ID: 1092871550

View in Genome Browser
Species Human (GRCh38)
Location 12:12810273-12810295
Sequence CCCAACAATCTAAGAGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 493}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092871550_1092871562 20 Left 1092871550 12:12810273-12810295 CCCTTGTCTCTTAGATTGTTGGG 0: 1
1: 0
2: 1
3: 28
4: 493
Right 1092871562 12:12810316-12810338 GTAGGGTACCCAAAGTCCGGTGG 0: 10
1: 11
2: 17
3: 15
4: 48
1092871550_1092871555 2 Left 1092871550 12:12810273-12810295 CCCTTGTCTCTTAGATTGTTGGG 0: 1
1: 0
2: 1
3: 28
4: 493
Right 1092871555 12:12810298-12810320 CCAGCCTCAACACCACCCGTAGG 0: 16
1: 26
2: 13
3: 12
4: 132
1092871550_1092871556 3 Left 1092871550 12:12810273-12810295 CCCTTGTCTCTTAGATTGTTGGG 0: 1
1: 0
2: 1
3: 28
4: 493
Right 1092871556 12:12810299-12810321 CAGCCTCAACACCACCCGTAGGG 0: 18
1: 22
2: 14
3: 7
4: 90
1092871550_1092871565 29 Left 1092871550 12:12810273-12810295 CCCTTGTCTCTTAGATTGTTGGG 0: 1
1: 0
2: 1
3: 28
4: 493
Right 1092871565 12:12810325-12810347 CCAAAGTCCGGTGGCAACAAAGG 0: 2
1: 4
2: 13
3: 21
4: 110
1092871550_1092871560 17 Left 1092871550 12:12810273-12810295 CCCTTGTCTCTTAGATTGTTGGG 0: 1
1: 0
2: 1
3: 28
4: 493
Right 1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG 0: 9
1: 12
2: 9
3: 12
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092871550 Original CRISPR CCCAACAATCTAAGAGACAA GGG (reversed) Intronic
902863730 1:19263730-19263752 CCCAACACTTTGGGAGACAAAGG - Intergenic
903481851 1:23659397-23659419 CCCAGCAATTTAAGAGGCCAAGG + Intergenic
904210121 1:28881640-28881662 CACAACAATTTAGGAGACCAAGG - Intergenic
904502616 1:30924460-30924482 CCCAGCAATTTAAGAGGCTAAGG - Intergenic
904938758 1:34150333-34150355 CCCAGCACTCTGAGAGACTAAGG - Intronic
905445496 1:38026139-38026161 CCCAACAAGCCAAGAGTCTAGGG - Intergenic
906709347 1:47917468-47917490 CCCAACACTCTGAGAGGCCAAGG + Intronic
907201795 1:52733421-52733443 CCCAACACTTTGGGAGACAAAGG + Intronic
907336540 1:53703384-53703406 CCCAACATTTTAAGAGGCCAAGG + Intronic
907476935 1:54712139-54712161 CCCAACACTTTAAGAGGCCAAGG + Intronic
910635714 1:89405365-89405387 CCCAGCAAGCTAAGAAACACTGG - Intergenic
911025405 1:93430929-93430951 CCCAACACTCTGGGAGACCAAGG - Intergenic
911408688 1:97473754-97473776 CCCAACAATTTGAGAGGCCAGGG + Intronic
912000279 1:104824602-104824624 CCCAACACTCTAGGAGGCCAAGG + Intergenic
912037102 1:105331710-105331732 CCCAACATTTTAGGAGACCAAGG + Intergenic
912076731 1:105884601-105884623 CCCAACAAGCTAAGATACAATGG - Intergenic
912102467 1:106227924-106227946 CCCTTCAGTCTAAGAGTCAAGGG + Intergenic
912369577 1:109163647-109163669 CCCAACACTTTGAGAGACCAAGG - Intronic
912549393 1:110475165-110475187 CCCAACAATTTGAGAGACTGAGG - Intergenic
913036304 1:114969557-114969579 CCCAACAAGCTAAGATCCACTGG - Intronic
913108663 1:115639385-115639407 CCCAACAAGCTAAGATCCACTGG - Intergenic
914193748 1:145432696-145432718 CCCAACACTTTAGGAGGCAAAGG - Intergenic
914356996 1:146895063-146895085 CCCAACACTTTGAGAGACCAAGG + Intergenic
914475077 1:148015562-148015584 CCCAACACTTTAGGAGGCAAAGG - Intergenic
916308788 1:163370925-163370947 CCCAAGAAGCTCATAGACAATGG - Intergenic
916920648 1:169462539-169462561 CCCAATAATTTGGGAGACAAAGG + Intergenic
917347135 1:174039953-174039975 CCCAACACTTTGAGAGACCAAGG + Intergenic
917400439 1:174643033-174643055 CCCAACACTCTGAGAGACCGAGG - Intronic
918546563 1:185691136-185691158 CCCAACACTCTGAGAGGCCAAGG - Intergenic
920023335 1:202972556-202972578 CCCAACACTCTAGGAGGCCAAGG - Intergenic
921008349 1:211115882-211115904 CCCAACACTTTAAGAGGCCAAGG + Intronic
921420336 1:214939831-214939853 CCCAACACTCTAGGAGGCCAAGG - Intergenic
921631338 1:217437460-217437482 CCCAACAAGCTAAGATCCACAGG + Intronic
921976325 1:221207127-221207149 CCCAACAAGCTAAGATCCATGGG + Intergenic
922066204 1:222146001-222146023 CCCAACAAACTAAGATCCACTGG + Intergenic
922143486 1:222914706-222914728 CCCAGCAATCTGAGAGGCCAAGG + Intronic
922174032 1:223181108-223181130 CACCACACACTAAGAGACAAGGG + Intergenic
922396790 1:225210238-225210260 CCCAGCAAGCTAAGATCCAATGG + Intronic
922957564 1:229616454-229616476 CCCAACAATTTGGGAGACTAAGG - Intronic
923061250 1:230476541-230476563 CCCAACAAGCTAAGATCCACTGG - Intergenic
923514490 1:234683211-234683233 CCCAACACTCTGAGAGGCCAAGG + Intergenic
923705228 1:236338511-236338533 CCCAACACTCTAGGAGGCCAAGG + Intergenic
924767933 1:247051444-247051466 CCCAACAAGCTAAAAGAGATTGG - Intronic
1064431689 10:15276798-15276820 CCCAACTATTTGAGAGACTAAGG - Intronic
1064601162 10:16994837-16994859 CCCAACACTTTAGGAGACCAAGG + Intronic
1065004390 10:21366151-21366173 CCCAACTATCTAGGAGACAGAGG + Intergenic
1065946603 10:30610681-30610703 CCCAACAATCTGGGAGGCCAAGG - Intergenic
1067749035 10:48957835-48957857 ACAAACAATCTAGGAGACCACGG + Intronic
1069093481 10:64229861-64229883 CCCAACAAGCTAAGATCCACTGG - Intergenic
1070294802 10:75151600-75151622 CCCAACACTTTAAGAGGCCAAGG - Intronic
1070299506 10:75192984-75193006 CCCAACACTTTGAGAGACCAAGG - Intergenic
1070581765 10:77725675-77725697 CCCAACACTTTGAGAGACCAAGG + Intergenic
1070974365 10:80594159-80594181 CCCAACAATCTAAGAAAGCATGG - Intronic
1070998399 10:80806918-80806940 CCCAACAATATGGGAGAAAATGG + Intergenic
1071266034 10:83965757-83965779 CCCAACATTATAAGAGGCCAAGG + Intergenic
1071341356 10:84651863-84651885 CCCAACAAGCTAAGATCCACTGG - Intergenic
1072433835 10:95397616-95397638 CCTAGAAATATAAGAGACAAAGG + Intronic
1072712883 10:97729021-97729043 CCCAGCACTCTGGGAGACAAAGG - Intergenic
1072748205 10:97957063-97957085 CCCAACACTTTAAGAGGCCAAGG - Intronic
1073211911 10:101810939-101810961 CCCAACACTGTAAGAGGCTAAGG - Intronic
1074361147 10:112824887-112824909 CCCAACAAAGTAAGAGCCAAAGG + Intergenic
1074525431 10:114259316-114259338 ACCAACAATCCAACAGAAAATGG - Intronic
1074929641 10:118111271-118111293 CCCAACACTTTGAGAGGCAAAGG + Intergenic
1075567233 10:123513675-123513697 CCCACCAAGCTCAGAGAGAAAGG - Intergenic
1077580088 11:3411686-3411708 CCCAACACTGTAAGAGGCAGAGG - Intergenic
1078392909 11:10952176-10952198 CCCAACAAGCTAAGATCCACTGG - Intergenic
1078676108 11:13415904-13415926 CCCAGCACGCTAAGAGACCAAGG - Intronic
1079248621 11:18771471-18771493 CAGAACAAAGTAAGAGACAAAGG - Intronic
1079303458 11:19300548-19300570 ACCAACCATCTAAGAATCAAAGG - Intergenic
1079867903 11:25758520-25758542 CCCAGCAAGCTAAGATACACTGG + Intergenic
1080710051 11:34738061-34738083 CCCAACAAGCTAAGATCCACTGG + Intergenic
1081178774 11:39961742-39961764 CCTAACAATCTAAAAAACATGGG - Intergenic
1081198789 11:40192680-40192702 CCCAACAAGCTAAGATCCACTGG + Intronic
1081293350 11:41353845-41353867 CGCAACAATCTAGGAGTCGAAGG + Intronic
1081363287 11:42205576-42205598 CCCAACAAGCTAAGATCCACTGG + Intergenic
1082083594 11:48031119-48031141 ACCAAGAATCTAACAGGCAATGG - Intronic
1082699684 11:56412331-56412353 CCCAACACTCTGAGAGGCCAAGG - Intergenic
1084748086 11:71185951-71185973 CCCAACAATGGAAAATACAATGG + Intronic
1085102936 11:73816712-73816734 CCCAACAATTTAGGAGGCCAAGG - Intronic
1085152066 11:74260232-74260254 CCCAACATCATAAGAGACAGAGG + Intronic
1085671409 11:78467957-78467979 CCCAACACTTTAAGAGGCCAAGG - Intronic
1085975980 11:81655674-81655696 CTCAACAAACTAGGAAACAAAGG - Intergenic
1087566747 11:99869355-99869377 CCCAACAATCTATAACACAAAGG - Intronic
1087830985 11:102819802-102819824 CCCAACAAGCTAAGACCCACTGG - Intergenic
1087848886 11:103005429-103005451 CCCAGCACTCTAAGAGGCCAAGG + Intergenic
1088092472 11:106058672-106058694 CCCAACACCCTAAGAGGCCAAGG - Intronic
1088216537 11:107516766-107516788 CCCAACACTTTGGGAGACAAAGG + Intronic
1088246124 11:107820003-107820025 CCCAGCAATTTAAGAGGCCAAGG + Intronic
1088871707 11:113895898-113895920 CCCAACAATTTGAGAGGCTAAGG + Intergenic
1088918482 11:114244787-114244809 CCTAACAATTTAAAAAACAAAGG - Intronic
1089277529 11:117348220-117348242 CCCAACACTCTAGGAGATCAAGG - Intronic
1090155471 11:124433134-124433156 CCCAACACTTTCAGAGACCAAGG + Intergenic
1090416345 11:126543208-126543230 TCCAACAATCAGAGAGACTAGGG - Intronic
1090781354 11:130009925-130009947 CCCAACAATTTGGGAGGCAAAGG + Intergenic
1092861207 12:12720675-12720697 CCAAACAATCTAAAACACACAGG - Intronic
1092871550 12:12810273-12810295 CCCAACAATCTAAGAGACAAGGG - Intronic
1092900943 12:13058879-13058901 CACTATAATCTAAGAGGCAATGG - Intronic
1093016010 12:14155467-14155489 CCCAACACTCTGAGAGGCCAAGG + Intergenic
1093022237 12:14214557-14214579 CCCAGCAAAATAAGACACAAAGG + Intergenic
1093545056 12:20336523-20336545 CCCAACAAGCTAAGATCCACTGG - Intergenic
1093557814 12:20498217-20498239 CCCACCAATCTATGAGACTTGGG - Intronic
1093705945 12:22275301-22275323 CCCAACAATTTGAGAGGCCAAGG + Intronic
1093918160 12:24829131-24829153 CCCAACAATTTAGGAGGCCAAGG + Intronic
1094140037 12:27171787-27171809 CCCAACAAGCTAAGATACACTGG - Intergenic
1094423805 12:30298689-30298711 TCCAACTATGTAAGAGAAAATGG + Intergenic
1094590338 12:31813706-31813728 CCCAACAATTTAGAAGACCATGG + Intergenic
1094621264 12:32082686-32082708 CCCAACACTTTGAGAGACCAGGG - Intergenic
1095674233 12:44897844-44897866 CCCAACAAGCTAAGATCCACTGG + Intronic
1096362740 12:51002230-51002252 CCCAACTATTCAAGAGACAGAGG + Intronic
1096640371 12:52989587-52989609 CCCAGCACTCTGAGAGACCAAGG + Intergenic
1096702754 12:53396877-53396899 CCCAGCACTCTGGGAGACAAAGG - Intronic
1097669462 12:62518607-62518629 CCCACCAATTAAAGGGACAAAGG - Intronic
1098922853 12:76318660-76318682 CCCAAGAATGTATGAAACAACGG + Intergenic
1099425017 12:82513396-82513418 CCCAGCACTTTAAGAGACCAAGG + Intergenic
1099528171 12:83741233-83741255 CCCAGCAAGCTAAGAGCCACTGG + Intergenic
1099564267 12:84220895-84220917 ACAAACAATCCAAGAGAAAATGG - Intergenic
1100434053 12:94555434-94555456 CCCAACACTCTGGGAGACCAAGG - Intergenic
1100589487 12:96012459-96012481 CCCAACACTCTGGGAGACAAAGG + Intronic
1101069871 12:101062797-101062819 CCCAGCAAGCTAAGAGCCACAGG - Intronic
1102085859 12:110139083-110139105 CCCAACATTTTAGGAGGCAAAGG + Intronic
1102148207 12:110670419-110670441 CCCAAAACTCTAAGACACAATGG + Intronic
1102266759 12:111492431-111492453 CCCAACACTCTGAGAGGCCAAGG + Intronic
1102380739 12:112464673-112464695 CCCAACACTTTCAGAGACCAAGG - Intronic
1103371030 12:120419658-120419680 CCCAACACTCTGAGAGGCCAAGG + Intergenic
1104115606 12:125746458-125746480 CCCAGCAAGCTAAGATACACTGG - Intergenic
1105552485 13:21410773-21410795 CCCAACAAGCTAAGATCCACTGG - Intronic
1106025801 13:25954084-25954106 CCCAACAAGCTAAGATCCACTGG + Intronic
1106118416 13:26837344-26837366 CCCCACAAGCCAAGAGGCAAGGG - Intergenic
1108383796 13:49879603-49879625 CCCAACAAGCTAAGATCCACTGG + Intergenic
1108896184 13:55332229-55332251 CCCAGCAATTTAAGAGGCAGAGG + Intergenic
1109229601 13:59740890-59740912 ACCAACAATCTTTGAGAAAATGG - Intronic
1109271284 13:60258501-60258523 CCCAACAAGCTAAGATCCACTGG + Intergenic
1109293729 13:60505167-60505189 CCCAACAAGCTAAGATCCACTGG + Intronic
1112116215 13:96357770-96357792 CCCAACACTTTAAGAGGCCAAGG - Intronic
1115691035 14:35844099-35844121 CCCAGCAAGCTAAGATCCAATGG - Intronic
1115981222 14:39053880-39053902 CCCAACACTCTGGGAGACTAAGG + Intronic
1116815722 14:49581776-49581798 CCCAACACTTTGAGAGACCAAGG + Intronic
1117245640 14:53882982-53883004 CCAAAGAATCAAAGAAACAAAGG + Intergenic
1117299264 14:54407759-54407781 CCCAACAAGCTAAGATCCACTGG - Intronic
1117903917 14:60565008-60565030 CCCAACAGTTTAAGAGGCCAAGG + Intergenic
1117930545 14:60837134-60837156 CCCAGCAAGCTAAGAAACACTGG - Intronic
1117976920 14:61308088-61308110 CCCAACACTCTGGGAGACCAAGG - Intronic
1119582851 14:75803087-75803109 CTCCATCATCTAAGAGACAAAGG - Intronic
1120254155 14:82096836-82096858 CCCAGAAATCTAGGAGACCAAGG - Intergenic
1120334012 14:83130472-83130494 CACAACAATATAAGATAGAAGGG + Intergenic
1120770108 14:88370097-88370119 CCCAACAAGCTAAGATCCACTGG + Intergenic
1121685836 14:95834339-95834361 CCCATCAATCTCAGAGCCGATGG - Intergenic
1121796451 14:96740229-96740251 CCCAACAATAAGAGAGACCAGGG + Intergenic
1121965497 14:98299990-98300012 ACCAACACTCAAAGAGATAAAGG + Intergenic
1122224218 14:100264113-100264135 CCCAACAATTTGAGAGACCGAGG - Intronic
1122757894 14:103997236-103997258 CACAAGAATCTAGGCGACAATGG + Intronic
1123144354 14:106113933-106113955 CCCAGAAATCAAAAAGACAAGGG + Intergenic
1123802018 15:23831235-23831257 CCCAACACTTTAGGAGACCAAGG - Intergenic
1125307004 15:38328968-38328990 CCCAACACTTTGAGAGACCAAGG - Intronic
1125829383 15:42703043-42703065 CCCAACACTTTAGGAGACTATGG - Intronic
1125974988 15:43943328-43943350 CCCAACACTTTAGGAGACCAAGG - Intronic
1126137684 15:45408098-45408120 ACCAACAGTCCAAGAGAAAATGG + Intronic
1126155557 15:45562668-45562690 CCCAGCATTTTAAGAGACCAAGG + Intergenic
1126817831 15:52471351-52471373 CCCAGCACTCTGAGAGACCAAGG + Intronic
1126973624 15:54148919-54148941 CCAAACCATATAAAAGACAACGG - Intronic
1127010286 15:54618315-54618337 CCCAATAATGTTAGTGACAAAGG + Intronic
1127307884 15:57725917-57725939 CCCAACACTGTAAGAGGCCAAGG - Intronic
1127831356 15:62754261-62754283 CCTAACACACTAAGAGCCAAGGG - Intronic
1127876609 15:63117055-63117077 CCCAGCAATCTAGGAGGCCAAGG - Intergenic
1127948911 15:63785172-63785194 CCCAACATTTTAAGAGGCCAAGG + Intronic
1127953090 15:63829166-63829188 CCCAACACTCTGAGAGGCCAAGG + Intronic
1128688136 15:69702383-69702405 CCCAACATTCCAAGAGAACAGGG - Intergenic
1129353184 15:74969518-74969540 CCCAACACTTTAAGAGACCGAGG - Intronic
1129586516 15:76872997-76873019 CCCAACACTCTGGGAGACTAAGG + Intronic
1130006491 15:80104090-80104112 CCCAACATTCTGGGAGACCAAGG - Intronic
1131756732 15:95572228-95572250 GTCAATATTCTAAGAGACAAAGG + Intergenic
1131918634 15:97299213-97299235 CCCTACAGTCTAGGAGATAATGG - Intergenic
1132096406 15:98988218-98988240 CCCAACAAGCTAAGATCCACTGG + Intronic
1133092771 16:3417634-3417656 CCCAGCAATCTGGGAGACCAAGG + Intronic
1133515152 16:6501642-6501664 CCAAACATTCTTATAGACAAGGG + Intronic
1133676365 16:8076844-8076866 CCCAACAATTTGGGAGACCAAGG + Intergenic
1133756339 16:8765079-8765101 CCCAACACTCTGAGAGGCAAAGG + Intronic
1134053353 16:11153025-11153047 CCCAAGAACCCAAGACACAATGG - Intronic
1134480591 16:14615648-14615670 CCCAGCACTTTAAGAGGCAAAGG + Intronic
1135118763 16:19747026-19747048 CCCAGCAATTTAAGAGGCCAAGG + Intronic
1136173829 16:28504225-28504247 CCCAACAATTTAGGAGACCGAGG + Intronic
1136694842 16:32069053-32069075 CCCAGAAATCAAAAAGACAAAGG - Intergenic
1136705211 16:32182163-32182185 CCCAGCACTCTAAGAGGCCAAGG + Intergenic
1136762702 16:32747243-32747265 CCCAGCACTCTAAGAGGCCAAGG - Intergenic
1136790131 16:32962835-32962857 CCCAACACTCTGGGAGACCAAGG + Intergenic
1136795343 16:33012315-33012337 CCCAGAAATCAAAAAGACAAAGG - Intergenic
1136805398 16:33123143-33123165 CCCAGCACTCTAAGAGGCCAAGG + Intergenic
1136874577 16:33842068-33842090 CCCAGAAATCAAAAAGACAAAGG + Intergenic
1136879682 16:33891093-33891115 CCCAACACTCTGGGAGACCAAGG - Intergenic
1137505937 16:49053725-49053747 CCCAACACTTTAAGAGGCCAAGG + Intergenic
1138743439 16:59336224-59336246 CCCAACCATATAAAAGTCAAAGG - Intergenic
1141075090 16:80998623-80998645 CCCAAGAGTCCAACAGACAATGG + Intronic
1203064858 16_KI270728v1_random:1007562-1007584 CCCAGCACTCTAAGAGGCCAAGG - Intergenic
1203092338 16_KI270728v1_random:1224289-1224311 CCCAACACTCTGGGAGACCAAGG + Intergenic
1203097598 16_KI270728v1_random:1273975-1273997 CCCAGAAATCAAAAAGACAAAGG - Intergenic
1142829803 17:2540150-2540172 CCCAACACTTTAGGAGACCAAGG - Intergenic
1144137199 17:12307834-12307856 CCCAACAATTTAGGAGGCCAAGG - Intergenic
1144298423 17:13900735-13900757 CCCAACAATTTGAGAGGCCAAGG + Intergenic
1144414962 17:15037822-15037844 CCCAGCACTCTAAGAGTCCAAGG + Intergenic
1146825945 17:36023450-36023472 CCCAACAAGCTAAGATCCACTGG - Intergenic
1147152391 17:38525418-38525440 CCCAACACTCTGGGAGACTAAGG + Intergenic
1147180726 17:38683901-38683923 CCCAGCACTTTGAGAGACAAAGG + Intergenic
1147281432 17:39364360-39364382 CCCAACAATCTGGGAGGCCAAGG + Intronic
1148574076 17:48695934-48695956 CCCAACACTCTGGGAGACCAAGG - Intergenic
1148631354 17:49111875-49111897 CCCAACACTTTGGGAGACAAAGG - Intergenic
1148930951 17:51126906-51126928 CCCAACACTTTAAGAGGCCAAGG - Intergenic
1148967374 17:51447200-51447222 CCCAACAAGCTAAGATCCACTGG + Intergenic
1149267715 17:54945516-54945538 CCCAAACACCTATGAGACAATGG - Intronic
1150454465 17:65295580-65295602 ACCAACTATCTAAGGGACACAGG + Intergenic
1150545770 17:66155624-66155646 CCCAACAAGCTAAGATCCAACGG + Intronic
1150711930 17:67538347-67538369 CCCAACAATTTGAGAGGCCAAGG + Intronic
1153364894 18:4244642-4244664 CCCAAATATTTAAGAGACAATGG + Intronic
1153394121 18:4598599-4598621 ACCAAGAATCAAAGAGAAAATGG - Intergenic
1154160605 18:11978600-11978622 CCCAACACTTTAGGAGACAAAGG - Intergenic
1155035191 18:22020054-22020076 CCCAACAATTTGGGAGACCAAGG - Intergenic
1155223406 18:23705928-23705950 CCCCAGAATGTAAGAGACAGAGG - Intronic
1155274847 18:24176918-24176940 CCCAACACTCTTAGACACCAGGG + Intronic
1155456031 18:26014404-26014426 TGCAACAATAGAAGAGACAAAGG + Intergenic
1155848796 18:30744419-30744441 CCCAGCACTCTGAGAGGCAAAGG + Intergenic
1156415145 18:36879942-36879964 CCCAACAAGCTAAGATCCACCGG - Intronic
1157086454 18:44585374-44585396 CCCAACACTTTGGGAGACAAAGG + Intergenic
1157363890 18:47045571-47045593 CCCAGCAATCTGGGAGACCAAGG - Intronic
1159581318 18:70236945-70236967 CCCAACAAGCTAAGATCCACTGG + Intergenic
1159583897 18:70264373-70264395 CCCAGCAATTTGAGAGACACAGG - Intergenic
1160212465 18:76893761-76893783 CCCAACACTCTGAGAGGCCAAGG - Intronic
1161506661 19:4647876-4647898 CCCAACACTTTAAGAGGCCAAGG - Intronic
1162010655 19:7812113-7812135 CCCAACAGACTAAGAGAGAAAGG + Intergenic
1162268835 19:9597680-9597702 CCCAACAATGTAGGAGGCCAAGG - Intergenic
1162839839 19:13348400-13348422 CACAAGAATAAAAGAGACAAAGG + Intronic
1163781895 19:19254875-19254897 CCCAGCACTTTAAGAGACCAAGG - Intergenic
1163893135 19:20034526-20034548 CCCAACACTTTAAGAGACCGAGG + Intronic
1164869887 19:31633788-31633810 CCCACCATTCTCCGAGACAAGGG - Intergenic
1164950865 19:32335921-32335943 CCCAACAATTTGAGAGGCCAAGG + Intergenic
1165007910 19:32821626-32821648 CCCAACACTCTTAGAGGCCAAGG - Intronic
1165343000 19:35225559-35225581 CCCAACACTTTCAGAGGCAAAGG + Intronic
1165821661 19:38680428-38680450 CCCAGCAATCTGGGAGCCAAAGG - Intronic
1166796033 19:45426706-45426728 CCCAACAATTTAGGAGGCCAAGG + Intronic
1167121187 19:47517931-47517953 CCCAACACTCTGGGAGACCAAGG + Intergenic
1167407336 19:49321337-49321359 CTCAACAATCTAGGAGTTAAAGG + Intronic
1167893821 19:52564701-52564723 CCCAACACTCTGAGAGGCCAAGG + Intronic
1168256480 19:55168662-55168684 CCCAACACTTTGAGAGACCAAGG - Intergenic
925734232 2:6946638-6946660 TCTAATAACCTAAGAGACAAAGG - Intronic
926449884 2:12989842-12989864 CCCAACAATTTGAGAGGCCAAGG - Intergenic
927557176 2:24043393-24043415 CCCAACAATTTAGGAGGCCAAGG + Intronic
927589237 2:24338739-24338761 CCCAACAACTCAAGAGACTAAGG + Intronic
928508733 2:31982046-31982068 CCCAACACTTTGAGAGACCAAGG + Intronic
928908691 2:36396158-36396180 CCCAACACTTTCAGAGACCAAGG - Intronic
928972522 2:37045925-37045947 TCTAACAATTTAAGACACAAGGG + Intronic
929012904 2:37463948-37463970 CCCAGCAAACTAAGAGTAAAAGG - Intergenic
929831522 2:45350675-45350697 CCCAAGAATCAAGGAGACAGTGG + Intergenic
930088501 2:47515257-47515279 CCCAGCAATCTGAGAAACACTGG - Intronic
930223343 2:48767652-48767674 CCCAACAAGCTAAGATCCACTGG - Intronic
930614011 2:53574579-53574601 CCCAACAGACTAAGACACACAGG + Intronic
931886707 2:66625889-66625911 CCCAACAAGCTAAGATCCACTGG - Intergenic
932124130 2:69127974-69127996 CCCAACACTTTAGGAGACATAGG + Intronic
932329525 2:70889869-70889891 CCCAACAGTTTAGGAGACCAAGG + Intergenic
935320156 2:101879077-101879099 CCCAGCAATCTGAGAGGCCAAGG + Intronic
937082339 2:119149237-119149259 CCCAACAACTTAGGAGACCAAGG + Intergenic
938609136 2:132928868-132928890 CCCAACACTTTGAGAGACCAAGG + Intronic
939543512 2:143522932-143522954 CCCTTCTATCTAAGAGACACAGG - Intronic
941099182 2:161278236-161278258 CCCAACAATTTAGGAGACTGAGG + Intergenic
943313514 2:186356873-186356895 CGCAACAATTTAGGAGGCAAAGG + Intergenic
943642901 2:190378607-190378629 CCCAACACTCTAGGAGGCAGAGG - Intergenic
944916089 2:204361927-204361949 GCCAACAATCTAATAGAAAATGG + Intergenic
945156891 2:206848756-206848778 CCCAACACTTTAGGAGACCAAGG + Intergenic
945899784 2:215524789-215524811 CCCAACACTCTAGGAGGCCAAGG + Intergenic
946085109 2:217162985-217163007 CCCAGCATCCTTAGAGACAAAGG - Intergenic
946278805 2:218651230-218651252 CCCAACAATTTGAGAGGCCAAGG - Intronic
946892120 2:224287859-224287881 CCTAAAAATTAAAGAGACAATGG - Intergenic
947644830 2:231730892-231730914 CCCAGCAATTTAGGAGACCAAGG - Intergenic
947780233 2:232753573-232753595 CCTAAGCATCTAAGAGATAATGG + Intronic
948104412 2:235401544-235401566 CCCAACACTCTGAGAGACTGAGG - Intergenic
1169443558 20:5652985-5653007 CCCAACAATTTGAGAGGCCAAGG + Intergenic
1170387082 20:15831287-15831309 CACAACAATCTAATAGACTCAGG - Intronic
1170672275 20:18445648-18445670 CCCAACAATTTGGGAGACTAAGG + Intronic
1170941471 20:20851876-20851898 TCCAAGAAGCTAAGTGACAAAGG - Intergenic
1172405055 20:34682035-34682057 CCCAACACTTTGAGAGACCAAGG + Intergenic
1172483136 20:35283547-35283569 CCCAACACTTTAAGAGACCAAGG + Intronic
1175742738 20:61431608-61431630 CCCAACATTTTAGGAGACCAAGG - Intronic
1178252315 21:31015843-31015865 CCCAACACTCTGGGAGGCAAAGG - Intergenic
1178544933 21:33485097-33485119 CCCAACATTTTGAGAGACCAAGG - Intergenic
1178826835 21:36024380-36024402 CCCAGCATTTTGAGAGACAAAGG + Intergenic
1179132000 21:38646026-38646048 CCCAACACTCTGAGAGGCCAAGG + Intronic
1181259728 22:21588910-21588932 CCCAACACTTTAAGAGGCCAAGG - Intronic
1181682374 22:24504379-24504401 CCCAAAAAACTAGAAGACAATGG - Intronic
1182276028 22:29189251-29189273 CCCAACACTCTGAGAGTCCAAGG + Intergenic
1182870307 22:33640662-33640684 CCCAGCAAGCTAAGAAACACTGG + Intronic
1182952500 22:34390723-34390745 CCCAGCAAGCTAAGATCCAATGG - Intergenic
1183100975 22:35583852-35583874 CCCAAGATTCTAAGAGGCATAGG + Intergenic
1183182721 22:36271807-36271829 CCCAGCAAGCTAAGAAACACTGG - Intergenic
1183924044 22:41192999-41193021 CCCAACAATTTAGGAGGCCAAGG + Intergenic
1184000746 22:41671636-41671658 CCCAACACTTTGAGAGACCAAGG + Intergenic
950721758 3:14887913-14887935 CCCAACAATTTGGGAGACCAAGG + Intronic
950833240 3:15895782-15895804 CCCAACACTTTAGGAGACAAAGG - Intergenic
951011522 3:17687336-17687358 CCCAACACTTTAAGAAACCAAGG + Intronic
951150451 3:19283664-19283686 GCCAACAATCTAGGAGGCCAAGG + Intronic
951629126 3:24699381-24699403 CCCAACAAGCTAAGATCCACTGG - Intergenic
953945828 3:47146684-47146706 CCCAGCATTCTAAGAGGCCAAGG + Intronic
954606328 3:51913467-51913489 CCCAACACTTTAAGAGGCCAAGG + Intergenic
955343590 3:58144340-58144362 CCCAACACTTTAGGAGACAAAGG - Intronic
955453985 3:59100439-59100461 CCCAGCAAGCTAAGAAACACTGG - Intergenic
956301907 3:67781508-67781530 CCCAACAAACTAAGATCCACTGG - Intergenic
956418782 3:69063072-69063094 CCCATCTATCAAAGGGACAATGG + Exonic
956698189 3:71936303-71936325 CCCAGCAATGTACCAGACAACGG + Intergenic
956946181 3:74226179-74226201 CCCCACACTATAATAGACAAGGG + Intergenic
958022224 3:88011588-88011610 ACAAACAATCCAAGAAACAATGG - Intergenic
958095114 3:88934492-88934514 CACAAAAAACAAAGAGACAAGGG - Intergenic
958843857 3:99241710-99241732 CCCAACACTTTAAGAGGCCAAGG + Intergenic
959074541 3:101735924-101735946 CCCAGCAAGCTAAGATACACAGG + Intronic
960918718 3:122724553-122724575 CCCAGCACTCTGAGAGACAGAGG - Intronic
961842315 3:129725357-129725379 CCCAACACTCTAGGAGGCCAAGG - Intronic
963371051 3:144400706-144400728 CCCAACAATCTGGGAGGCCAAGG - Intergenic
963779136 3:149469655-149469677 CCCAACAATTTGAGAGGCAGAGG + Intergenic
963803729 3:149701898-149701920 CACAACAACCCAAGAGGCAAAGG - Intronic
964053293 3:152421391-152421413 CCCAACAAGCTAAGATCCACTGG + Intronic
964656712 3:159074989-159075011 CCCAACTAACAAAGGGACAAAGG + Intronic
965823234 3:172705744-172705766 CCCAACATTTTAAGAGGCCAAGG + Intronic
965880448 3:173382379-173382401 CCCAGCAAGCTAAGATACACTGG + Intergenic
966455227 3:180107527-180107549 CACAGCTTTCTAAGAGACAAAGG + Intergenic
966981305 3:185138847-185138869 CCCAACACTCTGAGAGGCCAAGG + Intronic
967049425 3:185769090-185769112 CCCAACATTTTGAGAGACCAAGG + Intronic
969164819 4:5298701-5298723 CCCAGCAAGCTAAGATCCAATGG - Intronic
970573597 4:17406219-17406241 CCAAACACTCTCTGAGACAAAGG - Intergenic
970670383 4:18390101-18390123 CCCACCAAGTGAAGAGACAATGG + Intergenic
971647678 4:29229842-29229864 CCCAGCAAGCTAAGATCCAATGG + Intergenic
972536671 4:40005724-40005746 CCCAGCAATTTGAGAGACAGAGG - Intergenic
973165912 4:47077270-47077292 CCCAACAAGCTAAGGAATAAGGG - Intronic
973338359 4:48979139-48979161 CCCAGCACTTTAAGAGACAAAGG + Intergenic
974280018 4:59780364-59780386 CCCAACAAACTAAGATCCACTGG + Intergenic
974818498 4:67036246-67036268 CTCAACAATTTAAGAGGCCAAGG + Intergenic
974851794 4:67412650-67412672 CCCAACAAGCTAAGATCCACTGG - Intergenic
975096633 4:70464475-70464497 CCCAGCAAGCTAAGATACAATGG + Intronic
975400731 4:73935978-73936000 ACTAACAATATAGGAGACAAGGG - Intergenic
975524241 4:75331528-75331550 CCCAGCAAGCTAAGAGCCACTGG + Intergenic
975764677 4:77654973-77654995 CCCAGCAATCTAAGATCCACTGG + Intergenic
976040455 4:80878259-80878281 TGGAACAATCTAAAAGACAAGGG - Intronic
976363053 4:84202839-84202861 CCCAACAAGCTAACATACATTGG + Intergenic
976888859 4:90020375-90020397 TTAAACCATCTAAGAGACAAGGG + Intergenic
976903526 4:90208415-90208437 CCCAGCAAGCTAAGATCCAATGG - Intronic
978090281 4:104707080-104707102 CCCAACAAACTAAGATCCATAGG + Intergenic
979168424 4:117566653-117566675 CCCAACACTTTAGGAGACCAAGG - Intergenic
979896664 4:126166257-126166279 CACAATAAACTAACAGACAAAGG + Intergenic
980323074 4:131304119-131304141 CCCAACAATCTCCAGGACAATGG + Intergenic
980633930 4:135473857-135473879 CCCAACAAACTAAGATCCACTGG - Intergenic
980733243 4:136848871-136848893 CCCAACAAGCTAAGATCCACTGG - Intergenic
980949842 4:139364124-139364146 CCCAACAATTTGGGAGACCAAGG - Intronic
981092337 4:140744631-140744653 CCCAGCAATTTAGGAGACCAAGG + Intronic
981885328 4:149666655-149666677 CCCAACAAGCTAAGATACACTGG + Intergenic
982794546 4:159629639-159629661 CCCAGCAAGCTAAGAGCCACTGG - Intergenic
983369594 4:166841825-166841847 CCCAACGATTTTAGACACAATGG - Intronic
983896232 4:173084725-173084747 CCCAACAAGCTAAGATCCACTGG - Intergenic
984722542 4:182988873-182988895 CCAAACAATCTTAAAGAGAAAGG - Intergenic
984771255 4:183438094-183438116 CCCAACACTCTGAGAGGCCAAGG - Intergenic
986815993 5:11412125-11412147 CCCTAAAATCTAAGACACAAAGG + Intronic
987614294 5:20252685-20252707 CCCAACACTTTAAGAGGCAGAGG + Intronic
988091438 5:26545414-26545436 CCCAACAATTTAGGAGGCCAAGG - Intergenic
988289798 5:29270560-29270582 CCCAACAAGCTAAGATCCACTGG + Intergenic
988719202 5:33859236-33859258 CCCAACAAGCTAAGATCCACTGG + Intronic
990412571 5:55555728-55555750 CCCAACACTCTAGGAGGCCAAGG + Intergenic
990546355 5:56825637-56825659 CACAGCAATTAAAGAGACAATGG - Intronic
990803499 5:59631970-59631992 CCCAGCAAGCTAAGATACACTGG + Intronic
991422511 5:66455625-66455647 CCCAGCACTCTGAGAGACTAAGG + Intergenic
991713938 5:69434211-69434233 CCCAACACTTTAAGAGGCCAAGG + Intronic
993381863 5:87217780-87217802 CCCAACAAGCTAAGACCCACTGG - Intergenic
993556594 5:89347287-89347309 CCCAACACTTTGAGAGACCAAGG - Intergenic
994203961 5:97011478-97011500 CCCAGCACTCTGAGAGACCAAGG - Intronic
995481951 5:112602302-112602324 CCCAACACTCTGAGAGGCCAAGG + Intergenic
995928071 5:117399970-117399992 CCCAGCAATTTAGGAGACCAAGG - Intergenic
996102133 5:119454870-119454892 CCCAACACTTTATGAGACAGAGG - Intronic
996280738 5:121726619-121726641 CCCAGCAAGCTAAGAACCAATGG - Intergenic
996383251 5:122883903-122883925 CCCAACACTTTGAGAGACTAAGG - Intronic
996720460 5:126625344-126625366 CCCAACACTTTAGGAGACCAAGG + Exonic
997482617 5:134198931-134198953 CCCAACACTCTAGGAGGCCAAGG + Intronic
998029280 5:138851200-138851222 CCCAACAATGAAAACGACAAAGG - Intronic
998189386 5:140010045-140010067 CCCAACACTCTGAGAGGCCAAGG + Intronic
998964449 5:147524118-147524140 CCCAACACTTTAGGAGACCAAGG + Intergenic
999201479 5:149819751-149819773 CCCAACAATTTGAGAGGCCAAGG - Intronic
1000458708 5:161485407-161485429 CTCACCAATATAAGAGAAAATGG + Intronic
1000577181 5:162988765-162988787 CCAAACAAGCTAAGACACTAAGG - Intergenic
1000956323 5:167547838-167547860 CCCTTCAATTTAAGGGACAAAGG + Intronic
1001117565 5:168952497-168952519 CCCCACAATCTCAGAGAAGAAGG + Intronic
1002146494 5:177186931-177186953 ACCAACAATCAAAAAGAAAATGG + Intronic
1002685773 5:181008250-181008272 CCCAGCAAGCTAAGAGCCACTGG + Intergenic
1003002192 6:2346654-2346676 CCCAACACTCTGGGAGACCAAGG - Intergenic
1004576156 6:16897265-16897287 CCCAACAATTTGAGAGGCCACGG + Intergenic
1004909060 6:20265562-20265584 CCCAACACTTTAAGAGGCTAAGG - Intergenic
1005295049 6:24417638-24417660 CACAACAATAGAAAAGACAAAGG + Intronic
1005523333 6:26620359-26620381 CCCAACACTTTGGGAGACAAAGG - Intergenic
1007462575 6:42029239-42029261 CCCAACACTTTAGGAGGCAAAGG - Intronic
1007609161 6:43138057-43138079 CCCAGCACTTTAAGAGGCAAAGG - Intronic
1008719137 6:54327682-54327704 CCCAGCAAACTAAGATACACTGG + Intronic
1008739330 6:54586179-54586201 AGCACCAATCTCAGAGACAACGG - Intergenic
1009236959 6:61134697-61134719 CCCAACAATTTTAGAGGCCAAGG - Intergenic
1009492706 6:64312107-64312129 CCCAACAAGCTAAGATCCAGTGG + Intronic
1009608181 6:65900927-65900949 AGCAACATTCTAAGAGAGAAAGG - Intergenic
1009740255 6:67734476-67734498 CCCAGCAAGCTAAGAAACACTGG - Intergenic
1010192996 6:73212571-73212593 CCCAACACTTTGAGAGACCAAGG + Intronic
1010195697 6:73237768-73237790 CCAAACAATGTAAAAAACAAAGG + Intronic
1010884322 6:81217937-81217959 CCCAGAAGCCTAAGAGACAATGG + Intergenic
1011387689 6:86815545-86815567 CCCAGCAAGCTAAGATACACTGG - Intergenic
1011680826 6:89781738-89781760 CCCAACACTCTGAGAAACCAAGG + Intronic
1011707287 6:90014032-90014054 CCCAACACTTTGAGAGACCAAGG - Intronic
1012270125 6:97198739-97198761 CCCAACAATCTAAGAAATTCTGG + Intronic
1012377627 6:98581475-98581497 TCCAACACTCTAATAGACACAGG + Intergenic
1013515234 6:110879108-110879130 CCCAGCACTCTGAGAGACCAAGG + Intronic
1014527828 6:122522294-122522316 CCCAACAAGCTAAGATCCACTGG - Intronic
1014794417 6:125707800-125707822 TTCAACAATCTCAGAGAAAATGG + Intergenic
1015329708 6:131962740-131962762 CCCATCAATCCTGGAGACAAAGG - Intergenic
1015471865 6:133614839-133614861 CCCAACAAGCTAAGATCCACTGG + Intergenic
1015730080 6:136338508-136338530 CCCAACACTCTAGGAGACCAAGG - Intergenic
1015982005 6:138848751-138848773 CCCAACATTTTAGGAGGCAAAGG + Intronic
1016179987 6:141133839-141133861 CCCAATGACCTAAGAGACACAGG - Intergenic
1017142866 6:151207512-151207534 CCCAACACTTTGAGAGACCAAGG - Intergenic
1017466006 6:154694383-154694405 CCCAACACTTTAGGAGACTAAGG - Intergenic
1018159444 6:161024217-161024239 CCCAACACTCTAGGAGGCAGAGG - Intronic
1018534264 6:164802956-164802978 GCCACAAATCTAAGAGACAGAGG + Intergenic
1019579592 7:1754087-1754109 CCCAGCACTTTAAGAGACCAAGG - Intergenic
1021089822 7:16470539-16470561 CCCAACAAAGTAAGAGATAATGG + Intronic
1022430283 7:30312229-30312251 CCCAACACTCTGAGAGACCAAGG - Intronic
1023329370 7:39098529-39098551 CCCAACAGTTTGAGAGACCAAGG - Intronic
1023784449 7:43692266-43692288 CCCAACACTCTAAGAGGCCGAGG + Intronic
1024476260 7:49815027-49815049 TCCAACAATCTGAAAAACAAAGG - Intronic
1025265320 7:57451696-57451718 CCCAGCACTTTGAGAGACAAAGG - Intronic
1025265587 7:57454081-57454103 CCCAACAATTTGAGAGGCACAGG - Intronic
1025718998 7:63992115-63992137 CCCAACAATTTGAGAGGCACAGG - Intergenic
1026562195 7:71459488-71459510 CCCAAATATCTAAGAGACCTGGG + Intronic
1026678763 7:72449620-72449642 CCCAACATTTTAAGAGGCCAAGG + Intergenic
1027245515 7:76364488-76364510 CCCAACAGTCTAATGCACAAAGG + Intergenic
1027406214 7:77864028-77864050 CCCAACACTCTAGGAGGCAGAGG - Intronic
1027582874 7:80020353-80020375 CCCAACAAGCTAAGACCCACTGG + Intergenic
1027864581 7:83629701-83629723 CCCAACAAGCTAAGACACACTGG - Intronic
1028615713 7:92764385-92764407 CCCAACACTCTAGGAGACCAAGG - Intronic
1029107266 7:98188546-98188568 CCCAGCACTCTAGGAGACTAAGG - Intronic
1030006260 7:105123653-105123675 CCCCTCATCCTAAGAGACAACGG + Intronic
1030043981 7:105478057-105478079 CCCAACAATTTAAGAGGCCAAGG - Intronic
1030771115 7:113475823-113475845 CCCAACAAGCTAAGATCCACTGG - Intergenic
1030983897 7:116218018-116218040 CCCACCATTCTAACAGACTAAGG - Intronic
1031710995 7:125046529-125046551 CCCAACAAGCTAAGATCCACTGG + Intergenic
1032469449 7:132167797-132167819 CCCAACAATTTGGGAGACCAAGG - Intronic
1032966442 7:137103617-137103639 CCCAGCAAGCTAAGATACACTGG + Intergenic
1033305898 7:140225321-140225343 CCCAACAATTTGGGAGACCAAGG + Intergenic
1034951700 7:155301614-155301636 CCCACAAATTTAAGAGAGAATGG + Exonic
1035928608 8:3757051-3757073 CCCAGCACTCTGAGAGGCAAAGG - Intronic
1036469349 8:9037564-9037586 CTCAAGAACCTAAGACACAATGG + Intronic
1037207433 8:16339962-16339984 CACACCAAACTATGAGACAAGGG + Intronic
1037242342 8:16791453-16791475 CCCAACACTTTGAGAGACCAAGG + Intergenic
1037701568 8:21279673-21279695 CAAAGCAATCTAAGAGAAAATGG + Intergenic
1038230686 8:25696916-25696938 GCCAACAAGCAAAGAGGCAAAGG + Intergenic
1038251409 8:25908344-25908366 CCTAACAATAAAAAAGACAATGG - Intronic
1038520148 8:28225180-28225202 CCCAGCAATCTGGGAGACCAAGG - Intergenic
1039577693 8:38637312-38637334 CCCAACACTTTGAGAGACCAAGG - Intergenic
1041050806 8:53932354-53932376 CCCAGCAAGCTAAGATCCAATGG + Intronic
1041155053 8:54977115-54977137 CCCAACAAGCTAAGATCCACTGG + Intergenic
1041278322 8:56186621-56186643 CCCAACACTTTAAGAGGCCAAGG - Intronic
1043647252 8:82536279-82536301 CCCAACAAGCTAAGATCCACTGG - Intergenic
1043801194 8:84612088-84612110 AACCACAATCTAAGAGAAAAAGG - Intronic
1044312385 8:90708948-90708970 CCCAACAAGCTAAGATCCACTGG - Intronic
1044405260 8:91818971-91818993 CCCAGCAAGCTAAGAGCCACTGG + Intergenic
1044593656 8:93938216-93938238 CCCAACACTCTGGGAGACCAAGG - Intergenic
1045212109 8:100108897-100108919 CCCAACAAACTAAGATCCAGTGG + Intronic
1045362000 8:101441545-101441567 CCCAACAATTTAGGAGGCCAAGG - Intergenic
1046313955 8:112476294-112476316 CCCAGCACTCTAAGAGGCCAAGG - Intronic
1047095820 8:121624724-121624746 GCCACCAGTCTATGAGACAAAGG - Intronic
1047121294 8:121908148-121908170 CCCAGCAAGCTAAGAAACACTGG + Intergenic
1047369588 8:124245463-124245485 CCCAACAAACTAAGATCCACTGG - Intergenic
1048765675 8:137841885-137841907 CCCAACACTTTAGGAGACCAAGG - Intergenic
1049606933 8:143534031-143534053 CCCAGCACTTTAAGAGACTAAGG + Intronic
1050973920 9:11912323-11912345 CCCAGCAATCTAAGATCCACTGG - Intergenic
1052144057 9:25025794-25025816 CCCAACAAGCTAAGAACCACTGG - Intergenic
1052303810 9:26982703-26982725 CCCAGCACTCTAAGAGGCCAAGG - Intronic
1053550481 9:39074277-39074299 CCCAACAATTTGGGAGACCAAGG - Intronic
1054719889 9:68594059-68594081 CCCAGCAAGCTAAGATCCAATGG - Intergenic
1054884923 9:70185792-70185814 CCCAGCAAGCTAAGAAACACTGG - Intronic
1056110444 9:83389491-83389513 CCCAATAATCTATGAGAACAAGG + Intronic
1056385151 9:86090650-86090672 CCCAGCAAGCTAAGAAACACTGG - Intronic
1058594209 9:106597872-106597894 CCCCACAGTCTCTGAGACAAAGG - Intergenic
1059099134 9:111452991-111453013 CCCAACACTTTGAGAGACCAAGG + Intronic
1059291398 9:113227502-113227524 CCCAGCACTCTAAGAGGCCAAGG - Intronic
1059420759 9:114190516-114190538 CCCAACACTTTAAGAGGCCAAGG - Intronic
1060584192 9:124776079-124776101 CCCAACACTTTGAGAGACTAGGG + Intergenic
1060762281 9:126265173-126265195 TCCAGCAATCTAATAGAAAATGG - Intergenic
1062420400 9:136478152-136478174 CCCAACACTTTAAGAGGCCAAGG + Intronic
1186715087 X:12243130-12243152 CCCAACACTCTGAGAGACCAAGG - Intronic
1186800601 X:13088713-13088735 CCCAACATTTTGAGAGACCAAGG + Intergenic
1187178643 X:16920948-16920970 CCCAGCACTCTAAGAGGCTATGG + Intergenic
1190193279 X:48294937-48294959 CCCAACACTTTAGGAGACCAAGG + Intergenic
1190567643 X:51747032-51747054 CCCAAGCATGAAAGAGACAAAGG - Intergenic
1190659784 X:52643548-52643570 CCCAACACTTTAGGAGACCAAGG + Intergenic
1190666014 X:52696385-52696407 CCCAACACTTTAGGAGACCAAGG + Intronic
1190673404 X:52762025-52762047 CCCAACACTTTAGGAGACCAAGG - Intronic
1190676949 X:52790796-52790818 CCCAACACTTTAGGAGACCAAGG - Intergenic
1191024557 X:55899418-55899440 CCCAAGAATATAACATACAAGGG + Intergenic
1192020579 X:67386614-67386636 CCCAACAAGCTAAGATCCAATGG + Intergenic
1192242254 X:69341917-69341939 CCCAACACTCTGAGAGGCCAAGG - Intergenic
1192548392 X:72032606-72032628 CCCAGCACTTTGAGAGACAAAGG + Intergenic
1192994014 X:76492900-76492922 CCCAACAAGCTAAGAACCACTGG + Intergenic
1193068585 X:77283056-77283078 CACAGCAATCTAAGATACACTGG + Intergenic
1193140410 X:78020769-78020791 CCCAACACTTTGAGAGACTAAGG - Intronic
1193291097 X:79773700-79773722 CTCAACAATTTAAGAATCAAAGG - Intergenic
1193297016 X:79845514-79845536 CCAAACAAACTAAGATACCAGGG - Intergenic
1193375652 X:80757623-80757645 TACAAATATCTAAGAGACAATGG - Intronic
1193416753 X:81234817-81234839 CACAAAAATCTAAAAGGCAAAGG - Intronic
1193514381 X:82445825-82445847 CCCAGCAATCTAAGAACCACTGG + Intergenic
1193562657 X:83038019-83038041 CCCAGCAAGCTAAGATCCAATGG + Intergenic
1193571660 X:83151899-83151921 CCCAGCAATCTAAGAACCACTGG + Intergenic
1193897262 X:87128833-87128855 CCCAACAAACTAAGATCCACTGG + Intergenic
1195774830 X:108391590-108391612 CCCAACAAGCTAAGATCCACTGG - Intronic
1195959208 X:110368089-110368111 CCCAACAATTTGAGAGGCCATGG - Intronic
1196027913 X:111062066-111062088 CCCAACAATTTGAGAGGCCAAGG - Intronic
1196391673 X:115213047-115213069 CCCAACACTCTAGGAGGCCAAGG - Intronic
1197357797 X:125457862-125457884 CCCAACAATTTGAGAGGCCAAGG - Intergenic
1197787548 X:130214048-130214070 CCCAACACTTTAAGAGGCCAAGG - Intronic
1198066950 X:133107620-133107642 CCCATGAATATAAGAGTCAATGG + Intergenic
1199723705 X:150562099-150562121 CCCAACACTTTAGGAGACCAAGG - Intergenic
1200758551 Y:7014893-7014915 CTCAACAAACTATGAGAAAATGG - Intronic
1200797406 Y:7353681-7353703 CCCAGCACTCTGAGAGACCAAGG - Intergenic
1200840097 Y:7773101-7773123 CCCAGCAATCTGGGAGACCAAGG - Intergenic
1201187584 Y:11419169-11419191 CCCAACACTTTAAGAGACCGAGG - Intergenic
1201337809 Y:12899132-12899154 CCCAGCACTCTGGGAGACAAAGG + Intergenic
1201421227 Y:13801541-13801563 CCCAAGTATCTAAGAACCAAAGG + Intergenic
1201485736 Y:14492776-14492798 CCCAACAATCTGGGAGGCCAAGG - Intergenic
1201525404 Y:14927457-14927479 CCCAACACTTTCAGAGACCAAGG - Intergenic
1201594148 Y:15648718-15648740 CCCAGCAGTTTCAGAGACAAAGG - Intergenic