ID: 1092865028

View in Genome Browser
Species Human (GRCh38)
Location 12:12752886-12752908
Sequence CTGGCTAAACAGATAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092865028_1092865034 21 Left 1092865028 12:12752886-12752908 CCCTTCTCTATCTGTTTAGCCAG 0: 1
1: 1
2: 1
3: 33
4: 264
Right 1092865034 12:12752930-12752952 TATCTCCACTCAAGAAAAATGGG 0: 1
1: 0
2: 1
3: 17
4: 226
1092865028_1092865038 29 Left 1092865028 12:12752886-12752908 CCCTTCTCTATCTGTTTAGCCAG 0: 1
1: 1
2: 1
3: 33
4: 264
Right 1092865038 12:12752938-12752960 CTCAAGAAAAATGGGTAGGAGGG 0: 1
1: 0
2: 1
3: 35
4: 348
1092865028_1092865037 28 Left 1092865028 12:12752886-12752908 CCCTTCTCTATCTGTTTAGCCAG 0: 1
1: 1
2: 1
3: 33
4: 264
Right 1092865037 12:12752937-12752959 ACTCAAGAAAAATGGGTAGGAGG 0: 1
1: 0
2: 1
3: 25
4: 256
1092865028_1092865031 -6 Left 1092865028 12:12752886-12752908 CCCTTCTCTATCTGTTTAGCCAG 0: 1
1: 1
2: 1
3: 33
4: 264
Right 1092865031 12:12752903-12752925 AGCCAGGTAATAGTGATGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 170
1092865028_1092865035 25 Left 1092865028 12:12752886-12752908 CCCTTCTCTATCTGTTTAGCCAG 0: 1
1: 1
2: 1
3: 33
4: 264
Right 1092865035 12:12752934-12752956 TCCACTCAAGAAAAATGGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 207
1092865028_1092865033 20 Left 1092865028 12:12752886-12752908 CCCTTCTCTATCTGTTTAGCCAG 0: 1
1: 1
2: 1
3: 33
4: 264
Right 1092865033 12:12752929-12752951 CTATCTCCACTCAAGAAAAATGG 0: 1
1: 0
2: 1
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092865028 Original CRISPR CTGGCTAAACAGATAGAGAA GGG (reversed) Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
904284819 1:29447087-29447109 CTGGCTGACCACAAAGAGAAAGG - Intergenic
904310346 1:29625299-29625321 CTGGGTAAACATAGAGAGAAAGG - Intergenic
905335586 1:37242452-37242474 CTGGCGACAGAGAGAGAGAATGG - Intergenic
907410015 1:54277224-54277246 CAGGCTCAACAGATAGTGACTGG - Intronic
907971340 1:59384576-59384598 TTGCCAAAACTGATAGAGAAAGG - Intronic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
908662637 1:66453473-66453495 CTGTCAAAACTGATTGAGAATGG + Intergenic
909454806 1:75838249-75838271 CTGGCTTTAAAGATAGAGGAAGG - Intronic
909943884 1:81641040-81641062 TTGGCTTTATAGATAGAGAAGGG - Intronic
910326798 1:86018447-86018469 CTCTTTAAAGAGATAGAGAAAGG + Intronic
910485821 1:87712161-87712183 GTGGCTTATTAGATAGAGAAGGG + Intergenic
911098984 1:94079016-94079038 CTGGCTACTCAGATAAAGACAGG - Intronic
911323828 1:96445965-96445987 ATGGCTTGACAGAGAGAGAAAGG + Intergenic
913061707 1:115214487-115214509 GGGGCAAAACAGATAGGGAATGG - Intergenic
916142997 1:161715799-161715821 CAGGCTAGACAGAAAGAGACGGG - Intergenic
916465201 1:165067136-165067158 CTGGCTTATCAGTTAGGGAATGG - Intergenic
917163480 1:172084141-172084163 ATCAGTAAACAGATAGAGAAAGG - Intronic
918396770 1:184121412-184121434 ATGGCTTGAAAGATAGAGAAAGG - Intergenic
918589075 1:186220937-186220959 TAGGCTAAAGAGATAGTGAAGGG + Intergenic
918801916 1:188983453-188983475 CTGGCTAGACTAATAAAGAAGGG - Intergenic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
1063237128 10:4128630-4128652 TTGGCTTTACAGATAGAAAAAGG + Intergenic
1063545054 10:6972804-6972826 CTGTGTAAAAGGATAGAGAAAGG - Intergenic
1063894004 10:10660027-10660049 CTGGCTTTGAAGATAGAGAAAGG + Intergenic
1064347986 10:14549801-14549823 CTGTCCATACAGATAGTGAAAGG - Intronic
1064618284 10:17186459-17186481 CTGGCTTCAAAGATAGAAAAAGG + Intronic
1064967437 10:21029573-21029595 CTGACAAAACAGATACAGACTGG + Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1068403797 10:56564133-56564155 CTGGCCAAAAAGAAAGGGAAAGG + Intergenic
1069845729 10:71369894-71369916 CTGCCTTAAAAGATTGAGAAGGG + Intergenic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070322324 10:75363459-75363481 GTGGATAAACAGAGACAGAAGGG - Intergenic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1070851695 10:79568862-79568884 CTGGCTAAATGGATAAAAAAAGG - Intergenic
1071268360 10:83984245-83984267 CTGGGTAGTCAGCTAGAGAAAGG - Intergenic
1071337433 10:84612331-84612353 CTGGCTATACAGATAATGAGAGG + Intergenic
1072276586 10:93829265-93829287 GTGGCCAAACAGATAGAGACAGG - Intergenic
1073865063 10:107793030-107793052 CTGGCAAAACACTTATAGAAAGG + Intergenic
1076598515 10:131641394-131641416 CAGGCTTAACACATAGAGAGTGG - Intergenic
1076934998 10:133562019-133562041 CAGGCCAAACTGAAAGAGAAAGG + Intronic
1077793238 11:5463789-5463811 CTGTCTAAAGAGATACAGGAGGG + Intronic
1078044700 11:7903145-7903167 CTGGAAAAACAGATAGCTAAGGG - Intergenic
1078478045 11:11650928-11650950 CAGACTCAAGAGATAGAGAAAGG - Intergenic
1080492503 11:32781570-32781592 CTGCCTAACCAGAAAGAGAGAGG - Intronic
1081089391 11:38844531-38844553 CTCTCTAAACAGAGAGAGCAGGG - Intergenic
1081246931 11:40778649-40778671 CTGGCTAAATAGATTGATCAAGG + Intronic
1082737519 11:56873241-56873263 TTGGTTGAAGAGATAGAGAAAGG - Intergenic
1083731734 11:64655970-64655992 CTGGCTGGACAGAGAGAGCAGGG + Intronic
1085717248 11:78883355-78883377 ATGGCTAAACAGCTGGAGAGTGG + Intronic
1085822995 11:79813028-79813050 CTGGGGAAACAGATATAAAATGG + Intergenic
1086221453 11:84449486-84449508 ATGGCTAACTAGATAGAAAAGGG + Intronic
1087963437 11:104381024-104381046 CTGGCTGGACAGATCAAGAAAGG - Intergenic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1096242154 12:49965303-49965325 CTGGCTGCACAGTTAGAGAGGGG + Exonic
1096644410 12:53022535-53022557 CTGACAAAACAGATACAGACTGG + Exonic
1097601594 12:61699490-61699512 ATGCCTAAACAAATAGGGAAGGG + Intergenic
1098539891 12:71642742-71642764 CTGTATAATCAGATAGAAAATGG + Intronic
1100139553 12:91600339-91600361 CTGGCTTCAAAGACAGAGAAAGG - Intergenic
1100760669 12:97803528-97803550 ATGGCTACACAGCTAGTGAATGG - Intergenic
1101607257 12:106257074-106257096 CTGGCTAAATGTATAGATAAAGG - Intronic
1101816349 12:108149014-108149036 CTGACTAAACAGAAAGGAAAGGG - Intronic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1103732975 12:123041025-123041047 GTGTGTAAACAGACAGAGAAGGG + Intronic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1107118679 13:36775170-36775192 CTGACCAAACAGATAGAAGACGG - Intergenic
1107232900 13:38132007-38132029 TTGACTAAACAGAGACAGAATGG + Intergenic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG + Intergenic
1109490459 13:63091325-63091347 ATGGCAAAATAGCTAGAGAAAGG + Intergenic
1109528893 13:63614421-63614443 CTGGCTAAATATCTAGCGAAAGG - Intergenic
1109990267 13:70045864-70045886 TTGACAAAACAGATAGAGGAAGG - Intronic
1112125133 13:96457642-96457664 CTGGCAAAACACATACAGATGGG + Intronic
1115224011 14:31085120-31085142 CTGGCGAAGCAGACATAGAATGG - Exonic
1115654450 14:35429941-35429963 CAGGGGAAACAAATAGAGAAGGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116724711 14:48548102-48548124 CTGGCTTCACAGAAAGAGAGAGG - Intergenic
1117667914 14:58076725-58076747 CTGGGTAAACTGAGAAAGAAGGG + Intronic
1118879533 14:69814433-69814455 CTGGCAAAACAGATAGAAAAAGG + Intergenic
1120721240 14:87891686-87891708 CTGGCTCTGAAGATAGAGAAAGG + Intronic
1123786168 15:23676890-23676912 GTGGTTAAATTGATAGAGAATGG - Intergenic
1124205239 15:27712932-27712954 CTGGCTATAAAGATGGAGGAGGG + Intergenic
1126750336 15:51870510-51870532 CTGGCCAAAATGATTGAGAAGGG - Intronic
1127165083 15:56236466-56236488 AAGACTAAACAGAAAGAGAATGG + Intronic
1127182968 15:56443255-56443277 CTGGCTAAAAAGATAGACTCAGG - Intronic
1127601937 15:60546485-60546507 CAGGAGAAACAGATAGAGACAGG + Intronic
1128411811 15:67406782-67406804 CTCTCTTTACAGATAGAGAAAGG - Intronic
1129187391 15:73918066-73918088 CTGGCAAAAAAGAAAAAGAAGGG + Intergenic
1133411801 16:5574994-5575016 CTGGCTAACCAGATAACAAACGG + Intergenic
1133954594 16:10430296-10430318 CTGGATAAAAAAATAGTGAATGG + Intronic
1134203334 16:12216983-12217005 CTTGCTAAACACAAAAAGAATGG + Intronic
1134318370 16:13140179-13140201 CTGTCTAAAAAGAAAGGGAAGGG - Intronic
1134901445 16:17941581-17941603 CTGGCTGAACAAATTGAAAATGG - Intergenic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1136492780 16:30621310-30621332 CTGGGCAAACAGATAGAAAAGGG - Intronic
1137030518 16:35519579-35519601 CTGGGCAAACAGATAGAAAAGGG + Intergenic
1137387975 16:48058390-48058412 CAGGGAAAACACATAGAGAAAGG - Intergenic
1137679051 16:50323239-50323261 TTGGCTAAAATGATAGGGAATGG - Intronic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1138462216 16:57156602-57156624 GTGGCTACAGAGATAGAGCAAGG + Intronic
1144556920 17:16290395-16290417 CTGTCTCAAAAGAGAGAGAAGGG - Intronic
1146562818 17:33886181-33886203 CTGGCTGAAGAGATGGACAAAGG + Intronic
1146678763 17:34792150-34792172 CTGGCTCAGCAGGTACAGAAGGG - Intergenic
1151679795 17:75617191-75617213 CTGGCCAAACAGGTCCAGAAGGG - Intergenic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1154041978 18:10865093-10865115 CTAGCCAAACACAGAGAGAAGGG + Intronic
1157959891 18:52141543-52141565 CTGGGTAAAGAGATTCAGAAGGG - Intergenic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1159394439 18:67838170-67838192 CTGGCTTTAGAGAGAGAGAAAGG - Intergenic
1159554939 18:69935783-69935805 TTGGCTGAATTGATAGAGAATGG - Intronic
1161258730 19:3323762-3323784 CTAGCCAAACTGAGAGAGAAAGG - Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1162611993 19:11763115-11763137 TTGGTTAAACAGAAAGAGAAGGG + Intergenic
1162622924 19:11858839-11858861 GTGGGCAAACAGATAGAAAAGGG - Intronic
1162738438 19:12759749-12759771 CTGGGTCTACAGTTAGAGAAGGG - Intergenic
1163816335 19:19466841-19466863 CTGGCTGAAAACATAGAGAAAGG - Intronic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164465219 19:28482115-28482137 ATGCCTAGACAGATAGAGAAGGG + Intergenic
1167282516 19:48578206-48578228 CTGTCTCAACAAATAGAAAAAGG + Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167487243 19:49769832-49769854 CTGGCTTAACAGGGTGAGAAGGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168576249 19:57513523-57513545 CTGGGCAAACAGATAGAAAAGGG + Intronic
1168680097 19:58308635-58308657 CTGGGCAAACAGATAGGAAAGGG + Intronic
926006812 2:9378951-9378973 CTGGATAAACAGACAGGGAAAGG + Exonic
926858724 2:17285175-17285197 TTGTCTAAACAGTAAGAGAAGGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927676746 2:25111778-25111800 CTGGCTTTGAAGATAGAGAAGGG + Intronic
929983431 2:46701319-46701341 ATAGCTAAACAGAATGAGAATGG + Intronic
931552544 2:63462637-63462659 CTGGCTAAAAATATGCAGAAAGG + Intronic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
932708544 2:74046259-74046281 CTGTCTAAAGAGAGAGAGAAGGG - Exonic
935962945 2:108445301-108445323 ATGCCTAAGCAGATAGGGAAGGG + Intergenic
938505275 2:131873683-131873705 CTTTCTAAACAGCTAAAGAATGG - Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939211682 2:139183611-139183633 CTGTCTAAAAAGACAGAGAGAGG - Intergenic
941555060 2:166968094-166968116 CTAGCTAAACATATAGAAGAAGG + Intronic
943122842 2:183758498-183758520 CTTGCTAAACAAATGCAGAATGG + Intergenic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
944396019 2:199267038-199267060 CTGGCAAAGCAGATGGGGAAGGG + Intergenic
946183846 2:217965733-217965755 CTGGCTAAGCAGGGAGAGCAAGG - Intronic
946555309 2:220849836-220849858 CTGGCTAAAAGGATAGAGTAAGG + Intergenic
946891652 2:224283103-224283125 CTGGCAGAACAGAAAGAAAAAGG + Intergenic
947956866 2:234199682-234199704 CTGGCTGGACAGATAGGTAATGG - Intergenic
1169508020 20:6233897-6233919 ATGGCTGAACTGATAGAGTATGG + Intergenic
1170711057 20:18791472-18791494 TTGTCTAAAAAGATACAGAAGGG - Intergenic
1171094712 20:22320731-22320753 CTGGCTAAACACATAGCCAAGGG - Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1174853810 20:54023571-54023593 TTTGATAAACAGAGAGAGAAAGG + Intronic
1175083729 20:56442135-56442157 CTGTCAACACAGATATAGAAAGG - Intronic
1175768275 20:61606208-61606230 GTGGCCAAGCAGACAGAGAATGG + Intronic
1178017059 21:28359438-28359460 CTGGCATGAAAGATAGAGAAAGG + Intergenic
1179455839 21:41499433-41499455 CTGGCTAAACTGACTGAGCAAGG - Intronic
1179601810 21:42483701-42483723 CTTTCTAAACAGAAATAGAAAGG - Intronic
1181504002 22:23338540-23338562 CTGGCAAAGCTGAAAGAGAAGGG - Intergenic
1181841418 22:25665590-25665612 CTGGCTAAACAGATATAGAATGG + Intronic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
949785276 3:7733543-7733565 ATGGCTAGGCAGATAGGGAAGGG - Intronic
950110599 3:10416375-10416397 TTGGCTAAAAAGAGAGAGGAAGG - Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
951252039 3:20405082-20405104 GTGAATAAACAGATATAGAATGG - Intergenic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
952637768 3:35552481-35552503 CATGTTAAACAGATTGAGAAAGG + Intergenic
952715427 3:36475421-36475443 CTGACTAAACACATAAATAATGG - Intronic
953780367 3:45863789-45863811 CTGGATTAAAAGATAGAGAGAGG + Intronic
953841874 3:46395825-46395847 CTGGTTTACCAGATAGGGAAGGG + Intergenic
955567874 3:60268950-60268972 CTGGCTTTAAAGATAGAGGAAGG + Intronic
956030079 3:65028085-65028107 CTGAGTAAAAAGAAAGAGAAAGG + Intergenic
957167127 3:76689814-76689836 CTGACTACACACAGAGAGAACGG - Intronic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
958131361 3:89429288-89429310 GAGGCTAAATAGACAGAGAAGGG + Intronic
958502021 3:94923564-94923586 CAGGCTAAACTGATAAAGATGGG + Intergenic
959112875 3:102142954-102142976 CTGGCTTTGCAGATAGAGGAAGG - Intronic
959412385 3:106040812-106040834 CTGGCTTTAAAGATAGAGGAAGG - Intergenic
960744496 3:120872176-120872198 CTGGCCAATCAGCAAGAGAAAGG - Intergenic
960935303 3:122896394-122896416 CTGGCTTTATAGACAGAGAAGGG - Intergenic
961989891 3:131177464-131177486 CTACCAAAACAGATATAGAATGG + Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
965063836 3:163817764-163817786 GTGGCTAAAGATTTAGAGAATGG - Intergenic
967851354 3:194084944-194084966 CTGGCTTTGAAGATAGAGAAAGG - Intergenic
968376956 4:51748-51770 CTGGTTAGGCAGATAGAGAGAGG + Intergenic
970041611 4:11804368-11804390 CTGACTAAATAAATAGAGAGGGG + Intergenic
971964415 4:33534168-33534190 ATTGATAAACAAATAGAGAAAGG + Intergenic
972498070 4:39652464-39652486 CTGGCTTTACAGACAGAGAAGGG - Intergenic
974038245 4:56835964-56835986 CTTGCCTAGCAGATAGAGAAAGG + Intergenic
974571778 4:63660778-63660800 GTTGCTTCACAGATAGAGAAAGG + Intergenic
975968716 4:80007698-80007720 CTGGCTTTGCAGATAGAGAAAGG + Intronic
979853593 4:125604101-125604123 GAGGCTAAACATATAGAGAATGG - Intergenic
980060476 4:128123461-128123483 CTGGGTAAAGGGATAGAGAATGG - Intronic
980728349 4:136795047-136795069 CTGAATAATCAGATATAGAAGGG + Intergenic
981565906 4:146101239-146101261 CAGAGTAAACAGATACAGAATGG - Intergenic
982175723 4:152704063-152704085 CTGGCTAAATAGACAGGGAAGGG + Intronic
983082354 4:163402205-163402227 CTTGCTAAACTGACAAAGAAAGG + Intergenic
984022087 4:174497951-174497973 CTGTCTCAAAAGAGAGAGAAGGG - Intronic
984128594 4:175843892-175843914 TAGGCTAACCAGATTGAGAACGG - Intronic
984876333 4:184371257-184371279 CTGGTAAAACAGAAAGGGAAGGG - Intergenic
988664458 5:33310099-33310121 CTGGCTAATGAGATGCAGAAAGG + Intergenic
989777287 5:45225144-45225166 CTGGCTAAACAGTTTGGGTAAGG + Intergenic
990453026 5:55954755-55954777 CTGCCTAAAGAGTTAGAAAAAGG + Intronic
991131696 5:63130199-63130221 CTGGGTAAGCAGATATAGGATGG - Intergenic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
991917615 5:71620635-71620657 TTGCCTAAACAAATAGAGACTGG - Intronic
993091399 5:83430931-83430953 TTGGCTAGACAGACAGAAAAAGG + Intergenic
993211107 5:84952302-84952324 CTGGCTTTTCAGAAAGAGAAAGG - Intergenic
993953361 5:94202048-94202070 CTGGCTAAACTGATTTAGCAAGG + Intronic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
999008399 5:148007036-148007058 CTTGCTAAACAAAGGGAGAAAGG - Intergenic
1002894021 6:1364533-1364555 CTGGCTAATAAGATAGAAAGAGG - Intergenic
1002942144 6:1726685-1726707 CTTGCAAAACAGATCTAGAAAGG - Intronic
1005060760 6:21774994-21775016 TTGGGTGAAAAGATAGAGAATGG + Intergenic
1005394259 6:25364980-25365002 CTGGGAATCCAGATAGAGAAAGG - Intronic
1006200644 6:32286893-32286915 CAGGGCAAAGAGATAGAGAATGG + Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1007147982 6:39656581-39656603 CAGGTTAAACAGCTAGAGAAAGG - Intronic
1007998468 6:46334169-46334191 CAGGCTAAGGAGATAGTGAAAGG - Intronic
1008108133 6:47462524-47462546 CTGGCTTTAAGGATAGAGAAAGG + Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1012442556 6:99274976-99274998 GTGGCTAAACAGATAGCAAAGGG - Exonic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015095536 6:129410504-129410526 CTAACTAAACAAATTGAGAAAGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1019834639 7:3370674-3370696 CTGGTGAAACAGATTGCGAATGG + Intronic
1020975448 7:15000433-15000455 CTGACTCAACAGATAGAGGGTGG + Intergenic
1022545520 7:31184676-31184698 CTAGCAAAAAAGATAAAGAAGGG - Intergenic
1022611942 7:31884672-31884694 ATGGATAAAGAGCTAGAGAAAGG - Intronic
1022779098 7:33560029-33560051 CTGGGTAAACTGATAGAGAGGGG - Intronic
1023012424 7:35936116-35936138 GTGGCTATGCACATAGAGAATGG + Intergenic
1023964555 7:44956219-44956241 CTACCTACACAGACAGAGAACGG + Intergenic
1024078703 7:45837713-45837735 GTGGCTATGCACATAGAGAATGG - Intergenic
1024195694 7:47056815-47056837 CTGACTAAAGACATAGTGAAAGG - Intergenic
1025126088 7:56346226-56346248 GTGGCTATGCACATAGAGAATGG + Intergenic
1026840035 7:73665390-73665412 CTGTCTAAAAAGAAAGTGAAGGG + Intergenic
1029409315 7:100398579-100398601 CTGGGTGAATGGATAGAGAAGGG - Intronic
1029958811 7:104668323-104668345 CTGACAAAACAGATACAGACTGG + Intronic
1030062835 7:105636642-105636664 CTGGCCTAACAGAGAAAGAAGGG - Intronic
1030394940 7:108974257-108974279 CTGGCTAAGCAGATGGACTATGG + Intergenic
1031411472 7:121444760-121444782 TTGGCTAAGCATACAGAGAAGGG - Intergenic
1031910412 7:127511160-127511182 CTGGCTTTACACATGGAGAAAGG + Intergenic
1032064711 7:128758501-128758523 CAGGCCAAACAGCTAGAAAATGG + Intronic
1033626113 7:143111126-143111148 CTGGCTTCGGAGATAGAGAAAGG - Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036665328 8:10733685-10733707 CGAGCTAAACGGACAGAGAAGGG - Intronic
1038163386 8:25061674-25061696 CTGGCTAAACTCATACAGCAGGG + Intergenic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1040345447 8:46488492-46488514 TTGGAAAAACAGATAGAAAAGGG - Intergenic
1042503079 8:69530795-69530817 TTGGCTAACCAGATAGAAAGTGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043358724 8:79444227-79444249 ATGGGTAAACTGATACAGAATGG - Intergenic
1044186464 8:89258091-89258113 CTGGCTAAACAGCTTGAAAGAGG - Intergenic
1044725894 8:95193914-95193936 CTGGCTTAGAAGATAGAGAAGGG + Intergenic
1046733353 8:117749935-117749957 CTGTCTAACCAGATATATAAAGG + Intergenic
1046930748 8:119839469-119839491 CTGGCTAAAGAGATAGGTAATGG - Intronic
1048348270 8:133594982-133595004 ATGGCTAAAGAGAGAGAGGAAGG - Intergenic
1048409035 8:134152479-134152501 CTTACTAAACAAATAGAAAAGGG - Intergenic
1049833131 8:144714586-144714608 ATGGATGAACAGATACAGAATGG - Intergenic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1051034040 9:12721601-12721623 CTGGCTTTGGAGATAGAGAAAGG - Intergenic
1053089191 9:35258316-35258338 AAGGCAAAACAGAAAGAGAAAGG - Intronic
1054738742 9:68782991-68783013 CAGGGGCAACAGATAGAGAAGGG - Exonic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1058011207 9:99979517-99979539 CTAGCCAATAAGATAGAGAATGG - Exonic
1058306338 9:103445900-103445922 CAGACTAAAAAAATAGAGAATGG - Intergenic
1059304922 9:113346668-113346690 CTTGATGAACAGATAGGGAAAGG + Intergenic
1059474372 9:114532633-114532655 CTGGCTAAACTGAAAGAATAGGG + Intergenic
1059476798 9:114553858-114553880 CTGGCTAAACAGATGTCCAACGG - Intergenic
1060889943 9:127181738-127181760 CAGGCCAAAGAGATGGAGAAAGG - Intronic
1061461860 9:130746019-130746041 CTGGCCAAATAGAGAGACAAGGG + Intronic
1062320981 9:135990413-135990435 CTGGGATAACAGACAGAGAAGGG - Intergenic
1203572280 Un_KI270744v1:142498-142520 CTGGTTAGGCAGATAGAGAGAGG - Intergenic
1185481875 X:452319-452341 GTGGATAAATAGATAGATAATGG - Intergenic
1185774087 X:2788077-2788099 CTGTCTCAAGAGAGAGAGAAAGG + Intronic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1186283801 X:8022812-8022834 GTGTCTTAACAGATAGATAAGGG + Intergenic
1186428270 X:9482703-9482725 CTGGCTATAGAGATAGAAAAAGG - Intronic
1188570516 X:31579979-31580001 CTGGCTTTGAAGATAGAGAAAGG - Intronic
1188576950 X:31663156-31663178 CTGCCAAGACAGAGAGAGAAGGG - Intronic
1189965378 X:46367093-46367115 CTGGCTTTATAGACAGAGAAGGG - Intergenic
1190517070 X:51234879-51234901 CTGCCTTTACATATAGAGAATGG + Intergenic
1190722432 X:53161099-53161121 CTGGAAAAACAAATAAAGAAGGG - Intergenic
1191139934 X:57105972-57105994 CTGGAAAAACAGATAGCAAAGGG + Intergenic
1191904654 X:66075760-66075782 CTGACAAAACAGATACAGACTGG - Intergenic
1193276819 X:79598605-79598627 CTGGACAAATAAATAGAGAAGGG - Intergenic
1193993958 X:88342569-88342591 TTAGCTATACAGATAGAAAATGG + Intergenic
1194088817 X:89561190-89561212 CTGGCAAAACAGATTTTGAAAGG - Intergenic
1195777377 X:108422359-108422381 CTGTCTAAAAAGAAAGAAAAAGG + Intronic
1198558775 X:137825418-137825440 GTGGCAAAAGAGGTAGAGAAGGG + Intergenic
1198756466 X:139987554-139987576 TGGACTAAACAGAAAGAGAAAGG - Intergenic
1199748393 X:150791258-150791280 CTGTCTAAGCAGACAGAGATAGG - Intronic
1200441490 Y:3217241-3217263 CTGGCAAAACAGATTTTGAAAGG - Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic
1201592061 Y:15626397-15626419 GTGTCTAGACAGATAGAGAATGG - Intergenic
1201742080 Y:17335120-17335142 CTGGAAAATCAGATAGAAAAGGG + Intergenic
1202191278 Y:22248633-22248655 CTGGCTAAAAAGTTAGTTAATGG + Intergenic