ID: 1092851804

View in Genome Browser
Species Human (GRCh38)
Location 12:12635762-12635784
Sequence TCTCGCTTGCTGAAGGTGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092851800_1092851804 25 Left 1092851800 12:12635714-12635736 CCATATTCACTTTTCTGTACACA 0: 1
1: 1
2: 3
3: 26
4: 327
Right 1092851804 12:12635762-12635784 TCTCGCTTGCTGAAGGTGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092851804 Original CRISPR TCTCGCTTGCTGAAGGTGGT TGG Exonic
904920625 1:34005177-34005199 TCTCCCTAGCTGAATGTGCTTGG - Intronic
909938797 1:81586800-81586822 TCTCCCTCTTTGAAGGTGGTAGG - Intronic
918038268 1:180896334-180896356 CCTGGCTGGCTGAAGTTGGTGGG - Intergenic
919912612 1:202121135-202121157 TCTGGGCTGGTGAAGGTGGTAGG + Intergenic
921698375 1:218238623-218238645 TTTTGCTTGGTGAAGATGGTAGG + Intergenic
1065411331 10:25432298-25432320 TCTCTGTTGGTGAAGGTGTTAGG + Intronic
1065704486 10:28459689-28459711 TCTCTCTTGGTGAAGGGGGAAGG - Intergenic
1068131914 10:52905724-52905746 TCTCACTTGATCAGGGTGGTTGG + Intergenic
1069350650 10:67522458-67522480 TCTTTCTTGCTGAAGTTTGTTGG - Intronic
1069897301 10:71687662-71687684 GCGGGCTTGCTGAAGGTGGGAGG - Intronic
1073522873 10:104150890-104150912 TCTGGTTTCCTGAGGGTGGTGGG - Intronic
1080507559 11:32931835-32931857 TTTCTATTGCTGAAGGTGGTGGG - Exonic
1081624015 11:44635904-44635926 TGTGGCTTGCTCAAGGTGGAGGG + Intergenic
1084319657 11:68366254-68366276 CCCAGCTTGCAGAAGGTGGTGGG + Intronic
1087590319 11:100178894-100178916 CGTCACTTGCTGAAGGTGCTGGG + Intronic
1091711262 12:2742192-2742214 GCTCGCTTTCTGGATGTGGTCGG + Intergenic
1092851804 12:12635762-12635784 TCTCGCTTGCTGAAGGTGGTTGG + Exonic
1094650356 12:32369996-32370018 GCCCTGTTGCTGAAGGTGGTGGG - Intronic
1099094017 12:78350629-78350651 TCTCACATGCTGAAAGTGCTTGG + Intergenic
1103618776 12:122172997-122173019 TCTCACGTGCTCAGGGTGGTGGG + Intronic
1104138921 12:125967986-125968008 TCTGGCTTGCCGCAGGTGGTTGG + Intergenic
1111585106 13:90273385-90273407 TCTGGGTTGCTGCAGGTAGTAGG + Intergenic
1114080509 14:19198944-19198966 TCTCACTTGCTGCAAGTGCTTGG - Intergenic
1122255170 14:100471136-100471158 TCTCTGCTGCTGAGGGTGGTTGG + Intronic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1132709868 16:1261672-1261694 ACTCGCCTGCTGCAGGCGGTAGG + Intergenic
1134382358 16:13739792-13739814 TGACGTGTGCTGAAGGTGGTTGG - Intergenic
1138011679 16:53386587-53386609 CCTCCTTAGCTGAAGGTGGTGGG + Intergenic
1147450348 17:40500416-40500438 TCTTTCTTGCTGTAAGTGGTGGG + Intronic
1147762611 17:42809350-42809372 TCTCTATTTCTGAAGGTTGTGGG + Exonic
1148454887 17:47805878-47805900 TCGCTGTTGCTGCAGGTGGTGGG + Intergenic
1148652232 17:49258578-49258600 TCCCACTTCCTGAAGCTGGTGGG - Intergenic
1149544619 17:57494211-57494233 TCTCCCTTACTGCAGATGGTGGG - Intronic
1150723977 17:67636666-67636688 TCTGGCCTGTTGAAGGTGATGGG - Intronic
1156579686 18:38360366-38360388 TCTAGGTTGCTGAAGCTGGAAGG - Intergenic
1160096146 18:75875557-75875579 TCTAACTGGCAGAAGGTGGTGGG - Intergenic
1160827629 19:1088218-1088240 TCTCGGTTGTTGTAGGAGGTTGG - Exonic
1164964497 19:32470416-32470438 GGTAGCATGCTGAAGGTGGTGGG + Intronic
1165098907 19:33426781-33426803 CCTCGCTTCCTGCAGGTGCTGGG - Intronic
1167386123 19:49165097-49165119 TCTTGCTTTCTAAAGGTGATTGG - Intronic
1168288255 19:55345104-55345126 TCTCGTGTGCTCAAGGTGGCTGG - Intronic
927758008 2:25724116-25724138 TCTCCCTTGCCGAAGCTGGACGG - Intergenic
932633266 2:73365215-73365237 TCTGGCTTGTTGAAGCTGCTTGG + Intergenic
937755687 2:125535453-125535475 TCTTGCTTGCTAAAGCTGATAGG + Intergenic
938276055 2:130024307-130024329 TCTTTCTTGCTGAAGTTGTTGGG + Intergenic
938327013 2:130415054-130415076 TCTTTCTTGCTGAAGTTGCTGGG + Intergenic
938362929 2:130706422-130706444 TCTTTCTTGCTGAAGTTGCTGGG - Intergenic
938439315 2:131313048-131313070 TCTTTCTTGCTGAAGTTGCTGGG - Intronic
939640848 2:144638521-144638543 TCTGGGATGCTCAAGGTGGTGGG - Intergenic
945795666 2:214360066-214360088 TGTAGCTGACTGAAGGTGGTAGG - Intronic
948271038 2:236673498-236673520 TCCATCTTGCAGAAGGTGGTGGG - Intergenic
1173179038 20:40788011-40788033 TCCCACTTTCTGAAGGTGATTGG - Intergenic
1174676914 20:52366907-52366929 TCTCGCTGGCTTTAGGAGGTTGG + Intergenic
1180500270 22:15923740-15923762 TCTCACTTGCTGCAAGTGCTTGG + Intergenic
1181805752 22:25373613-25373635 CCCAGCTTGCAGAAGGTGGTGGG - Intronic
949242177 3:1886371-1886393 TCTCTCTTGCTCAAGGAGGCTGG + Intergenic
963851055 3:150210870-150210892 TCCCACTTGCTGCAGGTGGGGGG - Intergenic
969514172 4:7637353-7637375 TCTCCTCTGCTGAAGGTAGTGGG + Intronic
982874863 4:160634634-160634656 TCTCGACTGCAGAAGGAGGTGGG + Intergenic
984140114 4:175994671-175994693 TGGTGGTTGCTGAAGGTGGTTGG + Intronic
986039720 5:3980846-3980868 TTTGGCTTGCAGATGGTGGTTGG + Intergenic
989309368 5:39996607-39996629 TCTCGGTAGTTGAAGGGGGTGGG - Intergenic
990128196 5:52545240-52545262 TCTGGCTTAATGAAGGTAGTGGG + Intergenic
996324620 5:122258735-122258757 TGCTGATTGCTGAAGGTGGTTGG - Intergenic
997305589 5:132833655-132833677 TCTCCCTTAGTGATGGTGGTTGG + Intergenic
999368852 5:151040586-151040608 TCTCCCTTGCTCACAGTGGTAGG - Intronic
1007716412 6:43858684-43858706 TCCCTCTTGCATAAGGTGGTAGG - Intergenic
1007886445 6:45235827-45235849 ACTCCCATGCTGAAGGTTGTGGG + Intronic
1007932982 6:45708962-45708984 TCACTCTGGCTGAAGGTGGGGGG + Intergenic
1009631245 6:66203294-66203316 TCTCCCTTGTTGCAGGAGGTAGG - Intergenic
1009812559 6:68687980-68688002 TCTCTCTTTCTGAATGTGTTTGG - Intronic
1009969641 6:70613327-70613349 TCTGACTAGCTGAGGGTGGTAGG + Intergenic
1018919738 6:168163256-168163278 GCTCGCTGGCTGACGGTGGGAGG + Intergenic
1021571163 7:22066650-22066672 CCACGCATGCTGTAGGTGGTTGG + Intergenic
1027725626 7:81802117-81802139 TCTCTCTCACTGAAGGTGATAGG + Intergenic
1031119275 7:117703069-117703091 TCTGCCTTGCAGAAGGTGCTTGG - Intronic
1034163566 7:149009493-149009515 TCTCCCTTCCTCAAGTTGGTGGG + Intronic
1036652320 8:10653057-10653079 TGTGGCTTGCTGGAGGTGCTGGG - Intronic
1037960246 8:23092527-23092549 TCAGGCTTGCTGAAGTCGGTGGG + Intronic
1049039210 8:140099639-140099661 TCTCCCTTGCAGAAGGCTGTGGG - Intronic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1051015076 9:12464211-12464233 TCTTGCTTGCTGGGAGTGGTGGG + Intergenic
1055681569 9:78721076-78721098 TCTCCCTTGCTGATGGGGATAGG + Intergenic
1055717337 9:79132288-79132310 TTTCTTTTGCTGAAGGTGGAAGG - Intergenic
1056117395 9:83454096-83454118 TCTAGCTTGCTAAATATGGTGGG + Intronic
1057647336 9:96889173-96889195 TTTCGCTTGGTGAAGGGAGTGGG - Intergenic
1059795091 9:117685689-117685711 TCTCGTTTTCTGAAGCTGATAGG + Intergenic
1185751617 X:2614726-2614748 TCTGCCTTGCTGAAGGTGTTGGG + Intergenic
1189326797 X:40117329-40117351 TCTCGATTGGTGGAGGTGGTGGG - Intronic
1190756645 X:53407266-53407288 TCTCCCCTCCTGAAGGTTGTAGG - Intronic
1190771495 X:53518489-53518511 TTTCCCTTGCTGAAGGTGACAGG - Intergenic
1196459813 X:115918385-115918407 TTTCCCTTTCTGAAGGTGGACGG + Intergenic
1196472194 X:116041038-116041060 ACGCCCTTGCTGAAGGTTGTGGG + Intergenic
1199528514 X:148821139-148821161 TCTCCCTTGCTGAATGTTTTTGG + Intronic
1199940095 X:152617499-152617521 TCTCAGTTTCTGAAAGTGGTGGG - Intergenic