ID: 1092871284

View in Genome Browser
Species Human (GRCh38)
Location 12:12808004-12808026
Sequence CTCCAGAAGGAGAGGTCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092871284_1092871289 -5 Left 1092871284 12:12808004-12808026 CCCTTCGACCTCTCCTTCTGGAG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1092871289 12:12808022-12808044 TGGAGCCCATATATTGTTTCGGG 0: 1
1: 0
2: 0
3: 6
4: 117
1092871284_1092871288 -6 Left 1092871284 12:12808004-12808026 CCCTTCGACCTCTCCTTCTGGAG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1092871288 12:12808021-12808043 CTGGAGCCCATATATTGTTTCGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092871284 Original CRISPR CTCCAGAAGGAGAGGTCGAA GGG (reversed) Intronic
902005556 1:13229224-13229246 CTCCAGAAGCAGAGATGGAGTGG - Intergenic
903479623 1:23643867-23643889 CTCAAGAGAGAGAGGTCGTAGGG + Intergenic
903618735 1:24682188-24682210 CTCCGGAAGCAGAGGTTGCAGGG - Intergenic
903976526 1:27154009-27154031 ATCCAGAGGGAGATCTCGAAGGG + Exonic
904656118 1:32048931-32048953 CTCCAGAAGGCTAAGTCCAAGGG + Intronic
904984646 1:34534937-34534959 CTCCAGATGGAGTGATCCAAGGG - Intergenic
907690194 1:56656941-56656963 TTCCAGAAGAAGAGGACAAAGGG + Intronic
910553249 1:88500427-88500449 CTGCCAAAGGAGAGGTAGAAGGG + Intergenic
910750270 1:90621484-90621506 CTCAAGAAGAAGAGGGAGAAAGG - Intergenic
915393167 1:155562480-155562502 CTCCAGAGGGAGGGAGCGAAGGG + Exonic
915838215 1:159195021-159195043 CTCCACAAGAAGAGGATGAAGGG - Intronic
918820830 1:189252199-189252221 CTACAAAAGGAGAGGACAAAAGG + Intergenic
919127329 1:193410909-193410931 TGCCAGCAGGAGAGGTGGAATGG + Intergenic
1062970653 10:1645762-1645784 CTCCAGGAGGAGAGGCAGAGGGG - Intronic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1068556084 10:58460457-58460479 ATCCAGAAGTTGAGGTCAAAGGG - Intergenic
1068610892 10:59058732-59058754 CTCCTGAAGGAGAGATGCAAAGG - Intergenic
1069389901 10:67923664-67923686 CTCCAGAAGCTGAGGTAGAGAGG - Intronic
1071436920 10:85656031-85656053 CTCCGGAAGAAGAGCTGGAAGGG - Intronic
1072043214 10:91629392-91629414 CTCCACAAGGATACGTAGAATGG + Exonic
1078941039 11:16006067-16006089 ATCCAGGAGGAGAGGAGGAAAGG + Intronic
1080776612 11:35392747-35392769 TTCCAGAAGGGGAGGTCCTAAGG - Intronic
1082653590 11:55824997-55825019 CTCCAGAAGGGGAATTCAAAAGG + Intergenic
1084594522 11:70109070-70109092 CTCAAGAAGGAGGGGAGGAAAGG - Intronic
1084912297 11:72400588-72400610 CTAAAGAAGGAGAGGTGGAGAGG - Intronic
1088510824 11:110572920-110572942 TTCCAGAAGGAGAGAGCGTAAGG - Intergenic
1088731597 11:112688684-112688706 ATTGAGAAGGAGAGGTCAAAGGG + Intergenic
1089418191 11:118310974-118310996 CTCAAGAAGGAAAGGAGGAAAGG + Intronic
1089563444 11:119357360-119357382 ACCCAGAAGGAGAGGTTGGAGGG - Intronic
1090073149 11:123561383-123561405 CAGCAGAAGGAGAGGATGAAAGG + Intronic
1091107305 11:132934684-132934706 TTCCAGAAGTAGAAGTTGAAAGG - Intronic
1091555046 12:1566738-1566760 CTCCAGAAGGTGAGGGAGAGGGG - Exonic
1091745835 12:2992392-2992414 TCCCAGGAGGAGAGGTCAAAAGG - Intronic
1091746674 12:2997305-2997327 CTTCACAAGTAGAGGTGGAAGGG - Intronic
1092871284 12:12808004-12808026 CTCCAGAAGGAGAGGTCGAAGGG - Intronic
1094537411 12:31334474-31334496 CTCCAGAGGCTGAGGTGGAAGGG - Intergenic
1097221340 12:57452966-57452988 CCCCAGAGTGAGAGGTCGAGGGG + Intronic
1097661488 12:62435736-62435758 CTCCCTAAGGAAAGGACGAAAGG + Intergenic
1100180044 12:92075095-92075117 CACTAGAAGGGGAGGTTGAATGG + Intronic
1101755464 12:107617784-107617806 ATTCAGAAGGAGATGTAGAAGGG - Intronic
1102154575 12:110714465-110714487 CTTCAGATTGAGAGGTGGAATGG - Intergenic
1103516563 12:121512206-121512228 CTCCAGAAGGGCAGGTTGTAGGG + Intronic
1104198580 12:126565748-126565770 CTACAGAATGAGAGGGAGAAAGG - Intergenic
1104265865 12:127231972-127231994 CTCAGGAAGGAGAGCTGGAAAGG - Intergenic
1106355216 13:28975592-28975614 GTCCAGAAGGAGAGGAAGGATGG - Intronic
1106894029 13:34278411-34278433 GTCCAAAAGGAGATGTCCAAGGG - Intergenic
1108141635 13:47428749-47428771 CTCCAGAAGCAGAAGTTGACAGG - Intergenic
1112310148 13:98310910-98310932 CCTAAGAAGGAGAGGTCAAAGGG + Intronic
1112709518 13:102111245-102111267 CTCTAGTAGAAGAGGTAGAAAGG - Intronic
1112736725 13:102429428-102429450 TTCCAGAAGAAGAGGGGGAAAGG - Intergenic
1113885952 13:113658477-113658499 CTCCTGAAGGAGAGGAGGGAAGG - Intergenic
1113926979 13:113947087-113947109 CTACAGAAGGTGAGGTGGAGCGG + Intergenic
1119913317 14:78371378-78371400 CAGCAGAAGGGGAGGTGGAAGGG - Intronic
1121510760 14:94511616-94511638 CTTCCAAAGGAGAAGTCGAATGG - Intronic
1124173097 15:27395055-27395077 CTCCAGAAGGAGAGGGCAGAGGG - Intronic
1124714188 15:32043829-32043851 CTCAAGAAAGAGAAGTCTAAAGG - Intronic
1125390431 15:39186618-39186640 CTCCAGGAGCAGAGGAAGAACGG - Intergenic
1125477185 15:40055238-40055260 CTCCAGAAAGAGAGGGTGAGTGG + Intergenic
1126391909 15:48166455-48166477 CTACAGAAGGATAGGTCTATTGG - Intronic
1128469654 15:67941503-67941525 CTCCAGAAGGACAGGCAGGAGGG - Intergenic
1129038589 15:72665611-72665633 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129211301 15:74071619-74071641 CTCCCGAAGGAGAAGGCGGACGG - Exonic
1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129402709 15:75293744-75293766 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1130127022 15:81102558-81102580 CTTCAGAGGCAGAGGTAGAAGGG + Intronic
1130996856 15:88908893-88908915 CTCCAGAAGGAGGGGGCGGGGGG - Intronic
1132194718 15:99904858-99904880 CTCCAAAAGGAGAATTCGAAAGG + Intergenic
1132267493 15:100487612-100487634 AGCCTCAAGGAGAGGTCGAATGG + Intronic
1132377998 15:101344514-101344536 CTCCAGCAGGAGAGGAGGGAGGG - Intronic
1134063394 16:11212159-11212181 TTCCAGAAATAGAGGTCAAATGG + Intergenic
1134223123 16:12370918-12370940 TTCCAGAAGAACAGGTCAAAGGG - Intronic
1134872780 16:17666871-17666893 CAACAGAAGGAGAGGGGGAAAGG - Intergenic
1137916542 16:52437017-52437039 CTTCAGAAGTAGAGCTCGAATGG - Intergenic
1140830477 16:78746023-78746045 ATCCACAAGGAGAGGTGGAGGGG + Intronic
1141148287 16:81547222-81547244 CTCCAGAAAGAGAGACGGAAGGG + Intronic
1141657355 16:85423301-85423323 CTCCAGCCGGAGATGTCCAATGG + Intergenic
1141788965 16:86220092-86220114 CTTCGGAAGGAGGGGTCGGATGG - Intergenic
1143481637 17:7230561-7230583 CTCCAGAAGGAGAAGGCTGAGGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144187922 17:12813930-12813952 ACCAAGAAGGTGAGGTCGAAGGG - Intronic
1145881034 17:28352880-28352902 CTCAAGAAGGGGAGGTGGAATGG - Intronic
1147582935 17:41637049-41637071 GTAAAGAAGGAGAGGTCCAATGG + Intergenic
1147910638 17:43853937-43853959 CTGCAGGAGGAGAGGTCGCTGGG - Exonic
1150172425 17:63012757-63012779 CTCCAGAATCTGAGGTGGAAGGG - Intronic
1150386149 17:64762471-64762493 CTCCAGCAGGAGAGTTCAAATGG - Intergenic
1150753928 17:67893587-67893609 CTCCAGCAGGAGAGTTCAAATGG + Exonic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1158390940 18:57044428-57044450 CCCCAGAGGGAGATGACGAAGGG + Intergenic
1158392668 18:57056310-57056332 GTGCAGAAGGAGAGGGCGATGGG + Intergenic
1164055420 19:21618081-21618103 CTCTGGAAGGAGAAGACGAAGGG - Intergenic
1165162627 19:33826729-33826751 TTGCAGAAGGTGAGGTCGCAGGG + Intergenic
926204140 2:10823088-10823110 CTCCAGAAGTAGAGGTGGCCTGG + Intronic
926853182 2:17223439-17223461 GGCCAGTGGGAGAGGTCGAAGGG - Intergenic
927622198 2:24673441-24673463 CTCCAAAAGAAGAGGTCCCAAGG - Exonic
929139531 2:38654830-38654852 CTCCAGAAGGAGAGAGAGAGAGG - Intergenic
932965559 2:76471041-76471063 CTCATGAAGGAGAGATTGAATGG + Intergenic
934526879 2:95057440-95057462 CTCCAGAAGGGAAGATCGATGGG - Intergenic
937671457 2:124541842-124541864 ATCCAGAAGAAGAGGTCTCAAGG + Intronic
939060130 2:137411842-137411864 CTGCAGAAGGAGGGGTCAACAGG - Exonic
940701130 2:157044055-157044077 CCCCAGAAGCAGAGGTTGAGAGG - Intergenic
941905721 2:170715434-170715456 CACCCGAAGGCGAGGACGAAGGG - Exonic
944284176 2:197929572-197929594 CTTCAGAAGGTTAGGTAGAAGGG + Intronic
1172830963 20:37833972-37833994 ATCCAGATAGAGAGGTAGAAGGG + Intronic
1173010138 20:39174942-39174964 TTCCAGCAGGAGAGGGCCAATGG - Intergenic
1173151357 20:40569069-40569091 CTGCAGATGGAGATGTAGAAAGG - Intergenic
1174145821 20:48451799-48451821 CTCCAGAAGGAGAGCACAGAAGG + Intergenic
1175515609 20:59568132-59568154 CTCCAGAACGAGAGGACCCAGGG + Intergenic
1175940631 20:62536036-62536058 CTCCAGAAGCAGAGTTGGGAGGG - Intergenic
1178121938 21:29477993-29478015 CTCCAGAAGGACAGAACTAATGG + Intronic
1180172574 21:46067495-46067517 TTCCAGAAGCAGAGGCCGGATGG + Intergenic
1182527340 22:30928731-30928753 CTCCAGGGGGAGAGGTAGGAAGG + Intronic
1183983326 22:41555385-41555407 GTTCAGAAGGTGAGGACGAAGGG + Intergenic
1184586392 22:45450988-45451010 CTGCAGAAAGAGATGTCAAATGG + Intergenic
1185016460 22:48346038-48346060 TTGCAGAAGGTGAGGTCGAAGGG + Intergenic
949756189 3:7413509-7413531 CAGCAGAAGCAGAGGTCAAATGG - Intronic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
951140175 3:19148661-19148683 GTCCAGAAGGATGGTTCGAAAGG - Exonic
952728727 3:36617289-36617311 CTCCAGAAGGAGAGAGTGAGAGG + Intergenic
955217679 3:56997706-56997728 CCCCAGTAGGAGATGACGAAGGG + Intronic
959696709 3:109256168-109256190 CTCTAGAGGGAGAGGACTAATGG + Intergenic
963433390 3:145237610-145237632 CTGGAGAAGGAGAGGCAGAATGG - Intergenic
965190622 3:165523556-165523578 CTCAAGAAGGAGAAGTCAGAGGG - Intergenic
971682643 4:29720895-29720917 CTCAAGATGGAAAGGTCAAAAGG - Intergenic
978850028 4:113323845-113323867 ATGCAGAAGGAGATGGCGAAAGG - Intronic
979028891 4:115613856-115613878 CTCCAGAAGCTGAGGTTGGAAGG + Intergenic
979327144 4:119393542-119393564 CTGCAGAAGGAGTCGTCGTATGG - Intergenic
981549865 4:145932908-145932930 CTCTATTAGGAGAGTTCGAAGGG - Intronic
982103628 4:151992643-151992665 CTTCAGGAGCAGAGGTGGAAGGG - Intergenic
986949384 5:13063369-13063391 CTCCAGACTGAGAGTTCTAAAGG - Intergenic
987160809 5:15140230-15140252 CTCCTGAAGGAGAAGTCTCAGGG - Intergenic
990378054 5:55192916-55192938 GTCCAGAAGCAGAGGTGGGAGGG - Intergenic
993896516 5:93541696-93541718 CTCAAGCAGGACAGGTGGAAAGG - Intergenic
997872046 5:137514862-137514884 CTCTAGAAGGAGAAGTTGCAGGG + Intronic
999382842 5:151133717-151133739 CTCCAGAAAGAAAGGAAGAAAGG - Intronic
999879584 5:155846874-155846896 CTCATGAAGGAGAGGTTGAGAGG - Intergenic
1003578696 6:7320081-7320103 CTCAAGAATGAGAGGAGGAAAGG - Intronic
1004494571 6:16151418-16151440 CGCCTGAAGGAGGGGTCCAAGGG + Intergenic
1006455984 6:34132192-34132214 TTCCAGAAGGAAAGGGAGAAAGG + Intronic
1007934063 6:45717583-45717605 CTTCAGATGTAGAGGTCAAAAGG - Intergenic
1010828241 6:80498739-80498761 GTGCAGAAGGAGAGGAGGAAGGG + Intergenic
1010971101 6:82264313-82264335 CTCCAGGAGGTGAGGTCCACAGG - Intergenic
1012769036 6:103405274-103405296 CAGCAGAAGGAGAGCTGGAAAGG + Intergenic
1014043720 6:116859348-116859370 CTCCAGAAAGATAGGACAAATGG - Intergenic
1016564552 6:145438547-145438569 CTCCAGAGGCAGAGGTTGCAGGG - Intergenic
1018903260 6:168061656-168061678 CCCCAGATGCTGAGGTCGAAGGG - Intronic
1024009701 7:45257214-45257236 CTCCAGAAGGAAGGGTTGCACGG - Intergenic
1024578626 7:50783935-50783957 CTCCAAAAGGAGAGGTTCCACGG + Intronic
1025932904 7:66010686-66010708 ATCCAGAAGGAGATGAAGAAGGG - Intergenic
1025950479 7:66141567-66141589 ATCCAGAAGGAGATGAAGAAGGG + Intronic
1028900990 7:96100408-96100430 CTCAAGAAGGAGAGAGGGAAAGG - Intronic
1030322133 7:108180212-108180234 CTCCAGAAGGAGGTATGGAATGG - Exonic
1031631183 7:124044968-124044990 CTCAAGTAGGAGGGGTCCAAAGG - Intergenic
1033415414 7:141157308-141157330 CTCCAGCATGAGAGGAGGAAGGG - Intronic
1035355263 7:158272812-158272834 CGGCAGAAGGAGAGGTGGGAAGG + Intronic
1035701004 8:1639266-1639288 CTCCAGAAGGAGCAGTGGAAAGG + Intronic
1037751363 8:21684508-21684530 CTTCAGAGGGAGAGGTCAGAGGG - Intergenic
1037825862 8:22160217-22160239 CTCCAGATGGAGAGGGGGACAGG + Intronic
1038677302 8:29634992-29635014 GTCCAGAAGGAGAGAGAGAATGG + Intergenic
1038998908 8:32957732-32957754 CTCCAAAAGGAGAGGAGAAAAGG - Intergenic
1039491092 8:37947955-37947977 ATCCATATGGAGAGGTCTAAGGG + Intergenic
1040930358 8:52728177-52728199 CTCCAGAAGAAGAAATCTAATGG + Intronic
1041830166 8:62144491-62144513 CTCCAGAAGGAGATGTCCATGGG - Intergenic
1042943108 8:74127305-74127327 CACCAGAAGGAGAGGAACAAAGG + Intergenic
1044844803 8:96370381-96370403 CTTCAGTAGGAGTGGTAGAAGGG - Intergenic
1045382755 8:101643618-101643640 GGCCAGAGGGAGAGGTGGAATGG + Intronic
1045569109 8:103351516-103351538 ATTCAGAAGGAGAGGTCGAGGGG + Intergenic
1047133524 8:122050186-122050208 CTACAGAGGGAGTGGTAGAAAGG + Intergenic
1051507959 9:17846201-17846223 CTGCAGAAAGAGAGGGGGAAAGG - Intergenic
1059079505 9:111233552-111233574 CTCCTGCAGGGGAGGTCAAAGGG - Intergenic
1062328765 9:136026457-136026479 CCCCAGAAGGAGAGGAGGAGAGG + Intronic
1187389400 X:18875906-18875928 CTCCAGGAGGAGTGGTGGAAAGG + Intergenic
1188786560 X:34353642-34353664 CTCTAGAAGGACAGGACTAATGG - Intergenic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1197613123 X:128660808-128660830 CTCCTGAAGGAGAAGTCTCAGGG + Intergenic
1200237771 X:154477057-154477079 CCCCAGCAGGAGAGGATGAACGG + Intergenic