ID: 1092865713

View in Genome Browser
Species Human (GRCh38)
Location 12:12759061-12759083
Sequence GGAGGACTCACATCCTGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 1, 2: 5, 3: 50, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092865709_1092865713 4 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865713 12:12759061-12759083 GGAGGACTCACATCCTGTGCGGG 0: 1
1: 1
2: 5
3: 50
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092865713 Original CRISPR GGAGGACTCACATCCTGTGC GGG Intronic