ID: 1092865709

View in Genome Browser
Species Human (GRCh38)
Location 12:12759034-12759056
Sequence GTCCAGCTGAACCACACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092865709_1092865713 4 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865713 12:12759061-12759083 GGAGGACTCACATCCTGTGCGGG 0: 1
1: 1
2: 5
3: 50
4: 239
1092865709_1092865712 3 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865712 12:12759060-12759082 AGGAGGACTCACATCCTGTGCGG 0: 1
1: 0
2: 1
3: 24
4: 203
1092865709_1092865718 18 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865718 12:12759075-12759097 CTGTGCGGGAGGGAGCAGGATGG 0: 1
1: 0
2: 4
3: 81
4: 972
1092865709_1092865715 8 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865715 12:12759065-12759087 GACTCACATCCTGTGCGGGAGGG 0: 1
1: 0
2: 8
3: 47
4: 161
1092865709_1092865716 14 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865716 12:12759071-12759093 CATCCTGTGCGGGAGGGAGCAGG 0: 1
1: 0
2: 4
3: 107
4: 1670
1092865709_1092865714 7 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865714 12:12759064-12759086 GGACTCACATCCTGTGCGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092865709 Original CRISPR GTCCAGCTGAACCACACTGT AGG (reversed) Intronic
903887380 1:26548271-26548293 CACCGGCTGCACCACACTGTCGG - Intronic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
913193662 1:116434306-116434328 GTCCTGCTTAACCACACTGTGGG + Intergenic
914247870 1:145899269-145899291 GTCCCTCTGAACCACACTGATGG + Exonic
915801430 1:158797070-158797092 GTTCAGTAGAACCTCACTGTAGG - Intergenic
915969566 1:160344212-160344234 CTACAGCTGCCCCACACTGTGGG + Intronic
919111265 1:193221838-193221860 CTCCAGCTGACTCAAACTGTAGG - Intronic
919322401 1:196059547-196059569 TTCCAGCTAAACCAGACTCTTGG + Intergenic
922169752 1:223144289-223144311 GCCCACCCGAACCCCACTGTGGG + Intergenic
922640764 1:227229239-227229261 ATCCAGTTGCCCCACACTGTTGG + Intronic
1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072497268 10:95973946-95973968 GTGCAGTTGAAGCACATTGTGGG - Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081257834 11:40919232-40919254 TTCCAGCTGTATCACAGTGTAGG + Intronic
1085267857 11:75247932-75247954 TTCCAGCTGCACCAAACTATGGG + Intergenic
1086397488 11:86431780-86431802 GTCCAGGTGACCCGCTCTGTGGG - Intergenic
1087411278 11:97792851-97792873 GTCCAGCATCACTACACTGTAGG - Intergenic
1090207849 11:124895786-124895808 TTCCAGCTGAGCCACACCGCCGG + Exonic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1097453867 12:59771329-59771351 GTACAGCTGTACCTCACTATGGG + Exonic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1102060644 12:109928419-109928441 GAGCTGCTGAACCAGACTGTGGG + Intronic
1102565991 12:113797833-113797855 CTGCAGCTGAACCACACATTAGG + Intergenic
1103726703 12:123000787-123000809 GTTCAGCTGCTCCACACTGGAGG + Exonic
1104719724 12:131038600-131038622 GTCCACCTACCCCACACTGTGGG - Intronic
1107740743 13:43447342-43447364 GTCCTGCTCATCCACACTGCTGG - Intronic
1109108581 13:58287285-58287307 TTCCAGCTGAACCAGCATGTAGG - Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1117026084 14:51621511-51621533 GTCCTGCTGTTCCACCCTGTAGG + Intronic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1120681820 14:87489261-87489283 GTCAGGCTAAACCACACAGTTGG + Intergenic
1121867192 14:97373500-97373522 GTCCAGCTGAAGCAAGCTGAGGG + Intergenic
1122356390 14:101125541-101125563 GTCCAGCGTCTCCACACTGTAGG - Intergenic
1125954576 15:43781151-43781173 GTCCAGTGTATCCACACTGTAGG - Intronic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1127901399 15:63343695-63343717 GTCCATCTTAACCAGACTCTTGG + Intronic
1135184976 16:20307584-20307606 GCCCAGCTGAACAGCACTGGGGG + Intergenic
1138224456 16:55280874-55280896 GTCCAGCTGCAGCACACCCTGGG - Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1142318669 16:89366827-89366849 GTCCAGATGACACACACTTTGGG + Intronic
1143527761 17:7482337-7482359 CACCACCTGAACCGCACTGTAGG - Exonic
1144129258 17:12229905-12229927 GTCCCTCTGAACCACACCGGGGG - Intergenic
1144762758 17:17716766-17716788 GTCCAGCAGCACCACACAGGAGG - Intronic
1146138585 17:30344901-30344923 CTCCCGCTGAACCACAGGGTTGG - Intergenic
1146730998 17:35193933-35193955 CACCACCTGAACCGCACTGTAGG + Exonic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1150325931 17:64257591-64257613 GTCCAGCAGATCCACGCCGTAGG + Intronic
1152177374 17:78796708-78796730 GCCCAGCAGAGCCACACTGAAGG + Exonic
1153091571 18:1351904-1351926 CTCCAGCTCAACCAGACTTTGGG + Intergenic
1153618229 18:6953207-6953229 GTCCAGCGGATCCACACCATAGG + Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157104177 18:44757620-44757642 GTACAGATGAAGCACACAGTAGG - Intronic
1157545857 18:48545954-48545976 TTCCAGCTGAAACACGCTCTTGG - Intronic
1160444444 18:78915918-78915940 GGCCACCTGAACCACAGGGTGGG + Intergenic
1160494755 18:79366336-79366358 GAACCGCAGAACCACACTGTGGG + Intronic
1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG + Intronic
1163361614 19:16850559-16850581 GTCCATCTCACCCACACTTTAGG + Intronic
1164547512 19:29181224-29181246 GGCCACCTGCACCACACTGGCGG + Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1168376066 19:55880631-55880653 GTGCAACTGTCCCACACTGTTGG - Intronic
929523208 2:42674302-42674324 GTTAAGCAGAACCACACTATGGG - Intronic
935898996 2:107770515-107770537 GTCCAGCTGTAGCACCCAGTGGG + Intergenic
937705091 2:124911388-124911410 TTCCAGGTGGGCCACACTGTAGG + Intronic
938768185 2:134477820-134477842 GTACAGCTTCACCACTCTGTGGG - Intronic
939023335 2:136984192-136984214 GTACAGCTTCACCACTCTGTGGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
945532241 2:210970061-210970083 CTCCAGCTGATCTCCACTGTGGG - Intergenic
949071814 2:242029712-242029734 GAGCACCTGAACCTCACTGTGGG + Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1172053801 20:32140133-32140155 GTCGAGCAGATCCACACTGGAGG + Intronic
1175862866 20:62159493-62159515 GTCCAGCTGAGCCAGGCAGTGGG - Intronic
1178817660 21:35946397-35946419 GACCAGCAGAACCCCACTCTTGG + Intronic
1181290459 22:21788693-21788715 GACCAGCTGAACCACATTTTGGG - Exonic
1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG + Exonic
951602352 3:24390270-24390292 CTCCAGCTGAAACACACTTTAGG + Intronic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954065997 3:48106588-48106610 GTCCATCTGACCCTCACTGGTGG + Intergenic
955250365 3:57275594-57275616 GTCCAGTGTATCCACACTGTAGG + Intronic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
964527076 3:157626359-157626381 TTCCTGCTGAGCCTCACTGTTGG - Intronic
964894432 3:161578473-161578495 GTACAGCTGAGCCTCACTGAAGG + Intergenic
965994007 3:174856504-174856526 GTCCAGTTTATTCACACTGTAGG + Intronic
967390749 3:188951601-188951623 GTCTCACTGAAACACACTGTGGG - Intronic
969232242 4:5839852-5839874 GCCCAGCTCCACCACATTGTCGG + Intronic
970197823 4:13570367-13570389 TTCCAGCTCTACCACACTCTAGG + Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
972153502 4:36126621-36126643 GTCCAGCTAAACTATACTGTTGG + Intronic
977310774 4:95384519-95384541 GTCCAGCTTTACCACACTCCTGG - Intronic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
981118326 4:141018255-141018277 GTCTTTCTGAACCACACTGGTGG - Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
984515618 4:180735237-180735259 TCCCAGCTGAACCAGACGGTAGG - Intergenic
984994311 4:185413410-185413432 GTCTACCCAAACCACACTGTAGG - Intronic
988733306 5:33995144-33995166 GTCCATCCCATCCACACTGTGGG + Intronic
988819095 5:34863008-34863030 GTCAAGCTGTACTACACTCTGGG + Exonic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
991153644 5:63402143-63402165 GTCCAGATGAGCAACAATGTTGG - Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993683539 5:90909469-90909491 GTCCAGCTGACCCACTCCATAGG + Intronic
998830557 5:146153658-146153680 GTGCTGCTGAACTACGCTGTGGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1002924358 6:1596184-1596206 GAGCAGCTGAACGTCACTGTGGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003097588 6:3154782-3154804 TTCCAGCTGACCCACTCTCTGGG - Exonic
1003101174 6:3177501-3177523 TTCCAGCTGACCCACTCTCTGGG - Intergenic
1003107128 6:3225670-3225692 TTCCAGCTGACCCACTCTCTGGG - Exonic
1003119638 6:3308982-3309004 GACCTGCCGATCCACACTGTGGG - Intronic
1004794428 6:19065190-19065212 GTTCAGATGAGCCATACTGTAGG - Intergenic
1006730060 6:36230092-36230114 GGCCAGCTGAGCCACCCTGGAGG - Intronic
1009553148 6:65125922-65125944 CTACATCTGAACCAAACTGTGGG + Intronic
1013062542 6:106649577-106649599 GTGCTGCTGAACTAAACTGTTGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017333183 6:153223521-153223543 CTCCATCTGACCCACTCTGTTGG - Intergenic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1020210850 7:6157215-6157237 GTGCAACGGAACCACACTGCAGG - Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1035942770 8:3921895-3921917 GTCCATCTGGTCCATACTGTTGG + Intronic
1036828011 8:11994010-11994032 CTCCAGCTGAAACATACAGTAGG + Exonic
1038280832 8:26162854-26162876 GTCCAGCAAATCCACACTATAGG + Intergenic
1040923325 8:52648991-52649013 GTCCAGTGTATCCACACTGTGGG - Intronic
1046819898 8:118622577-118622599 AGCCACCTGAACCACCCTGTAGG - Intergenic
1047517060 8:125564133-125564155 GTACCTCTGAACCCCACTGTTGG + Intergenic
1048133538 8:131723295-131723317 GTTCAGCTAAACTACACTGTTGG + Intergenic
1058383153 9:104401800-104401822 CTCCAGCTGAATCTCAGTGTTGG + Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1061449511 9:130660751-130660773 GTCCCCCTGAAGCGCACTGTCGG + Intergenic
1061964345 9:134004648-134004670 GGCCAGCTGGGCCACACTCTGGG - Intergenic
1187359372 X:18610366-18610388 GTCCATCTGGAACAAACTGTGGG - Intronic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1197110091 X:122762840-122762862 TTCCAGCAGACCCACAGTGTGGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1198512051 X:137361937-137361959 GTACAGCTATACCACAGTGTTGG + Intergenic