ID: 1092864708

View in Genome Browser
Species Human (GRCh38)
Location 12:12750053-12750075
Sequence TTATTATGCTTTGTCTCTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 217}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092864708_1092864712 -2 Left 1092864708 12:12750053-12750075 CCGGTAGAGACAAAGCATAATAA 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1092864712 12:12750074-12750096 AAGAAATTGGGAAAGATGGCCGG 0: 1
1: 0
2: 2
3: 56
4: 576
1092864708_1092864711 -6 Left 1092864708 12:12750053-12750075 CCGGTAGAGACAAAGCATAATAA 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1092864711 12:12750070-12750092 TAATAAGAAATTGGGAAAGATGG 0: 1
1: 0
2: 6
3: 46
4: 619
1092864708_1092864715 7 Left 1092864708 12:12750053-12750075 CCGGTAGAGACAAAGCATAATAA 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1092864715 12:12750083-12750105 GGAAAGATGGCCGGGCGCGGTGG 0: 1
1: 22
2: 267
3: 1775
4: 9038
1092864708_1092864713 -1 Left 1092864708 12:12750053-12750075 CCGGTAGAGACAAAGCATAATAA 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1092864713 12:12750075-12750097 AGAAATTGGGAAAGATGGCCGGG 0: 1
1: 0
2: 5
3: 54
4: 608
1092864708_1092864714 4 Left 1092864708 12:12750053-12750075 CCGGTAGAGACAAAGCATAATAA 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1092864714 12:12750080-12750102 TTGGGAAAGATGGCCGGGCGCGG 0: 1
1: 1
2: 5
3: 95
4: 807

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092864708 Original CRISPR TTATTATGCTTTGTCTCTAC CGG (reversed) Intronic
901379729 1:8865049-8865071 TTATTATGCAATGTCGCTGCTGG + Intronic
902989766 1:20178581-20178603 TAATTAGGTTCTGTCTCTACAGG + Intergenic
904307542 1:29599862-29599884 TGATTAGGCCTTGACTCTACAGG + Intergenic
905910597 1:41650905-41650927 TTTTTAAGCATTGTCTCTGCTGG + Intronic
906594591 1:47063681-47063703 TTATTTTGCTTTGTCTTTGATGG - Intergenic
907553928 1:55328334-55328356 TCATTCAGCTTTCTCTCTACAGG + Intergenic
907611187 1:55873025-55873047 TTATTCTTCTCTTTCTCTACAGG + Intergenic
909511744 1:76461178-76461200 TTATGATACTCTGTATCTACTGG + Intronic
911554563 1:99327931-99327953 TTATTATTTTTTGACTCTTCAGG - Intergenic
912550854 1:110484255-110484277 ATTTTATTTTTTGTCTCTACTGG + Intergenic
913358982 1:117957869-117957891 TTATTTCTCTTGGTCTCTACAGG + Intronic
916501995 1:165395285-165395307 TCATTATTCTGTGTCTCCACTGG - Intergenic
917761937 1:178170928-178170950 TTATGAAGCTTTGTCTCAGCTGG + Intronic
918671776 1:187226077-187226099 TTATTGTGCTTTTCCTGTACTGG + Intergenic
918677293 1:187303306-187303328 TTATTATAATTTGTCACTACTGG + Intergenic
920505862 1:206514726-206514748 CTTTTATGTTTTGTTTCTACTGG + Intronic
920620370 1:207540471-207540493 TTCTTATTCTTTGTCTAAACAGG + Intronic
920622152 1:207559028-207559050 TTCTTATTCTTTGTCTAAACAGG + Intronic
920623761 1:207576079-207576101 TTCTTATTCTTTGTCTAAACAGG + Intronic
920636398 1:207708661-207708683 TTCTTATTCTTTGTCTAAACAGG + Intronic
920813834 1:209312200-209312222 TAATTGTGCTCTGCCTCTACAGG + Intergenic
922713143 1:227848376-227848398 TTCTGATGCTTGGTCTCTTCAGG + Intergenic
923150289 1:231227068-231227090 TGATTATGCTTTGTGTCCGCAGG - Exonic
923184586 1:231558382-231558404 ATATTAAGCTTTGTCAGTACAGG - Intronic
923700694 1:236297713-236297735 TGATAATGCTTAGTGTCTACTGG + Intergenic
1063022397 10:2142809-2142831 TTTTTATGCTTTCTCACTATAGG + Intergenic
1063640210 10:7821919-7821941 TTATTATGCTTAATCTCACCTGG - Intronic
1068027055 10:51659214-51659236 TATTTATGCTTGTTCTCTACTGG - Intronic
1068386766 10:56339380-56339402 TTATTATGCTGTTTCAGTACAGG + Intergenic
1068747518 10:60550904-60550926 ATATTATGCAATGTCTCTTCAGG + Intronic
1069205052 10:65671250-65671272 TTTTTATGCTTTTTTTCTAGAGG - Intergenic
1073715931 10:106107425-106107447 ATATGATGCTTAGTCTCTAGTGG + Intergenic
1074245256 10:111684442-111684464 TTATTTTGCTTTGGATCCACTGG + Intergenic
1074579957 10:114709892-114709914 TTTTTATGCTTTTTCTAAACAGG + Intergenic
1075089012 10:119432713-119432735 GGATTATGCTTTATCTCTTCAGG - Intronic
1078560730 11:12369618-12369640 TTTTTTTGTTGTGTCTCTACCGG - Intergenic
1078921393 11:15834248-15834270 ATATTATGCTGATTCTCTACAGG + Intergenic
1079725783 11:23879243-23879265 ATATTATATTTTGACTCTACTGG + Intergenic
1080257049 11:30302176-30302198 TTATCATGCTCAGTCTTTACAGG + Intergenic
1080735260 11:35007853-35007875 TTATTATTGTTTGTATCTGCAGG - Intronic
1087522713 11:99262718-99262740 TTATTCTGCTTTGTTTTTAAGGG + Intronic
1087979297 11:104591220-104591242 TTATTATGCTTTGGATCTCCAGG - Intergenic
1088159070 11:106846451-106846473 TTAATATCTTTTGTCTTTACAGG + Intronic
1089153133 11:116379818-116379840 TTATTATGCTATTATTCTACAGG + Intergenic
1090446019 11:126765479-126765501 TCATAATGCTTTATCTCAACGGG + Intronic
1091085751 11:132720004-132720026 TGATTATGCCTTCTCTCTGCTGG - Intronic
1092662266 12:10751236-10751258 TTATTGTGTTTTGTTTCTACAGG + Intergenic
1092864708 12:12750053-12750075 TTATTATGCTTTGTCTCTACCGG - Intronic
1093534460 12:20207403-20207425 TTAGTCTGCTTTGTCTCTTTTGG - Intergenic
1093534654 12:20209398-20209420 TTAGTCTGCTTTGTCTCTTTTGG + Intergenic
1095207992 12:39460583-39460605 TTATTTTGTTTTGTTTTTACTGG + Intergenic
1096436427 12:51593932-51593954 TTAATATTCTTGGTCTCCACAGG + Intronic
1098790366 12:74815292-74815314 TTATTATTCTTTTACTTTACAGG + Intergenic
1098864844 12:75749962-75749984 TTTTTATTCTTTGTCTGTCCTGG + Intergenic
1099510335 12:83527943-83527965 TTATTTTGCTTTCTCCCTAGTGG - Intergenic
1099814203 12:87624005-87624027 TAATTATGCTTCCTCTCTAATGG + Intergenic
1100641917 12:96490053-96490075 TTCTTAAACTTTGTCTCTCCTGG - Intronic
1101048453 12:100835676-100835698 TCTTTATACTTTTTCTCTACAGG + Intronic
1101484619 12:105141413-105141435 TTATTTAGCTTTGCTTCTACAGG + Intronic
1104494491 12:129224156-129224178 TTATAATACTTTGTGTCTCCTGG + Intronic
1105823315 13:24099200-24099222 TTATCCTGCTTTATCTCTACAGG + Intronic
1111601040 13:90474635-90474657 TTATTATTATTTTTCTATACTGG - Intergenic
1111982790 13:95034472-95034494 TCATGAAGCTTTGTCTCTGCAGG + Intronic
1112057984 13:95708202-95708224 ATGTTATGCTTTGTCAGTACAGG - Intronic
1112657194 13:101463556-101463578 TTTTCATGCTTTTTCTCTGCTGG + Intronic
1112877098 13:104056250-104056272 TTATAATGCTTTGTATTTTCTGG + Intergenic
1117645891 14:57852339-57852361 TTATTATGTTTTGGTTTTACTGG - Intronic
1121878904 14:97481651-97481673 TTAATATGTGTTGTCTCTATTGG + Intergenic
1124466524 15:29944746-29944768 TCATTATGAATTCTCTCTACTGG + Intronic
1125243228 15:37601085-37601107 TTATTATGCTTTTGCATTACTGG + Intergenic
1125740118 15:41956878-41956900 TTAATGTGCTCTGTCTTTACTGG - Intronic
1127032906 15:54883633-54883655 TTATTAAGGTTTTTCTCTAATGG + Intergenic
1127109393 15:55651307-55651329 TTATTCTGCTTTTGTTCTACTGG - Intronic
1128388373 15:67166330-67166352 TTATTATTTGTTGTCTCTAAGGG - Intronic
1128409020 15:67374915-67374937 TTGTTTTGCTTTCTCTATACAGG + Intronic
1131171440 15:90181668-90181690 TTATTATCATTTGTCTGCACAGG - Intronic
1131637648 15:94254226-94254248 TTATTATACAGTGTCTCTTCAGG + Intronic
1134348100 16:13410319-13410341 TTATTATGCTTTAAATTTACAGG + Intergenic
1135693167 16:24561802-24561824 TTATTATGCTTGGTATCTGTAGG + Exonic
1138022711 16:53499091-53499113 TGATTTTGATTTGTCCCTACTGG + Intronic
1143886217 17:10066947-10066969 TTATTATTTTTTGTCTTCACGGG - Intronic
1146537988 17:33669835-33669857 TAATTCTGCTTTGTCTAAACAGG - Intronic
1146765795 17:35520442-35520464 TTATAAAGTTTAGTCTCTACTGG + Intronic
1149638510 17:58188678-58188700 TTATTTTGTTATGTCTCTACTGG + Intergenic
1150296668 17:64012932-64012954 TTTATATACTTTATCTCTACTGG - Intronic
1151160916 17:72165112-72165134 TTAGTATGCTCTGACTCTTCAGG + Intergenic
1153569859 18:6459089-6459111 TTATTATTCTTTTCTTCTACTGG + Intergenic
1155642996 18:28042789-28042811 TTATTATTCTTTTTCTTTGCTGG - Intronic
1156168269 18:34450360-34450382 TTATTATGCTTTGAAGCCACTGG - Intergenic
1157681888 18:49613865-49613887 TTATTAATCTTTGTATCTCCAGG - Intergenic
1157735248 18:50042494-50042516 ATATTAAACTTTGTCTATACAGG + Intronic
1159672688 18:71241490-71241512 TTGTGATCATTTGTCTCTACTGG + Intergenic
1160250354 18:77198585-77198607 TTATTATTATTTTTTTCTACTGG + Intergenic
1167176102 19:47865455-47865477 TTGTTATGCTTTTTGGCTACAGG - Intergenic
927163855 2:20297234-20297256 TTACTTTGCATTGTCTCTGCGGG + Intronic
928070537 2:28210628-28210650 TTATAATGCTTTCTCTCTGAAGG - Intronic
928788935 2:34927672-34927694 TCATTATGCTTGCTCTCTTCTGG - Intergenic
929360675 2:41085786-41085808 TTATTATTCTTTGACCCTCCAGG - Intergenic
932590247 2:73061515-73061537 TTATTATTCTCTTTGTCTACAGG - Intronic
933106232 2:78329102-78329124 TTACTATTCTTTGTCTCTTTAGG - Intergenic
933295515 2:80486400-80486422 TTATTATGGTTTCTATTTACTGG - Intronic
935261547 2:101359874-101359896 TTCTTATGAATGGTCTCTACGGG - Intronic
936134940 2:109883163-109883185 TTATAATGCTTTGGCTATTCCGG + Intergenic
936209757 2:110488322-110488344 TTATAATGCTTTGGCTATTCCGG - Intergenic
936981268 2:118267581-118267603 TTATAAGGGTCTGTCTCTACTGG - Intergenic
938136919 2:128766373-128766395 TTATTATGGTTTTTCTCTATGGG + Intergenic
938731966 2:134153643-134153665 TGATAATGCTTTGCCTTTACAGG + Intronic
939746997 2:145985380-145985402 TTATTATGCTATTTCTATAGTGG + Intergenic
940230952 2:151450893-151450915 TTTTTATGTTTTGTTTCCACTGG + Intronic
941291595 2:163682406-163682428 TTATTAAGCTTTGTCTATGCTGG + Intronic
941521123 2:166544395-166544417 TTATTAGACTTTGTCTCCAGTGG - Intergenic
945638016 2:212383602-212383624 TTGGTATGCTTTGTCTCTTGAGG - Intronic
947551493 2:231049870-231049892 TACTTATGCTTTCTCGCTACAGG - Intergenic
948664317 2:239525354-239525376 TTATTAGACTTTGTGTCTATGGG + Intergenic
1169602829 20:7281395-7281417 TTTTTATGCTCAGTCTCTAATGG + Intergenic
1169958319 20:11130794-11130816 TTATTATGCTTGGTCATCACAGG - Intergenic
1172567897 20:35945353-35945375 TTACTATGGTTTGTCATTACAGG - Intronic
1172987816 20:39007112-39007134 TTATTTTGTTTTGTTTCTTCTGG + Intronic
1176786006 21:13257246-13257268 TTATTTTGCTTTATCTTTAGAGG - Intergenic
1177984029 21:27950948-27950970 TTATTTTGCTTTATCTTTAGAGG - Intergenic
1184622114 22:45688468-45688490 TTATTATGTTTTCTCTCTGTCGG - Intronic
949094031 3:64531-64553 TTATTTCTCCTTGTCTCTACAGG + Intergenic
949201030 3:1379608-1379630 TTAGTATGCTTTTTCTGTAGAGG - Intronic
949271876 3:2226205-2226227 TTATTATGTTTTATTTCTTCAGG + Intronic
953137360 3:40192904-40192926 TTATTCTGCATTTTCTATACAGG - Intronic
953284051 3:41588688-41588710 TTATTATTATTTGTGTCTATTGG - Intronic
954168163 3:48777860-48777882 TTATTTTGCCTTGTCTATAAAGG - Intronic
957200280 3:77125703-77125725 TTATAATGCTTTTTCAATACAGG + Intronic
959671835 3:108987413-108987435 CTATTATGCTTTGGGACTACAGG - Intronic
959966578 3:112362475-112362497 TTCATATGCTTTGTCTCTGCTGG + Intronic
960126819 3:114007885-114007907 TTAGTTTACTTAGTCTCTACAGG + Intronic
961642564 3:128373839-128373861 TTTTTAAGCTTTCTCTCTAATGG - Intronic
962335787 3:134528665-134528687 TTGATGTGCTTTGTCTTTACGGG + Intronic
962939487 3:140112847-140112869 TTTTCATGCTCTGTCTCTAAAGG - Intronic
963295368 3:143540278-143540300 TTATTCTGTTTTGCCTCTGCTGG - Intronic
967688789 3:192449212-192449234 ATATTAAGCTTTGTCACTAGAGG + Intronic
967918790 3:194599158-194599180 ATCTTATGCTCTGTCTCTCCAGG + Intronic
968014888 3:195320426-195320448 TTATAATGCTTGGTCTATAGTGG - Intronic
969853517 4:9980737-9980759 CTGCTATGCTTTCTCTCTACAGG - Exonic
970500632 4:16673131-16673153 TTATTGTGCTTTTTCTTTTCAGG + Intronic
970934429 4:21552523-21552545 TTATTATGCTTTGTAATAACAGG - Intronic
971709341 4:30091756-30091778 TTTGTATGTTTTGTCTCTCCAGG + Intergenic
971836163 4:31765968-31765990 TTATTCTTCTTTGTTTTTACAGG - Intergenic
973582081 4:52354062-52354084 TTATTATTATTTGTTTCAACTGG + Intergenic
973848076 4:54933463-54933485 TTATTATTTTTTCTCTCTACTGG + Intergenic
975539101 4:75486029-75486051 TGATTCTGCTTTGTAGCTACAGG - Intronic
975609139 4:76186544-76186566 GTATCCTGCTTTGTATCTACAGG - Intronic
977843162 4:101734399-101734421 TTCTGATACTTTGTCTTTACCGG - Intronic
980019087 4:127687099-127687121 TTATTATGCTTATTATTTACTGG - Intronic
981953481 4:150441239-150441261 TTATCCTGCTTTGTCTTTAGAGG - Intronic
981992728 4:150941898-150941920 TTAGTAATATTTGTCTCTACTGG + Intronic
982897454 4:160950690-160950712 TGATGATGCTTTGCCTCTTCAGG - Intergenic
982986357 4:162212435-162212457 TTATTATGCTTTTACTGTAAAGG + Intergenic
983185825 4:164699514-164699536 TTATTCTTCTTTCTCTTTACTGG - Intergenic
984470160 4:180159395-180159417 TTATTATCCTTTCTCTCTGTGGG + Intergenic
986396001 5:7331404-7331426 TTATTATGCTTTGTTTCATGGGG + Intergenic
990404960 5:55479781-55479803 TGATTTTGCTTTGTCTCTCTTGG - Intronic
991327811 5:65457247-65457269 TAATTATGCTTTTTGTCTCCAGG - Intronic
991600272 5:68345121-68345143 TTATTTTGCTTTCTCTTTTCTGG - Intergenic
996836292 5:127796411-127796433 CTATTGTGCTTTTTCTCTATAGG - Intergenic
997171110 5:131721852-131721874 TCATTATTCTTTGTCTTCACAGG + Intronic
999640264 5:153665265-153665287 TTACAATGCTTTGTCAATACTGG + Intronic
1000243885 5:159433060-159433082 TTATTATGATTTTTGTCTCCTGG + Intergenic
1000432077 5:161164001-161164023 TTATTATGTTTATTATCTACTGG - Intergenic
1000545611 5:162597497-162597519 TGATTCTGCATTGTCTCTATAGG + Intergenic
1001676711 5:173524335-173524357 TCATTATGCTGTATCTCTAGTGG + Intergenic
1003985965 6:11435717-11435739 TTCTTATTCTGTGTCTATACTGG + Intergenic
1008440717 6:51529222-51529244 TTATTAAACTTTTTCTCTATTGG - Intergenic
1008969728 6:57353211-57353233 TTACAGTGCTTTGTATCTACAGG - Intronic
1009158694 6:60255036-60255058 TTACAGTGCTTTGTATCTACAGG - Intergenic
1009705053 6:67239165-67239187 GCATTATGCTTTGACTCCACAGG - Intergenic
1009948336 6:70365706-70365728 TTATTCGGCTTTATCCCTACAGG + Intergenic
1011145300 6:84208026-84208048 TTTTTTTTTTTTGTCTCTACAGG + Intronic
1012417871 6:99029286-99029308 TTATATTGCTTTATCACTACTGG + Intergenic
1014666155 6:124240424-124240446 TTTTTTTGTTGTGTCTCTACCGG - Intronic
1016117766 6:140309335-140309357 TTATTATTCTTTGGTTCTTCAGG - Intergenic
1016148991 6:140715025-140715047 TTATCATTCTTTGTCCATACAGG + Intergenic
1016840765 6:148522517-148522539 TGATAATGCTTTGTATCCACTGG + Intronic
1017543898 6:155430563-155430585 TTATTTTGCTTTCTCTCTAGGGG - Intronic
1017554209 6:155545397-155545419 TTAATTTGCTTTTTCTTTACTGG - Intergenic
1019962908 7:4476138-4476160 TTCGTATGTTTTGTCTCCACAGG + Intergenic
1020455816 7:8372862-8372884 TTATTTTTCTTTTTCTCTATTGG + Intergenic
1021217039 7:17929114-17929136 TTATTCTTCTCTGTGTCTACAGG - Intronic
1021578204 7:22124766-22124788 TTATTACCCTTTGTATCCACAGG + Intronic
1022434397 7:30366926-30366948 TTATTGTGCTTTGCATCTCCAGG + Exonic
1023164594 7:37331007-37331029 TTATCCTGCTTTGTCCCTCCAGG - Intronic
1023496574 7:40804064-40804086 TTATTATTCTTTGTCGCAAAGGG + Intronic
1023508036 7:40920638-40920660 TCATTATTCTTTGTCTAAACAGG + Intergenic
1024454945 7:49594758-49594780 GTATTGTGCTATGTCTGTACAGG + Intergenic
1031216537 7:118900051-118900073 AGTTTATGCTTTGTTTCTACTGG + Intergenic
1031564203 7:123274793-123274815 TTATTTGGCTTTGTATCTAGAGG - Intergenic
1031648385 7:124255194-124255216 CTATTATGATTTGTCTCCCCAGG + Intergenic
1035948932 8:3997317-3997339 TTGTTTTCCTTTGTCTCTACTGG + Intronic
1036061172 8:5322877-5322899 TTATCATGCTTTTTCTCTACTGG + Intergenic
1036533519 8:9620863-9620885 TTATGATGCTTTCATTCTACTGG - Intronic
1039187407 8:34932665-34932687 TTATTTTACTTTCTCTCTGCTGG + Intergenic
1040774398 8:51022006-51022028 TTCTTATGTTTGGTCTCTTCAGG - Intergenic
1042187691 8:66153517-66153539 TTTCTATGCTCTGTCTCCACAGG + Intronic
1044797225 8:95915959-95915981 TTTTTATACTTTGTCTATGCAGG + Intergenic
1045821969 8:106349397-106349419 TTATTATCTTTTGTCTTGACTGG - Intronic
1046380274 8:113440704-113440726 TTACTATGTTTTGTCACCACAGG + Intergenic
1046454369 8:114439629-114439651 TTATTTTGCTTTCTTTCTTCTGG - Intergenic
1046866277 8:119154025-119154047 TGATTATCCTTAGTCTCTAATGG + Intergenic
1048192764 8:132305380-132305402 TTAATATGCATTGTCTAGACAGG - Intronic
1048219228 8:132526207-132526229 TTATGATGGTCTGTGTCTACGGG + Intergenic
1048722856 8:137346670-137346692 TTATTTTACTTTGTCTGTATGGG - Intergenic
1048911136 8:139136247-139136269 CTAGTATTTTTTGTCTCTACTGG - Intergenic
1050894235 9:10866242-10866264 TTATTATTCATAGTCACTACTGG + Intergenic
1050909323 9:11047247-11047269 TTTTTTTGCCATGTCTCTACTGG + Intergenic
1051938012 9:22467827-22467849 ATATTTTGATTTGTCTGTACAGG + Intergenic
1055035921 9:71818346-71818368 TTATTATTCTCTGTCTTGACAGG - Intergenic
1055526617 9:77140178-77140200 TTATTATGGTGTGTCTCTGTTGG + Intergenic
1055634630 9:78264005-78264027 TTAATATGGTCTGTCTTTACTGG + Intronic
1055800188 9:80026657-80026679 TAATTATGCTTTTGCTCTAATGG + Intergenic
1055982861 9:82022883-82022905 TTACTAGGCATTGTCTATACAGG + Intergenic
1056208732 9:84344624-84344646 TTGTCATCCTTTGTCTCTAAGGG + Intergenic
1062301996 9:135878966-135878988 GTATTATGCTTTGTTTTTCCTGG - Intronic
1187631431 X:21177225-21177247 TTTTTTTTTTTTGTCTCTACGGG - Intergenic
1188020222 X:25149081-25149103 TTATTATGTTTTTTTCCTACAGG + Intergenic
1188831998 X:34909894-34909916 TTATTATATTTTTTCTCTATAGG + Intergenic
1188840201 X:35007766-35007788 TTAATATGATATGTCTGTACTGG - Intergenic
1191119164 X:56885354-56885376 ATATTATACATTGTATCTACAGG - Intergenic
1192075578 X:67992436-67992458 TTTTTTTGTTTTGTCTCTGCCGG - Intergenic
1193409661 X:81147176-81147198 CTATTTTGCTGTGTCTCTGCAGG - Intronic
1193602280 X:83522091-83522113 TCATACTGCTTTATCTCTACAGG - Intergenic
1194512190 X:94810731-94810753 TGGCTATGCTTTTTCTCTACTGG + Intergenic
1195102656 X:101570504-101570526 TTTTTCTGTTTTGTCTCTGCCGG - Intergenic
1195750072 X:108155704-108155726 TGATTATGCTTTGTCTGTATTGG + Exonic
1197046584 X:122004710-122004732 TTATTATGGTTTTTTTCTATGGG + Intergenic
1197388611 X:125831759-125831781 TTTTTATGTTGTGTCTCTGCTGG - Intergenic
1199533129 X:148871797-148871819 ATATAATGCTTTGTCTCTCCTGG + Intronic
1200716100 Y:6546216-6546238 TTAATGTGCTTTGTCTCTGCCGG - Intergenic
1201050831 Y:9933247-9933269 TTAGAATTCTTTGTCTGTACTGG + Intergenic