ID: 1092841428

View in Genome Browser
Species Human (GRCh38)
Location 12:12545881-12545903
Sequence TTACCGGCTTTGAATTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092841428 Original CRISPR TTACCGGCTTTGAATTTGGT GGG (reversed) Intronic
906633415 1:47391304-47391326 TTACTGGCTTTGAAGGTAGTGGG + Intergenic
909357296 1:74724768-74724790 TTAGAGTTTTTGAATTTGGTGGG - Exonic
909839883 1:80306784-80306806 TTACAGGCTTTTAAATTTGTAGG - Intergenic
912362622 1:109107511-109107533 TTTTTGGCTTTGGATTTGGTAGG + Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916885694 1:169065570-169065592 TTACTGGCTTTGAAGATGGAAGG - Intergenic
917114696 1:171591064-171591086 TTACCAGCTCAGAATGTGGTAGG + Intronic
922352991 1:224750107-224750129 TTTCTGGCTTTGTATGTGGTAGG + Intergenic
1063434114 10:6016985-6017007 TGACCCACTTTGAATTTGGGGGG - Intronic
1065829058 10:29597820-29597842 TTACCGGCTGTGAATCTGTAAGG - Intronic
1069028762 10:63572928-63572950 TTACCAGCTTTGATTCTGCTGGG + Intronic
1073545718 10:104347117-104347139 TTACCTGCCTTGAATTTTATTGG - Intergenic
1074061760 10:109972849-109972871 TTTCCAGCTTTGCATTGGGTTGG - Intergenic
1075319650 10:121480447-121480469 TTACCGGTTTTCATTTTGCTGGG - Intronic
1077471675 11:2765370-2765392 TTGCCTGCTTTGAAATTTGTTGG + Intronic
1081016219 11:37884639-37884661 TTTCCACCTGTGAATTTGGTGGG + Intergenic
1081356551 11:42121226-42121248 TTACCGGATTCGAAATTGGTGGG - Intergenic
1085870675 11:80346152-80346174 TTCAGGGCATTGAATTTGGTTGG + Intergenic
1088577643 11:111287167-111287189 TTAAAGGGTATGAATTTGGTTGG - Intergenic
1092841428 12:12545881-12545903 TTACCGGCTTTGAATTTGGTGGG - Intronic
1097637940 12:62145127-62145149 AGACAAGCTTTGAATTTGGTAGG - Intronic
1098071824 12:66684143-66684165 TTAGCCACTTTGTATTTGGTAGG + Intronic
1099594235 12:84637961-84637983 TTATTGGCTTTGAAGCTGGTGGG + Intergenic
1099895708 12:88643870-88643892 TTACTGGATTTGGATTGGGTTGG - Intergenic
1101068515 12:101048215-101048237 TTACAGGCTTTGTTTTGGGTAGG - Intronic
1104639474 12:130458205-130458227 TTATAGGCTTTGGATTTGTTAGG - Intronic
1108920263 13:55664512-55664534 GTAACTGCTTTGATTTTGGTGGG - Intergenic
1109626772 13:64984139-64984161 TGACCTCCTTTTAATTTGGTGGG - Intergenic
1111398298 13:87697423-87697445 TTACCTGCCTTGAATTTCTTTGG + Intergenic
1113096434 13:106668886-106668908 TCAGCTGCTTTGAATTTGCTTGG - Intergenic
1116187903 14:41622033-41622055 TTACCATCTCTGAACTTGGTTGG + Intronic
1117126678 14:52635493-52635515 ATACCGGCTTTGATTTTCATAGG - Exonic
1121965443 14:98299398-98299420 TTCCCGGCTGGGAATTTGGGTGG - Intergenic
1124060863 15:26292742-26292764 TTTCAGTGTTTGAATTTGGTGGG - Intergenic
1124671885 15:31648086-31648108 TTACCTGACTTGAATTTGTTTGG + Intronic
1125785912 15:42317888-42317910 TTACTGTCTTTGAACATGGTGGG - Intronic
1129259201 15:74354667-74354689 TTACCGGGTTTAAAATTGGTGGG - Intronic
1130052733 15:80497346-80497368 TTGCTGGCTTTGAAGTTGGAGGG + Intronic
1130202421 15:81844292-81844314 TTACTGTCTTTGTATTTGGGTGG - Intergenic
1132277787 15:100584407-100584429 TTACTGGCATTCACTTTGGTTGG - Intronic
1142913838 17:3117389-3117411 TTACCGTTATTGAATTTAGTAGG + Intergenic
1146606786 17:34266659-34266681 TTACCAGGTGTGAATTTGATAGG - Intergenic
1151209456 17:72533522-72533544 CTACCGGCTGTGGATTTGGTGGG - Intergenic
1157659660 18:49429112-49429134 TTGCTGGCTTTGAAGATGGTAGG - Intronic
1161661454 19:5549144-5549166 TTACCGGATTTGAAATTGGTGGG - Intergenic
1161725584 19:5926660-5926682 ACAGCTGCTTTGAATTTGGTGGG - Intronic
926687208 2:15707331-15707353 TTACTGGCTTTGAAGGTGGAGGG + Intronic
928900279 2:36310144-36310166 TTTCCTGCTTTCCATTTGGTTGG - Intergenic
937732196 2:125246668-125246690 TTACTGGCTTTGAAGATGGTGGG - Intergenic
939579584 2:143931943-143931965 TTACCATCTTTGTATTGGGTGGG - Intergenic
940480945 2:154230076-154230098 TTTCTGGCTTTGAACTTGGGTGG + Intronic
941083468 2:161089288-161089310 ATTCTGGCTTTGAATTTGGGAGG - Intergenic
941864768 2:170323206-170323228 TTACCAGCTGTGACTTTGGAGGG + Intronic
942284444 2:174400770-174400792 TTACCAACTTCGAATTTGATAGG + Intronic
943868611 2:192962279-192962301 TTTCCGTTTTTGACTTTGGTGGG + Intergenic
944971941 2:205003113-205003135 TTGCCGGCTTTGAAGATGGAAGG - Intronic
945696276 2:213109204-213109226 TTACTTGCTGAGAATTTGGTAGG - Intronic
946645212 2:221826008-221826030 TTACTGGCTTGGAATCTGGAAGG - Intergenic
947374825 2:229484956-229484978 ACAACGGCTTTGAATTTGCTAGG - Intronic
1169546812 20:6658860-6658882 TTCCTGTCTTTGAATCTGGTTGG - Intergenic
1169771824 20:9209575-9209597 TGACTGGCTTTGAAGATGGTGGG + Intronic
1171751954 20:29060266-29060288 TTACTGGCTTTGAAGATGGAGGG + Intergenic
1177233536 21:18355280-18355302 TGGCTGGCTTTGAATGTGGTTGG + Intronic
1177878801 21:26668494-26668516 TTAGCTTCTTTGCATTTGGTTGG + Intergenic
1178721002 21:35008802-35008824 TTACAGACTTTGAATAAGGTAGG + Intronic
1180391081 22:12282727-12282749 TTACTGGCTTTGAAGATGGAGGG - Intergenic
1180408660 22:12582026-12582048 TTACTGGCTTTGAAGATGGAGGG + Intergenic
1180556222 22:16578768-16578790 TTAGCAGTTTTGAATTTGTTAGG + Intergenic
1181592032 22:23891388-23891410 TTACCGGCTTTGAAGATGAAGGG - Intronic
1183861599 22:40674187-40674209 TCACCTCCTTTGATTTTGGTGGG + Intergenic
959149087 3:102587034-102587056 TTAGCTGCTTTCAATTTGTTTGG - Intergenic
963756972 3:149244770-149244792 TTCCTGGCATTGAAGTTGGTTGG + Intergenic
965818061 3:172657199-172657221 TCATAGGCTTTGAATTTAGTAGG - Intronic
966369976 3:179240763-179240785 TTAGCAGTTTTGAATTTGTTAGG + Intronic
974144281 4:57927036-57927058 TTAACGGCTTTGTGTTTTGTTGG + Intergenic
979060825 4:116058784-116058806 TAACAGGCTTTGAATTTGCGTGG - Intergenic
981661770 4:147175635-147175657 TTGCTGGCTTTGAAGATGGTGGG + Intergenic
981814536 4:148815505-148815527 TTACAGCATATGAATTTGGTGGG - Intergenic
984423539 4:179554701-179554723 TTGCTGGCTTTGAAGATGGTGGG + Intergenic
985219160 4:187684322-187684344 TTAAAGGCATTGAATTTGCTTGG + Intergenic
986058495 5:4163551-4163573 TCCCCGACTTTGAGTTTGGTTGG - Intergenic
989249054 5:39286273-39286295 TTACAGGCTTAGTTTTTGGTGGG - Intronic
990940498 5:61198654-61198676 TTATCTGCTTTCCATTTGGTTGG + Intergenic
993071541 5:83170613-83170635 TTGCTGGCTTTGAATATGGAGGG - Intronic
995638142 5:114219372-114219394 TTACCGTCCTTCAATTTGTTTGG - Intergenic
996295913 5:121916389-121916411 TTTGAGGCTTTGAATTTGGATGG - Intergenic
1000962902 5:167621405-167621427 TTAGCGTCTTTGAATTTGACAGG - Intronic
1006256963 6:32839520-32839542 GTACAGACTTTGAATTTAGTAGG + Intergenic
1016380611 6:143474626-143474648 TTACAGGTTTTTATTTTGGTGGG + Intronic
1017040535 6:150305021-150305043 TTACTTGCTTTGTATTTGGAGGG + Intergenic
1020016173 7:4833464-4833486 TTCCCGGCTTGGGATTTGATGGG - Intronic
1023023699 7:36033029-36033051 TTTCTGGCTTTCAATTTTGTAGG - Intergenic
1023072381 7:36448743-36448765 TTACTGTCATTGAATTTGTTTGG + Intronic
1024945433 7:54803307-54803329 TTTCGGTCTCTGAATTTGGTTGG - Intergenic
1035000712 7:155610302-155610324 TTTCCGGGTATGAATTTGGGAGG + Intergenic
1042427748 8:68668780-68668802 TTACTGGCTTTGAAGATGGAGGG + Intronic
1051419813 9:16877818-16877840 TTACAGGCTTTGAAGATGGAAGG - Intergenic
1053326028 9:37152164-37152186 TAACTTGCTTTGAATTAGGTAGG + Intronic
1058728052 9:107822386-107822408 TTATCAGCTTTGAACTTTGTGGG + Intergenic
1059936866 9:119320540-119320562 TGACCTGCTTTGATTTTGTTCGG - Intronic
1062081770 9:134627905-134627927 TTCCCCGCTTTGAAGCTGGTGGG - Intergenic
1203451716 Un_GL000219v1:123225-123247 TTACTGGCTTTGAAGATGGAGGG - Intergenic
1186449684 X:9661755-9661777 TTACCCGCTGTGAACTTGCTGGG - Intronic
1189729622 X:44005338-44005360 TTACTGGCTTTGAAAATGGAAGG - Intergenic
1190105830 X:47560798-47560820 TTACCATCTTTGAAATGGGTTGG - Intergenic
1192122297 X:68467896-68467918 TTTCCGGTTTTGGATTTGTTGGG - Intergenic
1194336790 X:92658080-92658102 ATACTGACTTTGAATTTGGGTGG + Intergenic
1195870714 X:109482399-109482421 TCACCTGCTTTGAATTTTGCAGG - Intergenic
1199108596 X:143902643-143902665 TTTCCTGCTTTGAATATTGTAGG - Intergenic
1200131536 X:153850848-153850870 TTTCCGGCACTGAATATGGTAGG + Intergenic
1200645223 Y:5774820-5774842 ATACTGACTTTGAATTTGGGTGG + Intergenic
1202025615 Y:20519682-20519704 TTACCGGCATCTTATTTGGTGGG - Intergenic