ID: 1092835031

View in Genome Browser
Species Human (GRCh38)
Location 12:12479256-12479278
Sequence TTGCATTTGAATAAGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 2, 2: 2, 3: 35, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092835027_1092835031 26 Left 1092835027 12:12479207-12479229 CCTCATGGATACTTTTCAGGTGA 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1092835031 12:12479256-12479278 TTGCATTTGAATAAGGAACAAGG 0: 1
1: 2
2: 2
3: 35
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092835031 Original CRISPR TTGCATTTGAATAAGGAACA AGG Intronic
900836989 1:5012617-5012639 TTGTATTTGCATAAGGAAGGGGG + Intergenic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905881863 1:41468999-41469021 TGGCATTTGAATAAAAAGCATGG - Intergenic
906592221 1:47036020-47036042 TGGCTTTTGCATAAGGATCATGG - Exonic
906814726 1:48867115-48867137 TTGCATTTGGATAGGCAACAAGG + Intronic
907040547 1:51254874-51254896 ATTCATTTGAAAAAGGAACTAGG - Intronic
909618473 1:77640093-77640115 TAGCACTTGAATAAGCATCAAGG - Intronic
909937929 1:81575514-81575536 TTCCATTAGAATTAGGAGCAAGG + Intronic
909990284 1:82215304-82215326 TAGCAAATGAATAAGGAAAATGG - Intergenic
911329979 1:96515857-96515879 TTGCATTCCAACAAAGAACACGG + Intergenic
912459243 1:109820095-109820117 TTGCCCTTGAAAGAGGAACAGGG + Intergenic
912578921 1:110703012-110703034 ATGTATTTGAATAATGAAGAGGG - Intergenic
913212227 1:116591093-116591115 CTGCATTTGAAGAAGGGAGAAGG - Intronic
913317421 1:117564675-117564697 TTTCATTTTAGTAATGAACATGG - Intergenic
914003783 1:143715359-143715381 TTAAATTTGAAAAAGAAACAAGG + Intergenic
914516223 1:148377029-148377051 TTAAATTTGAAAAAGAAACAGGG + Intergenic
916891777 1:169118928-169118950 GTGCATTTGAATAACTTACAAGG + Intronic
916984793 1:170179539-170179561 TTGAATTTTAAATAGGAACATGG + Intergenic
917027808 1:170661758-170661780 ATGCATTTAATTAAGGAACTGGG - Intergenic
917820906 1:178763013-178763035 TTGTATTTGTATATGGTACAAGG + Intronic
918051859 1:180980491-180980513 GTTCATTTGGATAAGTAACAAGG - Intronic
918300895 1:183203010-183203032 ATGCTTTTGAAAAAGGAAAAAGG - Intronic
918447273 1:184627993-184628015 TTGCATTTTATTTAGGAACATGG + Exonic
918577325 1:186078639-186078661 TTTCATTTGAATGTGGAACTAGG - Intronic
919605592 1:199678952-199678974 TTGAATTTGAATAGGGAAGCTGG + Intergenic
922132519 1:222794333-222794355 ATGCATTGGACTAAGGCACATGG + Intergenic
923819094 1:237415760-237415782 CTGGATTTGAAAAAGCAACAGGG + Intronic
923914672 1:238488715-238488737 TTGCATTTGAGCAATCAACAGGG - Intergenic
1063294005 10:4783107-4783129 ATCCATTTCAATAAGAAACAAGG - Intergenic
1063430720 10:5985785-5985807 TGGCTTTTGACTTAGGAACAAGG + Intergenic
1063646159 10:7885636-7885658 AAGCATTTGAATTAGAAACATGG - Intronic
1063743855 10:8857301-8857323 TTGCATATGAGTCTGGAACAGGG + Intergenic
1064819692 10:19313056-19313078 TGGCATTTTAACAAGCAACATGG + Intronic
1066701690 10:38136316-38136338 TTGCATTTTTAGTAGGAACAGGG + Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1068326660 10:55498069-55498091 TTACATTTGAATAAGGAACATGG - Intronic
1068384457 10:56307347-56307369 TTTCATTTGACAAAGGAACTAGG + Intergenic
1069230482 10:66003210-66003232 TTGCATTTGCTTATGAAACAAGG + Intronic
1069328201 10:67258066-67258088 TTGCATATGTAGAAGGAACAAGG - Intronic
1069878502 10:71577649-71577671 GTCCATTTGAATAAGGGATATGG + Intronic
1070363563 10:75714310-75714332 TTTCATCTGCACAAGGAACATGG - Intronic
1072263720 10:93707013-93707035 TTGCCTTTCAATAAGGCCCATGG + Intergenic
1073657443 10:105431986-105432008 TTGCTTCTTAATAAGAAACATGG + Intergenic
1074145451 10:110713369-110713391 TTGCTGTTAAGTAAGGAACATGG + Intronic
1074894181 10:117760628-117760650 TTCCAATTAAATAAGGTACATGG - Intergenic
1074921360 10:118017306-118017328 TTGCATTTCAAGAAGGCACACGG + Intronic
1076165515 10:128279320-128279342 TTGCATATAACTGAGGAACAAGG + Intergenic
1079604486 11:22347657-22347679 TTCAATTTGAATAATGTACATGG - Intronic
1083497544 11:63070870-63070892 TTGCATTTCACAAAGGAACAAGG - Intergenic
1085713158 11:78848506-78848528 TTACATTTAAAAAAGGAAAATGG - Intronic
1085755596 11:79198827-79198849 TGGCACTTGAAGAAGGAGCACGG + Intronic
1086577808 11:88360789-88360811 CTGCATTTGAGCAAGGAAGAAGG + Intergenic
1086883454 11:92176060-92176082 TTGCATTACAATAATGCACAAGG + Intergenic
1086903002 11:92388626-92388648 TTGCATGTATATAAGCAACAGGG + Intronic
1087095346 11:94312618-94312640 ATGCTCTTGAAAAAGGAACATGG + Intergenic
1087115676 11:94521947-94521969 TGGAATTTGAGAAAGGAACAAGG - Intergenic
1089950049 11:122517232-122517254 TTGCATTATAATAAGAAACCTGG + Intergenic
1090561620 11:127938716-127938738 TTGCAGATTAATGAGGAACAAGG + Intergenic
1091392914 12:136818-136840 CTGCCTTTAAATAAGGGACAAGG - Intronic
1091871842 12:3898234-3898256 TTGAATGTGAAGAAGAAACATGG - Intergenic
1092835031 12:12479256-12479278 TTGCATTTGAATAAGGAACAAGG + Intronic
1093669158 12:21851929-21851951 TTGCATATTATTAATGAACAGGG - Intronic
1095842461 12:46708746-46708768 TCACATTTGAATAAAGAAAAGGG - Intergenic
1097579675 12:61439435-61439457 TTCTATTTGAATTAGCAACACGG + Intergenic
1097781793 12:63715251-63715273 TTGCATATGTACAAGGAATAGGG + Intergenic
1097919114 12:65052679-65052701 TTGCATTTGAATCAAGCACCAGG + Intronic
1099329846 12:81270141-81270163 TTGCAGTAGAATAAATAACAAGG + Intronic
1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG + Intronic
1102799697 12:115721193-115721215 ATGCGTTTAAATAATGAACAAGG - Intergenic
1105215474 13:18281716-18281738 CTGCATTTGAAGAAGGGAGAAGG - Intergenic
1105609496 13:21955464-21955486 ATAAATTTGCATAAGGAACAAGG - Intergenic
1106072581 13:26426640-26426662 ATGCCTTTGAATAAGGAGCTAGG - Intergenic
1107130479 13:36888921-36888943 TTGCCTTTGGAAAGGGAACATGG + Intronic
1107675123 13:42788118-42788140 CTGCATTTTAATAAGGTACCTGG - Intronic
1108250940 13:48567290-48567312 TTGGTTTTGAATTGGGAACAGGG - Intergenic
1108794458 13:54014475-54014497 TTGCATTTTAATAAGGCTTATGG - Intergenic
1109917702 13:69013713-69013735 TTGAATATGAATAAGATACAAGG - Intergenic
1109969909 13:69754369-69754391 TTACAATTTAATAAGGGACAAGG + Intronic
1110792738 13:79603081-79603103 TTGCATTCCAATAAGGAAAACGG + Intergenic
1112317797 13:98379938-98379960 TTGCAGGTGAATAAGGATAAAGG - Intronic
1113191786 13:107757121-107757143 ATGCCTTTAAACAAGGAACAAGG + Intronic
1113506022 13:110816518-110816540 TTGCCTTTAAAGAAGGAGCAGGG - Intergenic
1114193595 14:20458803-20458825 CTACATGTGGATAAGGAACAAGG - Intronic
1116962446 14:50980154-50980176 TTGCATTTGAATTAAGAACTTGG + Intronic
1117363547 14:55002229-55002251 TTGAATTTGAAGAAGGAAAAAGG + Intronic
1117380998 14:55162769-55162791 TTGCCTTTGAAGAAAGAGCAAGG - Intronic
1117503415 14:56376406-56376428 GTGCAATTGAATAAGGACAATGG - Intergenic
1117921772 14:60732173-60732195 TTCCATTTGAATTAGGAACCTGG + Intergenic
1118157450 14:63255594-63255616 GTGCATTTGAATCAGGAGCATGG - Intronic
1118303437 14:64635048-64635070 TTGCATTTCAATAAAGACCTCGG + Intergenic
1118553860 14:66990397-66990419 ATACAATTGTATAAGGAACATGG - Intronic
1119577363 14:75737850-75737872 TTGAATTTAAATGAGGAACAGGG + Intronic
1119921547 14:78451004-78451026 TTGCATCAGAATAAGGAATGAGG + Intronic
1120195387 14:81476891-81476913 TTGCATTTGATTTAGGACCTTGG - Exonic
1120243350 14:81975994-81976016 TTTGATTCTAATAAGGAACATGG - Intergenic
1120934353 14:89879413-89879435 TTTAAATTGAATAAGGAATATGG - Intronic
1122558636 14:102594986-102595008 TTGGATGTGACTAAGGAAAAGGG + Intronic
1123496997 15:20837068-20837090 ATGCAGTTGAATTAAGAACATGG + Intronic
1123554229 15:21410654-21410676 ATGCAGTTGAATTAAGAACATGG + Intronic
1123590476 15:21848023-21848045 ATGCAGTTGAATTAAGAACATGG + Intergenic
1125008201 15:34841149-34841171 TTTCATTTTAATTTGGAACAGGG + Intergenic
1126561767 15:50051995-50052017 TTGAATGGGAACAAGGAACAAGG + Intronic
1126574496 15:50183705-50183727 CTGCACTTGAATAAGGACCAAGG + Intronic
1127244929 15:57162806-57162828 TTGAAGTGGAAAAAGGAACAAGG - Intronic
1127737322 15:61854947-61854969 TTTCTTTTGAAACAGGAACAGGG - Exonic
1129813303 15:78528628-78528650 TTGCATTTTTATTAGAAACAGGG - Intronic
1131234819 15:90686747-90686769 TTGCATCTGAATCAGAAACAAGG - Intergenic
1131804928 15:96111482-96111504 TTACTTTTGAATAAAGAACTTGG - Intergenic
1131887407 15:96931765-96931787 TTTTATATGAAAAAGGAACATGG + Intergenic
1131981694 15:98000515-98000537 TTGTATTTGAATAAAGATAATGG - Intergenic
1132068738 15:98755764-98755786 TTTTATTTAAATCAGGAACAAGG - Intronic
1132162214 15:99553029-99553051 TTGCATTTGTATAAGTAAAAAGG + Intergenic
1202962577 15_KI270727v1_random:137852-137874 ATGCAGTTGAATTAAGAACATGG + Intergenic
1133141778 16:3750335-3750357 CTGCATTTGAACAAAGAAAATGG + Intronic
1133604462 16:7372568-7372590 TTGCATCTGACTTAGGAAGAAGG + Intronic
1135380475 16:21992226-21992248 TTTTATTTGAATAAGAGACATGG - Intronic
1137449198 16:48555083-48555105 GGGCATTTGAAGAAGGAGCAAGG - Intronic
1138773100 16:59688074-59688096 TTGCTTTTGGATAAGAAAGAAGG + Intergenic
1139232602 16:65299154-65299176 TTGCATTTGTATAATGATCAGGG - Intergenic
1139797628 16:69496341-69496363 TTGCATTTTTATCAGGTACAGGG - Intergenic
1140515581 16:75539004-75539026 TTTCCCTTGACTAAGGAACAGGG - Exonic
1144721463 17:17473392-17473414 ATGTATTTGAAAAAGGAACTGGG - Intergenic
1145825255 17:27872111-27872133 TTGCATCTCAAGAATGAACATGG - Intronic
1146277018 17:31522601-31522623 TAGGATTTGAAGAAGGGACAAGG - Intronic
1148865016 17:50623890-50623912 CTGCATCTGCAAAAGGAACAGGG - Exonic
1149366097 17:55946096-55946118 TTCCATTTAAATAAACAACAGGG + Intergenic
1151047160 17:70934272-70934294 TTCTATTAGAATCAGGAACACGG - Intergenic
1153351909 18:4090504-4090526 TTGCATTTCTCTAATGAACAGGG - Intronic
1153484990 18:5588620-5588642 TCTCATTTGAAAAATGAACATGG - Intronic
1154455015 18:14513448-14513470 ATGCAGTTGAATTAAGAACATGG + Intronic
1155765342 18:29623999-29624021 TTGAATTTGAATGAGAGACATGG + Intergenic
1157351800 18:46894650-46894672 TTTCATTTGATAAAGGAACAAGG - Intronic
1157996680 18:52566004-52566026 TAGCATTTGTATAAGGTATAAGG + Intronic
1158419932 18:57284222-57284244 TTGCATTTCTCTAATGAACAGGG + Intergenic
1158870089 18:61677932-61677954 TTCCATTTTATGAAGGAACATGG + Intergenic
1159286064 18:66353797-66353819 TAGCATTGGAAAAAGTAACAGGG + Intergenic
1165038800 19:33054370-33054392 TTGCATTTTTAGTAGGAACAGGG + Intronic
1165185728 19:34019397-34019419 TGACATTGGGATAAGGAACATGG - Intergenic
1165978554 19:39699241-39699263 TTGTATTTGAATAACCTACAGGG + Intergenic
1167123513 19:47533194-47533216 TTGTATTTTAAGTAGGAACAGGG - Intronic
1168496980 19:56861441-56861463 TTTCATTTGAAGAAAGCACATGG + Intergenic
925736168 2:6965693-6965715 TTCCAGGTGAATAAGGAAAAAGG + Intronic
925878431 2:8331268-8331290 TTGCATTTGAAAGAAGAAAAGGG - Intergenic
929654074 2:43712140-43712162 TGACGTTTGAATAATGAACAAGG + Intronic
930321488 2:49859661-49859683 TTGCTTGTGAATATGGAAAAGGG + Intergenic
930928075 2:56846031-56846053 AAGCATTGGAATAAGCAACAGGG + Intergenic
931899632 2:66773065-66773087 CTGCCTTTGAATAAGGCAGAAGG + Intergenic
932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG + Intergenic
933123312 2:78570906-78570928 ATGCATTTGAATAAACAGCAAGG - Intergenic
933435032 2:82238346-82238368 ATGCATTAAAATAAGGAGCAGGG + Intergenic
934298856 2:91765011-91765033 CTGCATTTGAAGAAGGGAGAAGG + Intergenic
934734652 2:96683851-96683873 CCTCATTTCAATAAGGAACATGG + Intergenic
934854566 2:97720975-97720997 TTGCATTTGCATAACTAAGAAGG + Intronic
935327455 2:101949609-101949631 TTGTTTTTGAATATGGAATAAGG - Intergenic
937457704 2:122057390-122057412 TTTCATTTGGACAAGGGACAAGG + Intergenic
938638787 2:133258289-133258311 TTGGATTTGAGTGAGGAGCAAGG - Intronic
938775987 2:134542038-134542060 TTGCTTTTGACTTAGCAACAAGG - Intronic
939999765 2:148955272-148955294 TTGTATTTGATTAAGTAACTGGG - Intronic
940640312 2:156338803-156338825 TTGCATTTGAAAAGCCAACAGGG + Intronic
941500805 2:166273476-166273498 TTGCATGTGAATCAGGTTCAAGG - Intronic
942984954 2:182129403-182129425 TGGAATTTGAAAAAGAAACAAGG - Exonic
943354014 2:186828982-186829004 TTGCATTTTAATATCGAAAATGG - Intronic
943597617 2:189876909-189876931 TTGAATTTAAATAAGGAACCAGG - Intronic
943624617 2:190184685-190184707 TTGGGTTTAAGTAAGGAACAGGG + Intronic
943849248 2:192695439-192695461 TTCCCTTTGAACAAGAAACAGGG - Intergenic
944099091 2:196003112-196003134 TTCCATTTAAATAATGAAGAAGG + Intronic
944638769 2:201700658-201700680 TTACTTTTGAAAAAGGATCATGG - Exonic
945222363 2:207497827-207497849 ATGAATTTGAAGATGGAACAAGG - Intergenic
945313709 2:208346874-208346896 TTGCATTTGAGGTAGAAACAAGG + Intronic
947321260 2:228921387-228921409 TTGCATTCCAAGGAGGAACATGG - Intronic
947397864 2:229704001-229704023 TTGAATTTGAATCAGAAATATGG + Intronic
948162824 2:235839229-235839251 TTCCATTTAAATATGGCACAAGG + Intronic
948853713 2:240720418-240720440 TTTCATTTAAATAAGAAAGACGG - Intronic
1169868199 20:10222968-10222990 GTGCACTTGAATAATAAACATGG + Intronic
1169901355 20:10555743-10555765 TTGGAATTGAAATAGGAACATGG - Intronic
1170133016 20:13043196-13043218 TTCCATTTCAGAAAGGAACATGG + Intronic
1170291988 20:14780624-14780646 GTCCATGTGAATATGGAACAAGG - Intronic
1174543275 20:51306445-51306467 CTGCATTTGAAGCAGGAGCATGG + Intergenic
1175469016 20:59212572-59212594 TTGCATTTGCTTTAGGATCAGGG + Intronic
1176275750 20:64267381-64267403 TTGCATTTAAAAAAGTAACAGGG + Intronic
1176819148 21:13639850-13639872 ATGCAGTTGAATTAAGAACATGG - Intronic
1177247770 21:18552081-18552103 TTGCATTTGCAAAAGTAACTAGG + Intergenic
1178078974 21:29042669-29042691 TAGGATTTGAATAAAGAACAGGG + Intronic
1179239622 21:39578494-39578516 TTGCATTTGAAGAAGAAAGGGGG + Intronic
1179535840 21:42051338-42051360 TTCTATTTGAATAAGGATGATGG - Intergenic
1183499699 22:38171299-38171321 TTGGATTTGAAGAAGGATCAGGG - Intronic
949867489 3:8558393-8558415 TGCCATTAGAATAAGGAACAAGG + Intronic
950129712 3:10533819-10533841 TGGCATTTGAATTAGGAGCATGG - Intronic
950236678 3:11327824-11327846 TTGCATTTTAATAAGAACCCAGG - Intronic
951289097 3:20854053-20854075 TTTCATTTGTATAAAGAAAAAGG - Intergenic
951334066 3:21399527-21399549 TGGCATCTGAGTAAGCAACATGG + Intergenic
951776383 3:26314895-26314917 TTGAATGTGAAAAAGGAACAGGG + Intergenic
952069483 3:29616881-29616903 TGGATTTTGAATAAGGAACCAGG - Intronic
952285067 3:31960501-31960523 TTGGATCTGAATAAGGAATTTGG - Intronic
953083945 3:39648410-39648432 TAGCATTTGATTGAGGAACTGGG + Intergenic
953663269 3:44906472-44906494 TTGCATTTGTTTTAGGCACAGGG + Intronic
954463751 3:50642426-50642448 TTGAATGTGACTAGGGAACATGG - Intronic
954927120 3:54245801-54245823 TTTCATTTGAAGATGAAACAAGG - Intronic
955414737 3:58681461-58681483 TTGGATTTGAATGAGGAAGGAGG - Intergenic
955508994 3:59660439-59660461 TTGCTTTAGCATTAGGAACAAGG + Intergenic
956070361 3:65443314-65443336 CTGCATTTTCATTAGGAACAAGG - Intronic
956927108 3:74001507-74001529 TTTAATTTGGATAAGAAACATGG + Intergenic
957183597 3:76913375-76913397 TTTCATTTGAATTAGCAGCAGGG - Intronic
957768703 3:84659597-84659619 TGGAATTTGAATAAGGTAAAAGG - Intergenic
962102210 3:132354535-132354557 TTGCTTTTAAATTAGGATCAAGG + Intronic
963219415 3:142790903-142790925 TTTCTTTTGAATAAGGCCCAAGG + Intronic
963852037 3:150218887-150218909 TTGTATTTGAAGAAGAGACAGGG + Intergenic
964787037 3:160408268-160408290 TTACATTTGAATAAGGATAAAGG + Intronic
965051008 3:163647563-163647585 GTGCATTTGAATAAGGATCATGG - Intergenic
965678646 3:171227505-171227527 TTGCATATGAATGCAGAACAAGG - Intronic
965828781 3:172758763-172758785 TTGCATATGATTAAGGAATCGGG + Intronic
966606329 3:181825082-181825104 TTGCATCTGAATAAGGAACAAGG - Intergenic
967274521 3:187760871-187760893 TGGGATTTGAAAAAGGAAGATGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968393110 4:209199-209221 TTTCAATTGAGTAAGTAACATGG + Intergenic
968823266 4:2873163-2873185 TTGCATTTTTATTAGAAACAGGG + Intronic
969062124 4:4444914-4444936 TTGCTCTTGATTAAGGGACAAGG - Intronic
970773872 4:19649107-19649129 TGGGGTTTGAATAAGAAACAAGG + Intergenic
970916193 4:21338086-21338108 CTGGATTTGAAAAAGAAACAAGG + Intronic
970989038 4:22191592-22191614 TTCCATTTCAATAAGGCAGAGGG + Intergenic
971163017 4:24153666-24153688 TTTCATGTGAATGAAGAACATGG - Intergenic
971536463 4:27758114-27758136 CTGCATTTGATTAAGAAAAAAGG - Intergenic
972053198 4:34766020-34766042 TTTCCTTGGAATAAGGAAGAAGG - Intergenic
972085604 4:35210489-35210511 TTGTATTTTAATAAGAGACAGGG + Intergenic
972202172 4:36726474-36726496 TTGCATTTTAAGTAGGGACAGGG + Intergenic
973581421 4:52348143-52348165 TTGCATTTGAGTCAACAACAAGG + Intergenic
974379118 4:61115730-61115752 TTGCTTTTGAAGAGGCAACATGG - Intergenic
974941720 4:68477516-68477538 CTGCATTTGTGTAGGGAACAGGG - Exonic
975198319 4:71553083-71553105 TTGCATTATCATAAGGAAAATGG + Intronic
976479984 4:85530896-85530918 TTGCATTTGCATAATGTGCAGGG + Intronic
977801496 4:101239165-101239187 TTGCATTTGATAAAGTAAAAGGG - Intronic
978015262 4:103736632-103736654 TTGCATTTGTATAGGTAAAATGG + Intergenic
978752480 4:112266783-112266805 TTCCATTTAAATAAAGACCAAGG - Intronic
978798427 4:112731421-112731443 TTCCATTAAAATAAGGAACTAGG + Intergenic
979046920 4:115878829-115878851 TAGCATTTGAAACAGGTACATGG + Intergenic
979419387 4:120485224-120485246 TTTTATTTGAAAATGGAACATGG + Intergenic
979608087 4:122660333-122660355 CTGAATTGGAATAAGGAATAAGG - Intergenic
980479491 4:133369319-133369341 TTATATATGCATAAGGAACAAGG + Intergenic
980788511 4:137587155-137587177 TTGCCTTTGACTGAGGAACTAGG - Intergenic
981196396 4:141925938-141925960 TTTCATGTGAAAAAGGAAAATGG + Intergenic
981498658 4:145422111-145422133 TTGCTAGTGAATAAGGAAAATGG - Intergenic
981761516 4:148200319-148200341 TGGCATTTGATTAGTGAACAAGG - Intronic
982482382 4:155928149-155928171 TAGTATTTGAAAAAGGAAGAGGG - Intronic
984122754 4:175766825-175766847 TTGCATTTTTAGTAGGAACAGGG + Intronic
984212050 4:176861795-176861817 ATGCATTTAAATAAAGAAGAAGG + Intergenic
984825295 4:183918957-183918979 TTGCAAATGAATAAGTAACATGG - Intronic
985823654 5:2177939-2177961 TTGTATTTTAAGAAGGAACTTGG - Intergenic
986032146 5:3904849-3904871 GTACATTTGAGTAAGGAATAGGG - Intergenic
986082775 5:4411384-4411406 TTGGATTTGAATCAGGTAGAGGG + Intergenic
987018041 5:13840384-13840406 TTGCTTTTAAATAGAGAACAAGG - Intronic
987835965 5:23162231-23162253 CTGGATTTGCATAAGAAACAAGG + Intergenic
988613785 5:32753715-32753737 TTGCATTTAAAGGAGGAACCTGG + Intronic
989521260 5:42403349-42403371 TAGCATCTGACTAAGGAAGAAGG + Intergenic
991419629 5:66427964-66427986 TTGCCTTTGAAGATGGAAGAAGG + Intergenic
991636257 5:68709050-68709072 TTACATTTGTTTAAGGAAAAGGG + Intergenic
992286832 5:75244318-75244340 TTGCATTTGAATAGCAAACACGG + Intergenic
992653079 5:78880689-78880711 TTGCATTAAAATAAGCAAAAGGG + Intronic
994918957 5:106017287-106017309 TTGCCTTTCAAAAAGTAACAAGG - Intergenic
995275080 5:110268562-110268584 TGGCATTTGAATGAGGTTCAGGG - Intergenic
995573997 5:113510901-113510923 TTTCATTTTAATAAGGGAGATGG - Intergenic
998882621 5:146658683-146658705 TTTCTTTTGAAAAAGGAAGAAGG - Intronic
998988634 5:147790370-147790392 TTGCATTTGCCTAAGGATCCTGG - Intergenic
999151606 5:149430075-149430097 TTGCATGTGATTATGGAACCTGG + Intergenic
999218160 5:149953505-149953527 CTGAATTTAAATAAGGAATAAGG + Intergenic
1000752006 5:165108371-165108393 TTGCATTAGAAAAAGCACCAAGG - Intergenic
1001917058 5:175570569-175570591 CTGCATTTGAATAAGTAAGTGGG + Intergenic
1003706189 6:8533426-8533448 TTGCAATTAAATAAGTCACATGG - Intergenic
1004290881 6:14366027-14366049 TTTCATTTAAAAAAGAAACATGG + Intergenic
1004602321 6:17162379-17162401 TTGCAATTTAACAAGGAAAAAGG + Intergenic
1007103048 6:39263765-39263787 TTGCTTTTGAATAGCTAACAGGG + Intergenic
1007279511 6:40700172-40700194 CTGCATTTGAATAAGACAAATGG - Intergenic
1007482089 6:42156914-42156936 TTGCATTTCAATAAGGCACAAGG + Intronic
1009446107 6:63744270-63744292 ATGCATTTTAAAAAGGAAAAAGG + Intronic
1009683873 6:66931020-66931042 TTGAATTTGAACCAGGTACATGG + Intergenic
1010318393 6:74477288-74477310 TTTAATATGAATAAAGAACAAGG - Intergenic
1011207181 6:84912543-84912565 TTGCATTTAACTAGGGAATAAGG - Intergenic
1011957603 6:93042424-93042446 TGGCATTTAAATAAGGAATGGGG - Intergenic
1012721219 6:102748166-102748188 TTCCATTTGAATAAGTTACATGG + Intergenic
1012831630 6:104210781-104210803 TTTCAGATGAATGAGGAACACGG + Intergenic
1013020200 6:106207130-106207152 ATACATTTGAAAAAGTAACAAGG - Intronic
1014399877 6:120975144-120975166 TTGCATTTGAAGAATAAAGAAGG - Intergenic
1014705920 6:124747273-124747295 TGGAATTAGAATAAGGGACAAGG - Intronic
1014780041 6:125554578-125554600 TTGCTTTTAATTAAGGAACATGG + Intergenic
1015400636 6:132784125-132784147 TTTCATTTGAAGAATTAACATGG + Intronic
1017985260 6:159437905-159437927 TTGGATTTGAATAAAGAAGTTGG - Intergenic
1020037934 7:4976358-4976380 CTGCATTTGAAAATGGAAGAGGG + Intergenic
1020159767 7:5761059-5761081 CTGCATTTGAAAATGGAAGAGGG - Exonic
1020642632 7:10775425-10775447 TTGTATTTGTATTAGGCACACGG - Intergenic
1021645436 7:22785021-22785043 TTGTCATGGAATAAGGAACAAGG - Intergenic
1021849848 7:24796547-24796569 TTGAATGTGAATAAATAACATGG - Exonic
1022777003 7:33537176-33537198 CTGCAATTTAATAGGGAACATGG - Intronic
1023500722 7:40846597-40846619 TTTCATTTGAAAAAGAAACAGGG - Intronic
1024788288 7:52933553-52933575 GTGCCTTTGAATAAGAAGCAAGG + Intergenic
1026507071 7:70994156-70994178 CTGCATATGTGTAAGGAACAAGG + Intergenic
1027515639 7:79138507-79138529 TTACATTTGAATATGGAAGGAGG - Intronic
1027561877 7:79740646-79740668 TGGCATTTGACTAAGGGACATGG + Intergenic
1027971775 7:85092089-85092111 TTGCATTTAAATTTGGAACTTGG - Intronic
1028488005 7:91381124-91381146 TTGGATTTGAATAAAGAGAATGG - Intergenic
1028505996 7:91570698-91570720 GTGCATTTCAAAAAGGAAAATGG - Intergenic
1028786749 7:94803432-94803454 TTGCATTTCTATAATGAATAAGG - Intergenic
1029254772 7:99262138-99262160 TTGCATTTGCATAATTAATAGGG + Intergenic
1030123678 7:106134651-106134673 TTGCATTTGAATACTTACCAGGG + Intergenic
1030183927 7:106740587-106740609 CTGCATTTGAAGAATGAAAAGGG - Intergenic
1030395792 7:108984893-108984915 CTACATTTGAATGAGGTACATGG + Intergenic
1030758820 7:113324826-113324848 TTGCAATGGAATGAGGTACAGGG + Intergenic
1030875720 7:114810786-114810808 TTGCATGAGGATAAGGCACAGGG + Intergenic
1031339749 7:120584528-120584550 TAGCATTTGAAACAGGTACATGG + Intronic
1031373193 7:120993017-120993039 TTCCATTTGAATAATGCAAAGGG + Intronic
1031886410 7:127250502-127250524 TTGCTTTTGAATAAGGGATGTGG - Intronic
1032204314 7:129848426-129848448 CTGTAATTCAATAAGGAACAGGG + Intronic
1032830535 7:135620582-135620604 ATGCCTGTGAATAAGGAAAATGG - Intronic
1033261062 7:139844422-139844444 TTGCCTTTGAATAATTAAAATGG - Intronic
1033496404 7:141901034-141901056 TTGCAAATGAATTAAGAACATGG - Intergenic
1034008103 7:147497172-147497194 ATGGATTTGAATAAAGAATATGG + Intronic
1035094147 7:156340029-156340051 TTGCATTCTAATAAGGACCCAGG - Intergenic
1035709782 8:1703985-1704007 TTGCACTTGATTATGTAACACGG - Exonic
1037600718 8:20391601-20391623 TGGCATATGGATAAGGAAAAAGG + Intergenic
1038660683 8:29494057-29494079 CTGCATTTGAATGAGGAGAAAGG - Intergenic
1039521859 8:38177731-38177753 TTGTTTTCGAATAAGGAACCGGG + Intronic
1039660627 8:39459826-39459848 TTGCATATTAACAAGGAACAAGG + Intergenic
1040954620 8:52967134-52967156 TTGCATTTCTATTATGAACATGG - Intergenic
1041041746 8:53853571-53853593 TTGCATTTGAATACAGAAAGAGG + Intronic
1041528102 8:58831462-58831484 TTGCATTGGCATAATGAATATGG + Intronic
1043510016 8:80941089-80941111 TTGGAAATTAATAAGGAACAAGG + Intergenic
1043812539 8:84759047-84759069 TTGGCTTTGAATATGGAACAAGG - Intronic
1044267299 8:90197784-90197806 TTGGATTTGAACAGGAAACAGGG - Intergenic
1044762487 8:95536191-95536213 TTGCATTTGAGTATGGTAGAAGG + Intergenic
1046180440 8:110639168-110639190 TTGCGTTTGAATGAGCCACATGG + Intergenic
1046316029 8:112502619-112502641 TTGCATTTGCCATAGGAACAGGG - Intronic
1047572607 8:126116554-126116576 TTGCAGTTGAATTACTAACATGG - Intergenic
1047878185 8:129163887-129163909 TTGCAATTACATAAGAAACATGG - Intergenic
1049131268 8:140844986-140845008 TTACATTTGAATTAGGGACAGGG - Intronic
1050425546 9:5509171-5509193 TTGCTTTTGTAGAAGAAACAAGG + Intergenic
1050498119 9:6265911-6265933 TTCCATGTGAACAAGGAGCATGG - Intergenic
1051013476 9:12447690-12447712 TGACATTTGCATAAGTAACAAGG + Intergenic
1051568629 9:18529190-18529212 TTGCATTTTACTGATGAACATGG + Intronic
1052278504 9:26705841-26705863 AGGCATTTGTATAAAGAACACGG + Intergenic
1053156987 9:35788180-35788202 TTTCTTTTGAAGAAGGGACAGGG + Intergenic
1055702307 9:78958571-78958593 CTGCATTTAAACAAGGAAAATGG - Intergenic
1055880245 9:80992565-80992587 ATGGATTAGAATAAAGAACATGG - Intergenic
1056499263 9:87191581-87191603 TTGCATTTCACTAAAGAATAAGG + Intergenic
1056781851 9:89556356-89556378 TGGGATTTGAATGAGGCACAAGG + Intergenic
1058114938 9:101074488-101074510 TTCCCTTTGAATAAGCATCAAGG + Intronic
1058934898 9:109761002-109761024 TGTCATTTGAATAAAGAATATGG + Intronic
1059037411 9:110770877-110770899 TTTTATTAAAATAAGGAACAAGG - Intronic
1059458056 9:114412202-114412224 TTTCAGATGCATAAGGAACATGG - Intronic
1203528209 Un_GL000213v1:109710-109732 ATGCAGTTGAATTAAGAACATGG + Intergenic
1188759215 X:34004901-34004923 TTGAATTTGAATAAGCATTATGG + Intergenic
1188925132 X:36031640-36031662 TTCCATTTGTATAAGGAGAATGG - Intergenic
1191951988 X:66602590-66602612 TTTCACATGAATCAGGAACAAGG - Intronic
1193518030 X:82494041-82494063 TTGCATTTTACTAAGCAACAAGG + Intergenic
1194543795 X:95206494-95206516 TAGCATTTGAGTAAGGCACCTGG + Intergenic
1195685126 X:107578413-107578435 TTGCCTTTGGAAAAGCAACATGG - Intronic
1198636116 X:138702353-138702375 TTACAATTCAATATGGAACATGG - Intronic
1199592673 X:149482219-149482241 TTAGATTTGAAAAAGAAACATGG + Intergenic
1201479336 Y:14422430-14422452 TAGCATTTGAATGAGTAGCAAGG - Intergenic