ID: 1092839737

View in Genome Browser
Species Human (GRCh38)
Location 12:12528303-12528325
Sequence CTACCTACTGGGAGAGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092839724_1092839737 28 Left 1092839724 12:12528252-12528274 CCCTCTACACTTAATGCTTCCTC 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1092839737 12:12528303-12528325 CTACCTACTGGGAGAGGGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 252
1092839723_1092839737 29 Left 1092839723 12:12528251-12528273 CCCCTCTACACTTAATGCTTCCT 0: 1
1: 0
2: 0
3: 30
4: 458
Right 1092839737 12:12528303-12528325 CTACCTACTGGGAGAGGGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 252
1092839727_1092839737 6 Left 1092839727 12:12528274-12528296 CCAGACACGCTGCCTGAAAACTC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1092839737 12:12528303-12528325 CTACCTACTGGGAGAGGGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 252
1092839725_1092839737 27 Left 1092839725 12:12528253-12528275 CCTCTACACTTAATGCTTCCTCC 0: 1
1: 0
2: 2
3: 22
4: 170
Right 1092839737 12:12528303-12528325 CTACCTACTGGGAGAGGGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 252
1092839729_1092839737 -6 Left 1092839729 12:12528286-12528308 CCTGAAAACTCAGGACCCTACCT 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1092839737 12:12528303-12528325 CTACCTACTGGGAGAGGGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 252
1092839726_1092839737 9 Left 1092839726 12:12528271-12528293 CCTCCAGACACGCTGCCTGAAAA 0: 1
1: 0
2: 1
3: 10
4: 208
Right 1092839737 12:12528303-12528325 CTACCTACTGGGAGAGGGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092839737 Original CRISPR CTACCTACTGGGAGAGGGGC CGG Intronic
900118723 1:1039729-1039751 CTTCCTTCTTGGAGAGGTGCAGG - Intronic
901207737 1:7506336-7506358 CTTCCCCCTGGGAGTGGGGCCGG - Intronic
901401407 1:9017431-9017453 CTTCCTTCTGGGTGTGGGGCAGG - Intronic
901667685 1:10835828-10835850 CTGCCTCCTGCGAGTGGGGCTGG - Intergenic
901795422 1:11676815-11676837 CCAGCTAGTGGGCGAGGGGCAGG + Intronic
902558208 1:17259643-17259665 CTCCCAACATGGAGAGGGGCCGG + Exonic
903773921 1:25781078-25781100 CCATCTACAGGGAGTGGGGCTGG + Exonic
904762944 1:32818174-32818196 GCCCCTACTGGGGGAGGGGCGGG + Intronic
904970710 1:34417705-34417727 CTTTCTGCTGGGAGAGGTGCTGG + Intergenic
905813791 1:40932245-40932267 CTACCAACTGGAGGAGGGGTCGG - Intergenic
906345010 1:45009621-45009643 ATACCTACTGGGAGAGCGATGGG - Exonic
907126723 1:52056626-52056648 CTGCCTCCTGGGACAGGGTCTGG - Intronic
907228468 1:52971749-52971771 CTTCCTTCTGGGCGTGGGGCAGG + Intronic
907232406 1:53012200-53012222 CTTCCTTCTGGGCGTGGGGCAGG - Intronic
909057513 1:70839221-70839243 CTACTTACAGGGAGAGCCGCTGG - Intergenic
910388751 1:86714419-86714441 CTACCCACTAGGTCAGGGGCTGG + Intronic
910507576 1:87967679-87967701 CTACCTACTGGGAATGAAGCTGG - Intergenic
912466146 1:109875904-109875926 CTACCTACTGGAAGGGCTGCAGG + Intergenic
912951880 1:114125899-114125921 CTAACTTTTGGGAGAGGGGAGGG + Intronic
917890414 1:179432116-179432138 ATACCTGTGGGGAGAGGGGCTGG + Intronic
918113604 1:181479164-181479186 CCAACTACTGTGAGATGGGCTGG + Intronic
920505075 1:206509573-206509595 CTACACACAGGGAGAGAGGCAGG + Intronic
922035835 1:221846928-221846950 CTACCTTCTGGGAGAGGGGAGGG + Intergenic
922599468 1:226838633-226838655 CAACCTCCTGGGAGAGGGGAGGG - Intergenic
923968951 1:239177800-239177822 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
924274773 1:242374657-242374679 CTTCCTTCTGGGTGTGGGGCAGG - Intronic
1062832138 10:612941-612963 ACACCCACTGGGAGGGGGGCCGG - Intronic
1065438428 10:25724968-25724990 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
1065600243 10:27360164-27360186 TTACCTTCTGGGAGAGTGGAAGG - Intergenic
1067233398 10:44427221-44427243 CTACGTGCTGGCAGAGAGGCTGG + Intergenic
1067265719 10:44742626-44742648 TTACCTTCTTGAAGAGGGGCAGG - Intergenic
1067683627 10:48454962-48454984 ATAGCTCCTGGGAGATGGGCTGG - Intronic
1067804219 10:49382060-49382082 AAATCTACTGGGGGAGGGGCTGG - Intronic
1068878466 10:62023067-62023089 CTAGGTATTGGGAAAGGGGCTGG - Intronic
1070332827 10:75430567-75430589 CTCCCAGCTGAGAGAGGGGCAGG + Intergenic
1070487350 10:76943484-76943506 CTACAGACTGAGAGAGGGGCTGG - Intronic
1074134570 10:110615520-110615542 CTTCCTACTGGAACAGGGCCTGG - Intergenic
1076452191 10:130564182-130564204 CCACCTTCTTGGTGAGGGGCAGG + Intergenic
1076705747 10:132300659-132300681 CTGTATACTGGGAGAGGGGAGGG + Intronic
1076812832 10:132898207-132898229 CTCCCTGCTGGGAGATGGGGAGG - Intronic
1077300241 11:1843341-1843363 GTGCCTACTGGGAAAGGGGGCGG + Intergenic
1078595232 11:12680712-12680734 ATCCCTACTGGGATAGGGGGAGG + Intronic
1080050886 11:27857785-27857807 CTGGCTCCTGGAAGAGGGGCTGG + Intergenic
1080307366 11:30851188-30851210 CTTCCTTCTGGGTGTGGGGCAGG + Intronic
1080893068 11:36426235-36426257 AGACCTACTGGCAGAAGGGCTGG - Intronic
1081366427 11:42240935-42240957 CTAGTTACTGTGACAGGGGCTGG - Intergenic
1083768142 11:64852090-64852112 CTGCCTTCTGCCAGAGGGGCTGG + Exonic
1085132888 11:74057011-74057033 CCAGCTACTGGGGGAGGGGAGGG - Intronic
1085274387 11:75289002-75289024 CTACCGGCGGGGAGAGGGGACGG + Intronic
1089605454 11:119638778-119638800 CCGGCTTCTGGGAGAGGGGCTGG + Intronic
1092839737 12:12528303-12528325 CTACCTACTGGGAGAGGGGCCGG + Intronic
1092904781 12:13091318-13091340 CTTCCTTCTGGGTGTGGGGCAGG - Intronic
1092937602 12:13378565-13378587 CTACCTGCTGGGCCAGGGTCAGG - Intronic
1096046881 12:48570205-48570227 CTAGATACTGGGAGAGGGAAAGG - Intergenic
1096073470 12:48788599-48788621 GCACGTACTGGGGGAGGGGCTGG - Intronic
1096968958 12:55650189-55650211 CCAGCTACTGGGAGAAGGCCTGG + Intergenic
1098373044 12:69780377-69780399 CCAACTGCAGGGAGAGGGGCTGG + Intronic
1099441545 12:82705726-82705748 CTTCCTAATGGAAGAGGGGATGG - Intronic
1100768961 12:97900080-97900102 GTAGCTACTGGGAGAGGGAAAGG - Intergenic
1101214188 12:102564171-102564193 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
1101571478 12:105957850-105957872 CTACCTACTGTAACAGGGGGAGG - Intergenic
1105705761 13:22966577-22966599 CTACCTTATGGGTGAGAGGCAGG - Intergenic
1105858665 13:24391562-24391584 CTACCTTATGGGTGAGAGGCAGG - Intergenic
1106727071 13:32496972-32496994 CTACCTACTGTAATATGGGCTGG - Intronic
1108076593 13:46686392-46686414 CTTCCTTCTGGGCGTGGGGCAGG + Intronic
1108844461 13:54660460-54660482 CTACCAACTCGGAAGGGGGCGGG + Intergenic
1111046203 13:82815964-82815986 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
1113634014 13:111907630-111907652 CTACCCAGTGGAAGGGGGGCTGG + Intergenic
1114543648 14:23482652-23482674 CTATCTAATGGGGGAGGGGAGGG + Intronic
1114645324 14:24252828-24252850 CAGCCTTCTGGGACAGGGGCAGG - Intronic
1114911763 14:27208254-27208276 ACACCTTCTGGGGGAGGGGCAGG + Intergenic
1115166308 14:30452247-30452269 CTTCCTTCTGGGTGTGGGGCAGG + Intergenic
1116071998 14:40059017-40059039 CTAATTACAGGGAGAGGGCCTGG + Intergenic
1116891694 14:50274956-50274978 CTACAGACTGGGAGGGGGGTGGG + Intronic
1117600945 14:57373808-57373830 CTACATGCTGGGAGTGGGGGAGG - Intergenic
1119028619 14:71174158-71174180 CTGACTACTGGGAGAGGCCCAGG - Intergenic
1119536647 14:75408451-75408473 CTAGGTACTGGGGGTGGGGCAGG + Intergenic
1119780831 14:77275897-77275919 CTACCTACTGGGTGGTGGGGAGG - Exonic
1119975697 14:79021516-79021538 CTACTTACTTGGAGAGTGCCAGG + Intronic
1120314668 14:82875938-82875960 ATACCTTCTGGGAGAGCTGCAGG + Intergenic
1121188112 14:91995224-91995246 TTACCCACTGGTAGAGGGGAAGG - Intronic
1122082348 14:99274485-99274507 CTTCCTGCTGGGAGTGGGGAGGG - Intergenic
1122203532 14:100136918-100136940 CCACCTTCTGGGACAGGCGCTGG - Intronic
1122540204 14:102493738-102493760 CTCCCTGCTGTGACAGGGGCAGG + Intronic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124781598 15:32641645-32641667 CCACCTGCTGGAGGAGGGGCCGG + Intergenic
1125342105 15:38685410-38685432 CTTCCTACTGGGTGTGGGGCAGG - Intergenic
1125479500 15:40070402-40070424 CTGCCTACTGGGATGGGCGCCGG - Intergenic
1127449608 15:59103924-59103946 CCAGGTACTGGGAGGGGGGCGGG - Intergenic
1128700314 15:69799211-69799233 CTCCCTACAGGAAGAGGGGAGGG + Intergenic
1129010151 15:72408603-72408625 CTATCTTCTGGGGGCGGGGCGGG - Intergenic
1130185351 15:81675742-81675764 ATATCTACTGGGAGATGGTCTGG - Intergenic
1130958138 15:88641498-88641520 CTAGAATCTGGGAGAGGGGCAGG - Intronic
1131191257 15:90318721-90318743 CTTCCTTCTGGGTGAGGGGCAGG + Intergenic
1131293637 15:91128751-91128773 CTTCCTTCTGGGTGTGGGGCAGG - Intronic
1131398073 15:92102724-92102746 CTACCTACTGGAAGAGCTGGTGG + Intronic
1132994426 16:2815551-2815573 CTGCTGGCTGGGAGAGGGGCAGG + Intergenic
1135126248 16:19811895-19811917 GTACCTACAGGGAAAGGGTCTGG + Intronic
1135141641 16:19927192-19927214 CTTCCTTCTGGGTGTGGGGCAGG + Intergenic
1135241221 16:20808155-20808177 CCACTGACTGGGAGAAGGGCTGG - Intronic
1142203899 16:88773674-88773696 CTGCCTACTGGGTGACAGGCAGG + Intronic
1142203909 16:88773716-88773738 CTGCCTACTGGGTGACAGGCAGG + Intronic
1142708200 17:1709655-1709677 CTAAGAACTGGGAGAGGGGCGGG - Intronic
1142717624 17:1755626-1755648 CCAGCTCCTGGCAGAGGGGCTGG - Intergenic
1144017917 17:11214155-11214177 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
1144767356 17:17739975-17739997 CTCCCCACTGGGAGTGGGGATGG + Intronic
1148393664 17:47291535-47291557 CTGCCTAAGGGGAGAGGGGTTGG + Intronic
1148619609 17:49024457-49024479 ATAGTTACTGGGAGAGGGGAAGG + Intronic
1149497787 17:57131211-57131233 CTAACTACTGGGTGCGGGGTGGG - Intergenic
1152015545 17:77748134-77748156 CTTCCTTCTGGGTGAGGAGCTGG - Intergenic
1152990207 18:356481-356503 CTACATGCTGGGAGAGAGGTGGG + Intronic
1155937383 18:31767802-31767824 CTTCCTCCTGGGTGTGGGGCAGG - Intergenic
1157531534 18:48425231-48425253 CTACCTACTGGGAGCAGCCCTGG + Intergenic
1157860273 18:51134933-51134955 TTACCTACTGGGGGAGATGCAGG - Intergenic
1159106035 18:64002758-64002780 CTACCTCCTGGGAGAGGCTGGGG - Intronic
1160299233 18:77665027-77665049 CTTGCTCCTGGGAAAGGGGCTGG + Intergenic
1161721281 19:5904037-5904059 CTATCTACTAGGGGAGGGGCCGG + Intergenic
1161725312 19:5925152-5925174 GTCCCGACTGGGAGATGGGCGGG - Intronic
1162617566 19:11814474-11814496 CGGGCGACTGGGAGAGGGGCTGG + Intronic
1164100774 19:22052652-22052674 CGACATCCTGGGAGAGGGGAAGG + Intronic
1167869495 19:52355963-52355985 CTAGCTTCTAGGAGAGGGGCTGG - Intronic
1168100428 19:54138341-54138363 ATACCGACGCGGAGAGGGGCGGG - Intronic
1168475042 19:56669414-56669436 CTACCTCCTGGGAGGGGAGAGGG - Intronic
925976588 2:9146243-9146265 CTCCTTGCTGGGAGTGGGGCAGG + Intergenic
926105058 2:10144858-10144880 CTGCCCACTGGGGGAAGGGCGGG + Intronic
926544490 2:14222583-14222605 CTAGGTACTGGGAGACAGGCAGG - Intergenic
928061468 2:28117566-28117588 CAACCTGCTGGGAGAAGTGCAGG - Intronic
928549684 2:32357943-32357965 CTCCCTTGTGGGAGAGGAGCCGG + Intronic
929461366 2:42104030-42104052 CTTCCTCCTGGGTGTGGGGCAGG + Intergenic
930006159 2:46898785-46898807 CTGCATCCTGGGTGAGGGGCTGG - Intergenic
931304269 2:61013349-61013371 CTTCCTTCTGGGTGTGGGGCAGG - Intronic
931968096 2:67555882-67555904 CTTCCTCCTGGGAGGGAGGCTGG + Intergenic
932278877 2:70472512-70472534 CTACTTACAGGAAGAGGGTCTGG + Intronic
932479838 2:72032570-72032592 CTTCCTGCTGGGAGAGGCCCAGG - Intergenic
935414321 2:102799676-102799698 CTTCCTTCTGGGTGTGGGGCGGG + Intronic
936600577 2:113890502-113890524 CTCCCTCCTGGGACTGGGGCGGG + Intronic
937239865 2:120453089-120453111 CTGCCTGCTGGGATAGGGGCTGG + Intergenic
938069410 2:128300540-128300562 CTACTTGCTGGGAGAGGGACTGG - Intronic
938092298 2:128441651-128441673 CTGCCTATGGGGAGAGGCGCAGG - Intergenic
938378856 2:130825578-130825600 CTCCCTCCTGGGTGAGAGGCAGG - Intergenic
938943941 2:136193485-136193507 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
940223820 2:151381630-151381652 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
940453273 2:153867545-153867567 CCACAGACTGGGAGAGGGGATGG + Intergenic
941724070 2:168841992-168842014 CTTCCTGCTGGGAATGGGGCAGG + Intronic
942510067 2:176688555-176688577 CTCCCTGATGGTAGAGGGGCAGG + Intergenic
946359099 2:219208330-219208352 CTACCTGCTGGGAGAGGTACAGG - Exonic
948502334 2:238404870-238404892 CTGACTCCTGGGGGAGGGGCAGG - Intergenic
948875160 2:240822598-240822620 CTGCCTGCAGGGAGCGGGGCGGG + Intergenic
1169414027 20:5400435-5400457 ACAGCTACTGGGAGAGGGGTGGG + Intergenic
1171770986 20:29323651-29323673 CCACCTTCAGGGAGAGGGTCTGG + Intergenic
1173301740 20:41809602-41809624 CTACCTACAAGCAGAGGGGCTGG + Intergenic
1179316078 21:40245511-40245533 CTCCCTTCAGGGAGAGGTGCAGG - Intronic
1180758768 22:18182891-18182913 CTACCAACTGGGGGAGGGCAGGG + Intergenic
1180809976 22:18753022-18753044 CTACCAACTGGGGGAGGGCAGGG - Intergenic
1180826930 22:18869907-18869929 CTACCAACTGGGGGAGGGCAGGG + Intergenic
1181196120 22:21187274-21187296 CTACCAACTGGGGGAGGGCAGGG - Intergenic
1181213407 22:21305850-21305872 CTACCAACTGGGGGAGGGCAGGG + Intergenic
1183375613 22:37463151-37463173 CGACCTCCTGGGTGGGGGGCAGG + Intergenic
1184111143 22:42396079-42396101 CTACCAACTGGGATTGGGCCTGG - Intronic
1184504608 22:44893321-44893343 GTCCCTCCTGGGAGTGGGGCTGG - Intronic
1203230678 22_KI270731v1_random:107567-107589 CTACCAACTGGGGGAGGGCAGGG + Intergenic
949569228 3:5275818-5275840 CTACGTACTTGGAGAGAGTCTGG - Intergenic
953919580 3:46942825-46942847 TTTCCTACTGAGAGATGGGCTGG + Intronic
954198055 3:49007866-49007888 CTCCCTTCTAGGAGATGGGCGGG + Intronic
954389581 3:50261584-50261606 CTACCTGCTGGGACAGGGGGTGG - Intergenic
954630295 3:52044409-52044431 CTAGCCGCTGGGAGAGAGGCAGG - Intergenic
955488986 3:59463661-59463683 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
956018360 3:64908227-64908249 CTAGCTAATGGTGGAGGGGCGGG + Intergenic
957237699 3:77615730-77615752 CTACCTACTGGGAGACATGTTGG + Intronic
957614420 3:82509143-82509165 CTGCCAACTTGGAAAGGGGCAGG - Intergenic
961390621 3:126550499-126550521 GTAGCTGCTGGGAGATGGGCTGG - Intronic
961553416 3:127681588-127681610 CTACCTTCTGGGTGTGGGGCAGG + Intergenic
961682510 3:128608478-128608500 CTCCCGGCTGGCAGAGGGGCCGG - Intergenic
963061801 3:141232028-141232050 CTCGCCAGTGGGAGAGGGGCGGG + Intronic
964084295 3:152797692-152797714 CTTCCTTCTGGGTGTGGGGCAGG + Intergenic
966491361 3:180531617-180531639 CTGTCCTCTGGGAGAGGGGCTGG + Intergenic
966818349 3:183906792-183906814 CTACCTGAGGGTAGAGGGGCAGG + Intergenic
966885884 3:184377991-184378013 CTCCCAGCTGGGGGAGGGGCAGG - Intronic
972718472 4:41673001-41673023 TTAGCTATTGGGAGAGGGGGAGG - Intronic
973650191 4:52991456-52991478 CTACCAACTGGGCTAGGGGGAGG + Intronic
975784959 4:77877789-77877811 CTACCCACTGAGAGCAGGGCAGG - Intronic
976221190 4:82758139-82758161 TCACCTCCTGGGAGAGGGGGAGG + Intronic
977348786 4:95853190-95853212 CTTCCTTCTGGGTGATGGGCTGG + Intergenic
979186240 4:117797691-117797713 CTTCCTTCTGGGTGTGGGGCAGG + Intergenic
979381163 4:120008544-120008566 AGACCTACTAGCAGAGGGGCAGG + Intergenic
981295139 4:143123116-143123138 CAACCCATTGGGAGAGGTGCAGG - Intergenic
982094702 4:151911359-151911381 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
983937238 4:173510476-173510498 CTACCTACTTGTGGAGGGGTAGG - Intergenic
984257866 4:177408952-177408974 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
990300185 5:54441965-54441987 CTAAAGACTGGCAGAGGGGCAGG - Intergenic
990604585 5:57395952-57395974 CTTCCTCCTGGGAATGGGGCAGG + Intergenic
991963238 5:72066099-72066121 ATGCCTAGTGGGGGAGGGGCTGG + Intergenic
991970346 5:72135056-72135078 CTTCCTATTGCGGGAGGGGCTGG - Intronic
992707063 5:79406842-79406864 CCTGTTACTGGGAGAGGGGCAGG + Intronic
997995321 5:138581140-138581162 GTTCCTACTGGGAGTGGGGAGGG + Intergenic
1001092729 5:168753095-168753117 CATCCTACAGGGAGAGGGGTGGG + Exonic
1001783373 5:174390441-174390463 CTACCTCCTGGCAGAGGGTCTGG - Intergenic
1002617542 5:180464908-180464930 CCATCTACTGAGAGAGGGACAGG + Intergenic
1004237974 6:13891752-13891774 TCACCTTCTAGGAGAGGGGCTGG + Intergenic
1006358479 6:33574283-33574305 CTTCCAGCTGGGAGAGGGGTGGG - Intronic
1006522669 6:34581116-34581138 CTTCCTTCTGGGTGAGGGGGAGG - Intergenic
1006919198 6:37616330-37616352 CTACCTGCCTGGAGATGGGCAGG - Intergenic
1008174770 6:48253502-48253524 CTCCTTATAGGGAGAGGGGCGGG + Intergenic
1008199652 6:48570635-48570657 CTACTTAATGTTAGAGGGGCTGG + Intergenic
1008613028 6:53201689-53201711 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
1009523540 6:64714870-64714892 CTAGCAACTGGTAGAGGGGGTGG - Intronic
1013359486 6:109381748-109381770 CTACCTCCGGAGAGAGGCGCCGG + Intronic
1014974664 6:127864469-127864491 CTATCTTCTGGGAGAGTGCCAGG + Intronic
1019481355 7:1268334-1268356 CGTCCTCCTGGGTGAGGGGCTGG + Intergenic
1019483597 7:1277346-1277368 CTTCCTACTGGGGGGGGGGAGGG - Intergenic
1021983925 7:26081081-26081103 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
1022121003 7:27307917-27307939 CTACCTAAGGTGAGCGGGGCAGG - Intergenic
1024124068 7:46273641-46273663 CTCTCCACTGGGATAGGGGCTGG - Intergenic
1025947936 7:66119051-66119073 CTTCCTACTGGGTAAGGGGCAGG - Intronic
1025994457 7:66519064-66519086 CTACCTTCCTGGAGGGGGGCAGG - Intergenic
1026033539 7:66815599-66815621 CTACCTTCCCGGAGGGGGGCAGG + Intergenic
1026883329 7:73921057-73921079 CTTCCTGCTGGCACAGGGGCCGG - Intergenic
1026896518 7:74012984-74013006 CCACCTACTGGGTGAGAGCCAGG - Intergenic
1027429391 7:78094751-78094773 CTACCCAGTGGGAAAAGGGCAGG - Intronic
1028182423 7:87741502-87741524 CTGCCTAAAGGGAGAGGGGCTGG + Exonic
1031919940 7:127593145-127593167 CTACCCACTGGCAGAGCAGCTGG + Intronic
1032025047 7:128434521-128434543 CCAGCTACTGGGAGTGGGGCAGG + Intergenic
1032379269 7:131459211-131459233 CTTCCTCCTGGGAATGGGGCAGG + Intronic
1034759487 7:153658014-153658036 CTAACTACAGGGAGAAGGGAGGG - Intergenic
1035022003 7:155805705-155805727 GTTCCTACTGGGAGCCGGGCCGG - Intronic
1035158085 7:156930343-156930365 CTTCCCACTGGGAGAAGGGGAGG - Intergenic
1035670517 8:1413712-1413734 CTACATACTGGGAGACTGGGTGG - Intergenic
1035775254 8:2182671-2182693 ATACCTCCTTGGAGAGGAGCAGG + Intergenic
1036821719 8:11945334-11945356 CTAGCTACTGGGAGAGGCTGAGG + Intergenic
1037765622 8:21770644-21770666 CTGCATCCTGGGTGAGGGGCAGG - Intronic
1038227400 8:25669997-25670019 CTTCCTTCTGGGTGTGGGGCAGG + Intergenic
1039328837 8:36514290-36514312 CTTCCTTCTGGGTGTGGGGCAGG + Intergenic
1039569484 8:38575627-38575649 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
1039771813 8:40694952-40694974 CTTCCTTCTGGGTGTGGGGCAGG - Intronic
1040454233 8:47579890-47579912 CTCCCTCCTGGGAGATGGTCTGG + Intronic
1041312306 8:56529545-56529567 CTGCCTACTGGGGTGGGGGCGGG - Intergenic
1044172979 8:89080166-89080188 CTATCTACTGGAAGAGGGTAGGG - Intergenic
1047471484 8:125178053-125178075 TTAACTAATGGCAGAGGGGCTGG - Intronic
1047585598 8:126268738-126268760 CTCCCTCCTGGGAGACTGGCTGG - Intergenic
1047702122 8:127459386-127459408 CTACCTTTGGGGAGAGGGGAGGG + Intergenic
1049422647 8:142523766-142523788 CTGCTTACTGGGAGGGGGGTGGG + Intronic
1053024654 9:34719784-34719806 CTGCCTGGTGGGAGTGGGGCAGG - Intergenic
1053036014 9:34827263-34827285 CTGCCTGGTGGGAGTGGGGCAGG - Intergenic
1053606277 9:39663218-39663240 CCACCTACTGGGAGAGGTGGGGG + Intergenic
1053864199 9:42419833-42419855 CCACCTACTGGGAGAGGTGGGGG + Intergenic
1054247263 9:62679198-62679220 CCACCTACTGGGAGAGGTGGGGG - Intergenic
1054561382 9:66713733-66713755 CCACCTACTGGGAGAGGTGGGGG - Intergenic
1054704884 9:68452295-68452317 CTTCCTACTAAGAGAAGGGCAGG - Intronic
1055641359 9:78321053-78321075 CTGCCTTCTGGGAGAGGCCCAGG - Intronic
1057268133 9:93632133-93632155 CTCCCTGCAGGGACAGGGGCAGG - Intronic
1057588057 9:96347269-96347291 CCACCTCCTGGGAGAGCTGCAGG + Intronic
1061286951 9:129629211-129629233 GTACCTGCTGGCAGAGGGGCAGG + Intronic
1061944383 9:133900564-133900586 CTTCCTTCTGGGTGTGGGGCAGG - Intronic
1062212042 9:135370419-135370441 CTTCCTACAGGGGGTGGGGCGGG + Intergenic
1062364282 9:136201658-136201680 TCACCCACTGGGAGATGGGCTGG - Intronic
1062623864 9:137434327-137434349 CTCCCTGCTGGGATCGGGGCAGG - Exonic
1186250548 X:7661140-7661162 CTCCCTTCTGGGTGTGGGGCAGG + Intergenic
1186758610 X:12699950-12699972 CTTCCTTCTGGGTGTGGGGCAGG + Intronic
1187043698 X:15624463-15624485 CCACTTACAGAGAGAGGGGCAGG + Intergenic
1187268838 X:17761643-17761665 AGACCTACTGGAAGAGGGACAGG - Intergenic
1187485084 X:19695574-19695596 CTACCAAGCAGGAGAGGGGCGGG - Intronic
1187842326 X:23501627-23501649 CTTCCTTCTGGGTGTGGGGCGGG - Intergenic
1190076696 X:47322283-47322305 GTACCTGCTGGGAGAGCAGCTGG + Intergenic
1194103015 X:89730740-89730762 CTACCTAATTGGAGGAGGGCAGG - Intergenic
1195910628 X:109885555-109885577 CTTCCTTCTGGGTGTGGGGCAGG + Intergenic
1195992364 X:110695462-110695484 TTAGCTCCTGGGAGAGGGGTGGG - Intronic
1196679148 X:118453207-118453229 ATCCCTACTTGGAGAGGGGGAGG + Intergenic
1197882788 X:131186721-131186743 ATGACTACTGGGAGAGGGACAGG + Intergenic
1198851151 X:140966577-140966599 CTTCCTTCTGGGAGTGCGGCAGG + Intergenic
1199073106 X:143501523-143501545 CTTCCTTCTGGGTGTGGGGCAGG + Intergenic
1199215620 X:145257236-145257258 CTTCCTTCTGGGTGTGGGGCAGG - Intergenic
1200037831 X:153344811-153344833 CCACCTTCTTGGAGTGGGGCAGG + Intronic
1200455700 Y:3388764-3388786 CTACCTAATTGGAGGAGGGCAGG - Intergenic