1060293679 9:122328278-122328300 ACTGAACTGTACACTTAAAATGG - Intergenic
1060495557 9:124115892-124115914 ACTGAATTGTACACTTAAAAGGG + Intergenic
1060609933 9:124954631-124954653 ACTGAATTGTATACTTTAAATGG - Intronic
1060840337 9:126788482-126788504 ACTGAATTGTATACTTTAAAAGG + Intergenic
1060874479 9:127071838-127071860 AGTGAATTGTACACTTTAAATGG - Intronic
1060921862 9:127426145-127426167 ACTGAATTGTTCACTTTAAAAGG - Intronic
1061011738 9:127959975-127959997 ACTTAACTGTACACTTTAAATGG + Intronic
1061030288 9:128077752-128077774 ACTGAACTGTATACTTTAAATGG + Intronic
1061596238 9:131631224-131631246 ACTGAATCGTACACTTTAAATGG - Intronic
1062227708 9:135462774-135462796 ATTGAATTGTACACTTTAAATGG - Intergenic
1062237815 9:135521103-135521125 GCTGACGTGCACACTGTCAAGGG - Intergenic
1062356043 9:136163012-136163034 ACTGAATTACACAATTTAAATGG - Intergenic
1062356048 9:136163107-136163129 ACTGAATTACACACTTAAAAAGG - Intergenic
1062457834 9:136647926-136647948 ACTGAATTGTACATTTTAAATGG - Intergenic
1062701612 9:137908583-137908605 ACTGACTTGTACACTTTAAATGG - Intronic
1062723264 9:138056106-138056128 ACTTAATTGCACACTGTAAGTGG - Intronic
1203588568 Un_KI270747v1:33012-33034 ACTGAACTGTACACTTAAAATGG - Intergenic
1203614760 Un_KI270749v1:49619-49641 ACTGAACTGTACACTTAAAATGG + Intergenic
1186009235 X:5110218-5110240 ACTGAATTGTACACTTAAAATGG + Intergenic
1186158977 X:6756533-6756555 ACTGAATCGCACACTTTAAATGG + Intergenic
1186370930 X:8946746-8946768 ACTGAATTGTACATTTTAAATGG - Intergenic
1186461480 X:9751733-9751755 ACTGAACTGCACACGTTTAAAGG + Intronic
1186509543 X:10120444-10120466 ACAGAAGTGCTCACTGTAAGTGG + Intronic
1186519234 X:10191057-10191079 ACTGAATTGTATACTTTAAATGG - Intronic
1186578598 X:10792850-10792872 ACTGAATTGTACACTTTGAAAGG + Intronic
1186580264 X:10810044-10810066 ATTGAATTGTACACTTTAAAAGG - Intronic
1186636482 X:11410595-11410617 ACTGAACTGTACACTTTAAATGG + Intronic
1186659500 X:11654920-11654942 ACTGAATTGTATACTTTAAAAGG - Intronic
1186770436 X:12812675-12812697 GCTGAACTGTACACTTTAAATGG - Intronic
1186802196 X:13104591-13104613 ACTGAATTGTACACTTTAACAGG + Intergenic
1186995085 X:15112705-15112727 ACCGAATTGCACACTTTAAAGGG - Intergenic
1187184984 X:16975954-16975976 ACTGAAGTGTACACTTCAAATGG - Intronic
1187194048 X:17064656-17064678 ACTGAATTGTATACTTTAAATGG - Intronic
1187373657 X:18731636-18731658 ATTGAATTGCACACTTTAAATGG - Intronic
1187463538 X:19508524-19508546 ACTGAAATGAACACTAAAAATGG + Intronic
1187488499 X:19727188-19727210 ACTGAACTGTACACTTAAAATGG - Intronic
1187503618 X:19860576-19860598 ACTGAATTGTACACTTAAAACGG + Intronic
1187505972 X:19878885-19878907 ATTGAATTGCACACCTTAAATGG + Intronic
1187515862 X:19969285-19969307 ACTGAAATGCACAAGCAAAATGG + Intronic
1187517062 X:19981989-19982011 ACTGAATTGTACACTTTAAATGG + Intergenic
1187530704 X:20093863-20093885 ACTGAACTGAACGCTTTAAAGGG + Intronic
1187586197 X:20664529-20664551 ACTGAACTGTACACTTTAAAAGG + Intergenic
1187877851 X:23818980-23819002 ATTGAATTGTACACTTTAAATGG - Intergenic
1187890682 X:23932004-23932026 ATTGAATTGTACACTTTAAATGG + Intronic
1187916954 X:24162727-24162749 ACTGAAATGTACATTTTAAAGGG - Intronic
1187930255 X:24287115-24287137 ACTGAATTGAACACTTTAAAAGG - Intergenic
1187941044 X:24381534-24381556 ACTGAACTGTACACTTAAAATGG + Intergenic
1188194653 X:27217946-27217968 TCTGATGTGCACACTCTAAATGG - Intergenic
1188299588 X:28491466-28491488 ATTGAAATGTACACTTTAATGGG - Intergenic
1188367102 X:29330131-29330153 ACTGAATTATACACTTTAAATGG + Intronic
1188722181 X:33536155-33536177 ATAGAAATGAACACTGTTAAAGG + Intergenic
1189073674 X:37891586-37891608 ATTGAATTGTACACTTTAAATGG + Intronic
1189259207 X:39666158-39666180 ACAGAAATCCAGAATGTAAAAGG - Intergenic
1189488639 X:41452316-41452338 ACTGAACTGCACGCTTAAAATGG + Intronic
1189538915 X:41966026-41966048 ACTGAATTGTACACTTAAAATGG + Intergenic
1189621896 X:42849829-42849851 ACTGAATTGTACACTCTAAATGG + Intergenic
1189699751 X:43706184-43706206 ATTGAATTGTACACTATAAATGG + Intronic
1189764510 X:44356626-44356648 ACTGAATTGTATACTGTAGAAGG + Intergenic
1189880142 X:45482483-45482505 ATTGAACTGTACACTTTAAAGGG - Intergenic
1189904093 X:45740097-45740119 ACTGAATTGTACACTTTAAATGG - Intergenic
1190363641 X:49671717-49671739 ACTGAATTGCACACTTTAAAAGG - Intergenic
1190395032 X:49973590-49973612 ATTGAATTGTACACTTTAAATGG - Intronic
1190436690 X:50432801-50432823 AGTGAAAGGAACAATGTAAAGGG + Intronic
1191696011 X:63991317-63991339 ACTGAATTGTACACTTGAAAAGG + Intergenic
1191782913 X:64887577-64887599 ACTGAATTGTTCACTGAAAATGG + Intergenic
1191901810 X:66048433-66048455 ACTGAACTGTACACTTTAAGTGG + Intergenic
1192098278 X:68236425-68236447 ACTGAATTGTACACTTTAAAAGG - Intronic
1192252786 X:69426876-69426898 ACTGAATTGTACAATTTAAAAGG - Intergenic
1192345899 X:70305213-70305235 AGTGAAATGTATACTTTAAAAGG - Intronic
1192402641 X:70852089-70852111 ACTGAATTACACAGTGTAAATGG + Intronic
1192484877 X:71516463-71516485 ACTGAACTGCACACTTAAAAAGG + Intronic
1192536259 X:71930420-71930442 ACTGAATTATACACTTTAAATGG - Intergenic
1192593549 X:72382848-72382870 ACTGAATTGCACTCTTTAAATGG + Intronic
1192596718 X:72417040-72417062 ACTGAATTGTACACTTAAAATGG - Intronic
1192626967 X:72738932-72738954 ACTGAATTGTACACTTAAAAAGG - Intergenic
1192654671 X:72980681-72980703 ACTGAATTGGACACTTTAAAAGG + Intergenic
1192801724 X:74471681-74471703 ACTGAAATGTACACTTAAAATGG - Intronic
1192802667 X:74481860-74481882 ACTGAATTGTACACTTTTAAAGG - Intronic
1193211171 X:78808937-78808959 ACTGTCCTGCACACTGCAAATGG + Intergenic
1193719659 X:84972242-84972264 ACTGAAGTACACATTTTAAAAGG + Intergenic
1194061109 X:89199302-89199324 ACTTAAATGTACAATTTAAAAGG - Intergenic
1194311211 X:92309616-92309638 ACTGAAGTGTACACTTAAAATGG + Intronic
1194779221 X:98002941-98002963 ACTCAATTGCATACTTTAAAAGG + Intergenic
1194879508 X:99234529-99234551 ACTGAAGTGTACACTTTGAAAGG - Intergenic
1194998765 X:100621833-100621855 ACTGAATTGCACACTTAAAAGGG + Intergenic
1195031848 X:100933915-100933937 ACTAAATTGTACACTTTAAATGG - Intergenic
1195058675 X:101172719-101172741 ACTGAATTGTACATTTTAAATGG + Intergenic
1195137591 X:101924970-101924992 ACTGAATTTCACACTTAAAATGG + Intronic
1195274856 X:103272076-103272098 ACTGAATTGTATACTGTAAAAGG + Intergenic
1195309836 X:103621523-103621545 ACTGAACTGTACACTTTCAATGG + Intronic
1195331228 X:103802686-103802708 ATTGGATTGCACACTTTAAATGG - Intergenic
1195413263 X:104592340-104592362 ACTGATAAGCACAATGTAGAAGG - Intronic
1195462827 X:105146592-105146614 ACTGAAGTGTACACTTTAAATGG - Intronic
1195641327 X:107178290-107178312 ACTGAACTGTACATTTTAAATGG + Intronic
1195790473 X:108579038-108579060 ATTGAATTGTACACTTTAAATGG - Intronic
1195921100 X:109984603-109984625 ACTGAATTGTACACTTAAAAAGG + Intergenic
1196064958 X:111453951-111453973 ATTGAATTGTACACTGTAAATGG + Intergenic
1196279620 X:113808325-113808347 AGAAAAATGCACACTTTAAAAGG + Intergenic
1196338630 X:114569464-114569486 ACTGAATTATACACTTTAAAGGG + Intergenic
1196354118 X:114769497-114769519 ACTGAATTGTACACTTTAAAGGG - Intronic
1196499466 X:116362587-116362609 ACTGAATTGTACATTTTAAAAGG - Intergenic
1196548327 X:116992033-116992055 ACTAAATTGTATACTGTAAAGGG - Intergenic
1196839480 X:119845791-119845813 ACTGAACTGTATACTTTAAAAGG + Intronic
1196839754 X:119848570-119848592 ACTGAACTGTACACTTAAAATGG + Intronic
1197322423 X:125049119-125049141 ACTGAATTGTACACTTTAAAAGG - Intergenic
1197496275 X:127185752-127185774 ACTGAATTGCATAATTTAAAAGG - Intergenic
1197629243 X:128838986-128839008 ACTGAACTGTACACTTTAAAAGG - Intergenic
1197731864 X:129817506-129817528 ACTGAATTGCACACTTAAAATGG - Intronic
1197826113 X:130591973-130591995 ACTGAATTGTATACTTTAAATGG - Intergenic
1197916959 X:131546067-131546089 ATAGAATTGCACACTGTAATTGG - Intergenic
1197970282 X:132108359-132108381 ACTGAATTGTACACTTTAAAAGG + Intronic
1198123523 X:133619770-133619792 ACTGAATTGTACATTTTAAAAGG + Intronic
1198569999 X:137944728-137944750 ATTAAAATGCAGACTGTAATTGG - Intergenic
1198719462 X:139600249-139600271 ACTGAATTGTATACTTTAAAAGG + Intronic
1198723716 X:139653731-139653753 ACTGAACTGTACACTTAAAATGG - Intronic
1198728196 X:139699381-139699403 ATTGAATTGTACACTTTAAATGG - Intronic
1199513186 X:148646258-148646280 ACTGAATTGTACACTTTAAATGG + Intronic
1199518744 X:148710527-148710549 ACTGAATTGTACACTAAAAATGG - Intronic
1199652259 X:149957855-149957877 ACTGAATTGTACACTTAAAAGGG - Intergenic
1199759402 X:150893650-150893672 ACTGACTTGTACACTTTAAAAGG - Intronic
1199793032 X:151172743-151172765 ACTGAATTCTACACTTTAAAGGG + Intergenic
1199909878 X:152273842-152273864 ACTGAACTGTACACTCAAAATGG + Intronic
1200250291 X:154549636-154549658 ATTGAATTGTACACTTTAAATGG - Intronic
1200301888 X:154984710-154984732 CCTAAAATGCACACAGTCAATGG - Exonic
1200314189 X:155114530-155114552 ACTGAACTGTACACTTAAAATGG + Intronic
1200388990 X:155924226-155924248 ACTGAAGTGTACCCTTTAAATGG - Intronic
1200619485 Y:5423904-5423926 ACTGAAGTGCACACTTAAAATGG + Intronic
1201748056 Y:17402363-17402385 ACAGAAATGTAAACTGGAAAAGG + Intergenic
1202047608 Y:20750291-20750313 ACTGAAATGCACACTTTTGAAGG + Intergenic
1202365057 Y:24154636-24154658 ACTGAACTGTACACTTCAAAGGG - Intergenic
1202505724 Y:25515486-25515508 ACTGAACTGTACACTTCAAAGGG + Intergenic