ID: 1092865709

View in Genome Browser
Species Human (GRCh38)
Location 12:12759034-12759056
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092865709_1092865716 14 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865716 12:12759071-12759093 CATCCTGTGCGGGAGGGAGCAGG 0: 1
1: 0
2: 4
3: 107
4: 1670
1092865709_1092865714 7 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865714 12:12759064-12759086 GGACTCACATCCTGTGCGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 88
1092865709_1092865712 3 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865712 12:12759060-12759082 AGGAGGACTCACATCCTGTGCGG 0: 1
1: 0
2: 1
3: 24
4: 203
1092865709_1092865715 8 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865715 12:12759065-12759087 GACTCACATCCTGTGCGGGAGGG 0: 1
1: 0
2: 8
3: 47
4: 161
1092865709_1092865718 18 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865718 12:12759075-12759097 CTGTGCGGGAGGGAGCAGGATGG 0: 1
1: 0
2: 4
3: 81
4: 972
1092865709_1092865713 4 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865713 12:12759061-12759083 GGAGGACTCACATCCTGTGCGGG 0: 1
1: 1
2: 5
3: 50
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092865709 Original CRISPR GTCCAGCTGAACCACACTGT AGG (reversed) Intronic