ID: 1092847075

View in Genome Browser
Species Human (GRCh38)
Location 12:12593725-12593747
Sequence CTGTTTGTACAGAGTCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092847075_1092847076 2 Left 1092847075 12:12593725-12593747 CCATCATGACTCTGTACAAACAG No data
Right 1092847076 12:12593750-12593772 CATACAATTAAATTTTTCACTGG No data
1092847075_1092847077 24 Left 1092847075 12:12593725-12593747 CCATCATGACTCTGTACAAACAG No data
Right 1092847077 12:12593772-12593794 GAACTTGAGTATTGATCATCTGG No data
1092847075_1092847078 25 Left 1092847075 12:12593725-12593747 CCATCATGACTCTGTACAAACAG No data
Right 1092847078 12:12593773-12593795 AACTTGAGTATTGATCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092847075 Original CRISPR CTGTTTGTACAGAGTCATGA TGG (reversed) Intergenic
No off target data available for this crispr