ID: 1092860498

View in Genome Browser
Species Human (GRCh38)
Location 12:12716130-12716152
Sequence TGTGGGCTTGAGCACCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092860498_1092860503 7 Left 1092860498 12:12716130-12716152 CCACCACGGTGCTCAAGCCCACA 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1092860503 12:12716160-12716182 AGAAATTTCCAGCTGCAAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 346
1092860498_1092860505 23 Left 1092860498 12:12716130-12716152 CCACCACGGTGCTCAAGCCCACA 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1092860505 12:12716176-12716198 AAAAGGGAGAAGAGAAACGCTGG 0: 1
1: 0
2: 2
3: 64
4: 671
1092860498_1092860502 6 Left 1092860498 12:12716130-12716152 CCACCACGGTGCTCAAGCCCACA 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1092860502 12:12716159-12716181 GAGAAATTTCCAGCTGCAAAAGG 0: 1
1: 0
2: 3
3: 32
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092860498 Original CRISPR TGTGGGCTTGAGCACCGTGG TGG (reversed) Intronic
901057681 1:6456304-6456326 TGTGGCCTTGAGCAGCCCGGAGG + Intronic
901680923 1:10912424-10912446 TGTGGCCATCAGCACCGTAGAGG - Intergenic
902476672 1:16692151-16692173 TGTGGCCTTGAGCAGCCCGGAGG - Intergenic
903007166 1:20306337-20306359 TGGGGGCTTGAGGGACGTGGGGG + Intronic
904401082 1:30257152-30257174 TGTGAGCTTGGGCACCAAGGGGG - Intergenic
907164317 1:52396961-52396983 TCTGGGCAGGAGCACAGTGGTGG - Intronic
907740809 1:57163812-57163834 TTTTGGCTTGAGCACCTTAGTGG + Intronic
907788503 1:57637442-57637464 TCTGGGTTTGAGCAGAGTGGTGG + Intronic
909315222 1:74208922-74208944 TCTGGACTTGAGCACCTTGGCGG + Intronic
912453965 1:109785607-109785629 TGTGGGGTTGAGGGCTGTGGTGG + Intergenic
913539573 1:119805868-119805890 TGTGGCCGTGAGCTCCTTGGTGG + Intronic
917464301 1:175261728-175261750 TTGGAGCTTGAGCACCGTGCTGG + Intergenic
917800207 1:178563128-178563150 TGAGGCCTTGAGCCCAGTGGAGG + Intergenic
919627548 1:199926404-199926426 TGTGGGATTAAGCACCAAGGTGG + Intergenic
924570887 1:245236778-245236800 TGTGGCCGTGAGCCCCGTGGGGG + Intronic
1064173947 10:13057836-13057858 TCTGGGCTGGAGTACCATGGCGG - Intronic
1068287794 10:54962346-54962368 TGTGGGCCAGAGCAGGGTGGTGG + Intronic
1071592400 10:86887196-86887218 TGTGGCCTTGAGAAACTTGGTGG - Intronic
1076366948 10:129927250-129927272 CGTGGGCTTGGTCCCCGTGGTGG + Intronic
1077324365 11:1957334-1957356 GGTGGGCTTGAGCATCCTGTTGG + Intronic
1078390706 11:10933140-10933162 TGTGGGCTTAATAACAGTGGTGG + Intergenic
1081864321 11:46351336-46351358 TGTGACTTTGAGCACCGTGAAGG - Intronic
1083653813 11:64219601-64219623 TGTGGCCCTGAGCAACCTGGAGG + Exonic
1083953054 11:65967383-65967405 GGTGGGCTTGGACACGGTGGTGG + Exonic
1084087638 11:66861887-66861909 GGTGGGCTTCTGCACCCTGGAGG - Intronic
1085509362 11:77080309-77080331 TGTGGCTTTGAGGCCCGTGGTGG + Intronic
1086437110 11:86792323-86792345 AGTGAGCATGAGCACCTTGGAGG - Intronic
1088125184 11:106415774-106415796 TGTGAGCAGGAGCACTGTGGGGG + Intergenic
1089065541 11:115659517-115659539 TGTGGGCTGTAGCACAGAGGGGG + Intergenic
1089443381 11:118533493-118533515 CGTGGGGTTCAGCACCTTGGTGG + Exonic
1091369468 11:135046589-135046611 TGTGGGATGGAGCTCCGTGTGGG - Intergenic
1202807346 11_KI270721v1_random:12511-12533 GGTGGGCTTGAGCATCCTGTTGG + Intergenic
1092860498 12:12716130-12716152 TGTGGGCTTGAGCACCGTGGTGG - Intronic
1096614089 12:52821946-52821968 TGTGGGCTATAGCACCGTCAAGG - Exonic
1104915744 12:132263567-132263589 TGTGCGCTTGAGGACGGTGAGGG - Intronic
1106152358 13:27117866-27117888 TGTGGCCCTGAGCACCATGGTGG + Intronic
1111335754 13:86820103-86820125 TGTGGGCCTGATCATTGTGGAGG - Intergenic
1117882647 14:60327614-60327636 TGTGGGCTTGGGCCCCGGGCAGG - Intergenic
1118465348 14:66025514-66025536 TGTGGGCTGGAGCAGAGTGCTGG + Intergenic
1119720697 14:76888283-76888305 AGTGGGCATGACCAACGTGGTGG - Intergenic
1120911154 14:89668153-89668175 TGTTGGCTTCAGCATCGGGGTGG - Intergenic
1122900966 14:104782200-104782222 GGTGGGCGTGAGCAGCGGGGTGG - Intronic
1130145827 15:81273092-81273114 TCTGGGCTTCAGCATCGTTGGGG + Exonic
1131512412 15:93056606-93056628 TGTAGGCTTCAGGACCCTGGTGG + Intronic
1132044568 15:98552428-98552450 TGTGGCCCTGAGCACCATCGTGG + Intergenic
1132700320 16:1219489-1219511 TGTGGGCATGGGTCCCGTGGTGG + Intronic
1141283421 16:82649538-82649560 AGTGGGCTTAAGCAGCATGGGGG + Intronic
1144828369 17:18119027-18119049 CGTGGACTTGAGCACGGTGCGGG - Exonic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149555225 17:57568837-57568859 AGGGGGCTGGAGCACTGTGGTGG + Intronic
1149657646 17:58318786-58318808 TGTGGCCTTGTGCAGAGTGGGGG - Intronic
1150648253 17:66993167-66993189 TGTGGGCCTGAGGCCTGTGGTGG + Intronic
1152106083 17:78329840-78329862 TGTGGGCATGTGCACAGTGCTGG + Intergenic
1152229145 17:79106022-79106044 TGTAGGCTTCAGCCCCGTGGTGG - Intronic
1154121528 18:11656294-11656316 AGTGGGCCTGAGCCCCTTGGGGG - Intergenic
1155585519 18:27359533-27359555 TGAGGGCTTGACCAGCGGGGTGG + Intergenic
1157319658 18:46624377-46624399 TGTGGGCTTGAGTAGTGAGGGGG - Intronic
1159355906 18:67337344-67337366 TGTGGGCTGGAGCAGAGTGGTGG - Intergenic
1160529029 18:79552867-79552889 TGTGAGCTTGGGCAACGCGGCGG + Intergenic
1160707378 19:535934-535956 TGAGGACTTGAGGCCCGTGGGGG - Intronic
1161007012 19:1941874-1941896 GGTGGGCTTGAGCACTGGGTGGG - Intronic
1161821124 19:6531774-6531796 TGAGGGGTTGAGGACTGTGGGGG - Intronic
1165063962 19:33218564-33218586 TGCGGGCTTGGGCACGGAGGAGG + Intronic
1168262120 19:55201453-55201475 GGTAGGCATTAGCACCGTGGAGG + Intronic
1202710693 1_KI270714v1_random:17992-18014 TGTGGCCTTGAGCAGCCCGGAGG - Intergenic
926701440 2:15806802-15806824 TGTGCTCTTGAGCACAGAGGAGG + Intergenic
934574468 2:95391452-95391474 TGTGGCCTTGGGCACCATGAGGG + Intergenic
935739938 2:106138541-106138563 CCTGGGCCAGAGCACCGTGGAGG - Intronic
940254915 2:151718480-151718502 TGTGGGCTTAAGGACAGTGTTGG - Intronic
941560740 2:167040923-167040945 TGTGGGCATGGACAGCGTGGTGG - Intronic
944397840 2:199289740-199289762 TGTTGGCTGGAGCAACCTGGGGG - Intronic
946399267 2:219460161-219460183 TGTGGGCTTAGGCCCTGTGGTGG + Intronic
947912181 2:233808690-233808712 TGAGGGTGTGAGCACCGTGAGGG + Intronic
948673303 2:239582217-239582239 TGTTGGCTTGATCACCAAGGAGG + Intronic
948712631 2:239834414-239834436 TGTGGGGTTCAGCACCCAGGCGG - Intergenic
1170991279 20:21303638-21303660 TGTGGGATTCAGCACCCCGGGGG + Intronic
1176042736 20:63073773-63073795 GGTGGCCTTGTGCACCCTGGGGG + Intergenic
1176043845 20:63082449-63082471 TCTGGGCTTCAGCACCAGGGAGG + Intergenic
1176077562 20:63255161-63255183 TGAGGCCTTGTGCACGGTGGAGG + Intronic
1176207243 20:63895559-63895581 CGGGGGTCTGAGCACCGTGGTGG + Intronic
1180163020 21:46006521-46006543 TGTGGGCCTCAGCGCCGTGAGGG - Intergenic
1181065389 22:20303344-20303366 TGAGGGGGTGGGCACCGTGGGGG + Intergenic
1181910094 22:26231770-26231792 TGGGGGCTTCTGCATCGTGGGGG - Intronic
1182353788 22:29713118-29713140 TGTGGGCTTGGGCACTGGTGAGG + Intergenic
1185231317 22:49685848-49685870 CCTGGGCTTCAGCACCGTGCTGG - Intergenic
953410542 3:42688317-42688339 GGTGGGGCTGAGCTCCGTGGGGG + Intronic
953761186 3:45688609-45688631 TGGGGGCTTCTGCTCCGTGGCGG + Intergenic
955331227 3:58049352-58049374 TGTGGCCTTGGGCACTGGGGTGG + Intronic
955384921 3:58471755-58471777 TGTGGGCTTGGGCACCAACGAGG - Intergenic
961432002 3:126890084-126890106 AGTGAGCTGGAGCACCTTGGGGG - Intronic
962497758 3:135959589-135959611 TGTGGGCTGGAGCAGCATAGTGG - Intergenic
963765896 3:149335721-149335743 TATTGGGTTGAGCAACGTGGAGG + Intergenic
964929083 3:161993793-161993815 TTTTGGATTGAGCACAGTGGTGG + Intergenic
964991541 3:162818821-162818843 TGTGGTCTTGAGCAAGATGGGGG - Intergenic
966549236 3:181185429-181185451 TGTGGGCTTTTGCAACATGGAGG + Intergenic
972705079 4:41534432-41534454 TTTGGACTTGAGCAGTGTGGAGG + Intronic
983559248 4:169084632-169084654 TGGCTGCTTGAGCACCCTGGGGG + Intergenic
983663375 4:170154808-170154830 TGTGGGCTAGCTCACAGTGGTGG + Intergenic
984204487 4:176769445-176769467 TGTTGGCTTTAGCAACATGGAGG + Intronic
985572906 5:659749-659771 TGTGAGCTTCAGCCCAGTGGAGG + Intronic
986289568 5:6388929-6388951 TGTGGTCATGAGCTCCTTGGTGG - Intergenic
994787860 5:104187167-104187189 TTTGGGCTGGAGCACCCAGGTGG - Intergenic
1000184398 5:158844961-158844983 TTTGGTCTTGAGTACCGTGCTGG - Intronic
1000822144 5:165997868-165997890 TATTGGCTGGAACACCGTGGTGG + Intergenic
1001691508 5:173636105-173636127 TGTGGTCTGCAGAACCGTGGAGG + Intergenic
1002449458 5:179310602-179310624 TGTGGCCTGGAGCAGCCTGGGGG + Intronic
1003575349 6:7288512-7288534 TGTGGGCATGAGCATAGGGGAGG + Exonic
1007357835 6:41333829-41333851 TGGGGCCTTGAGCACCCTAGGGG - Intergenic
1007573153 6:42907692-42907714 TGTTGGCCTGAGCACCTGGGAGG + Intergenic
1007665765 6:43512203-43512225 TGTGGCGTTGAGGACGGTGGTGG + Exonic
1007715191 6:43851624-43851646 TGTGTGCTTGAGAGCAGTGGGGG + Intergenic
1012238029 6:96839853-96839875 TGTGGGCTTGAGGTACATGGAGG - Intergenic
1019473475 7:1233211-1233233 CGTGGGGTTGACCACCGAGGCGG - Exonic
1020639735 7:10740860-10740882 TGTGGGTTTGAGCAGCTTGTAGG - Intergenic
1021354952 7:19642742-19642764 TGTGGTCTTGGGTACAGTGGTGG - Intergenic
1025035370 7:55590107-55590129 TGAGGGCCTGGGCACCCTGGCGG - Intergenic
1026439951 7:70435467-70435489 TGTGTGATTGAGCACCTTGCTGG + Intronic
1026621639 7:71954687-71954709 TGTGGGATTTAGCAACATGGTGG + Intronic
1027232755 7:76282007-76282029 TGGGGGGTTGAGATCCGTGGGGG - Intronic
1028658308 7:93236221-93236243 TTTTGGATTGAGCAGCGTGGAGG + Intronic
1029191780 7:98777113-98777135 TGTTTCCTCGAGCACCGTGGTGG - Intergenic
1034169752 7:149053898-149053920 TTTGGGATTCAGCACCATGGCGG + Intergenic
1035055765 7:156035064-156035086 TGCAGGCTGGTGCACCGTGGAGG - Intergenic
1035055802 7:156035343-156035365 TGCAGGCTGGTGCACCGTGGAGG - Intergenic
1035239879 7:157522598-157522620 TGTGGGCGTGTGCACTGTGTGGG + Intergenic
1036550674 8:9812762-9812784 TTTGGGCTTGAACAACTTGGAGG + Intergenic
1047083490 8:121491293-121491315 TGTGTGCTAGAGAACAGTGGCGG - Intergenic
1049047820 8:140166448-140166470 TGGGAGCTTGAGCTCCCTGGAGG - Intronic
1049364815 8:142232090-142232112 CGTGGCCTTGAGCACAGTGCTGG + Intronic
1059455887 9:114399922-114399944 TCTGGGTTTGAGCAGCATGGCGG + Intergenic
1060972534 9:127746893-127746915 TGTGGGCTGGAGTGCAGTGGTGG - Intronic
1061139298 9:128754611-128754633 TGTGGGCCTGAGGACAGAGGTGG - Intronic
1061841303 9:133359889-133359911 TGTGGCCCAGAGGACCGTGGGGG + Intronic
1062624864 9:137438169-137438191 TGTGGGCAGGAGCACGCTGGTGG + Exonic
1186900523 X:14050562-14050584 TGCGGGCTTTTGCACCGTGCTGG + Intergenic
1187364220 X:18653330-18653352 TGTGGCCTTCTGCTCCGTGGGGG + Intronic
1188169913 X:26911708-26911730 TGTGGTGTTGAGCACCATGTGGG + Intergenic
1190376791 X:49796177-49796199 TGAGGTCTTGAGCTCCTTGGGGG + Intergenic
1190452340 X:50594578-50594600 TGTGGGCTAGAGCACCTTTTTGG - Exonic
1192427417 X:71089756-71089778 TGTGGGGCTGGGCACGGTGGTGG + Intergenic
1197684996 X:129429501-129429523 TGTGGCATTGAGCACTGAGGGGG - Intergenic
1198371328 X:135992164-135992186 AGTTGGCCTGAGCACCGAGGGGG - Intronic
1199855431 X:151755549-151755571 TGTGGGATTGAGGGGCGTGGAGG + Intergenic
1200117085 X:153774123-153774145 AGGCGGCCTGAGCACCGTGGCGG - Intronic