ID: 1092865714

View in Genome Browser
Species Human (GRCh38)
Location 12:12759064-12759086
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092865709_1092865714 7 Left 1092865709 12:12759034-12759056 CCTACAGTGTGGTTCAGCTGGAC 0: 1
1: 0
2: 1
3: 18
4: 122
Right 1092865714 12:12759064-12759086 GGACTCACATCCTGTGCGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type