ID: 1092871552

View in Genome Browser
Species Human (GRCh38)
Location 12:12810274-12810296
Sequence CCCCAACAATCTAAGAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092871552_1092871560 16 Left 1092871552 12:12810274-12810296 CCTTGTCTCTTAGATTGTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG 0: 9
1: 12
2: 9
3: 12
4: 41
1092871552_1092871565 28 Left 1092871552 12:12810274-12810296 CCTTGTCTCTTAGATTGTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1092871565 12:12810325-12810347 CCAAAGTCCGGTGGCAACAAAGG 0: 2
1: 4
2: 13
3: 21
4: 110
1092871552_1092871556 2 Left 1092871552 12:12810274-12810296 CCTTGTCTCTTAGATTGTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1092871556 12:12810299-12810321 CAGCCTCAACACCACCCGTAGGG 0: 18
1: 22
2: 14
3: 7
4: 90
1092871552_1092871562 19 Left 1092871552 12:12810274-12810296 CCTTGTCTCTTAGATTGTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1092871562 12:12810316-12810338 GTAGGGTACCCAAAGTCCGGTGG 0: 10
1: 11
2: 17
3: 15
4: 48
1092871552_1092871555 1 Left 1092871552 12:12810274-12810296 CCTTGTCTCTTAGATTGTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1092871555 12:12810298-12810320 CCAGCCTCAACACCACCCGTAGG 0: 16
1: 26
2: 13
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092871552 Original CRISPR CCCCAACAATCTAAGAGACA AGG (reversed) Intronic
901401549 1:9018310-9018332 CCCCAAGAACCTGAGAGGCATGG - Exonic
902114887 1:14113250-14113272 CCCCAACTCCCTAAGAGACAGGG - Intergenic
905445498 1:38026140-38026162 CCCCAACAAGCCAAGAGTCTAGG - Intergenic
908293845 1:62693530-62693552 CTACAAAAAGCTAAGAGACATGG + Intergenic
908427339 1:64020057-64020079 CCCTCAGAAACTAAGAGACAAGG + Intronic
909378427 1:74967903-74967925 CTCCAACAAACTAAGCGACTTGG + Intergenic
909543021 1:76812199-76812221 CCCCTACAAACTGAGAGAAAAGG - Intergenic
909945386 1:81657472-81657494 CCCAAACAAACTAAGACACATGG + Intronic
914858100 1:151366607-151366629 GCCCCAGAATCTAAGAGAGATGG - Intronic
915474936 1:156147710-156147732 CCCCTGCAATCAAAGACACAGGG + Intronic
921410316 1:214829524-214829546 CCCAAACAAACTAAGACACATGG - Intergenic
921976323 1:221207126-221207148 GCCCAACAAGCTAAGATCCATGG + Intergenic
1063088227 10:2838728-2838750 CCCCAAGAATCCTAGTGACAGGG - Intergenic
1063317974 10:5024928-5024950 CCCCAACAATCTCACAGTAAAGG - Intronic
1067738169 10:48875419-48875441 CCCAAACAATTTTTGAGACAGGG + Intronic
1067859687 10:49832691-49832713 CCACAAAAATCTAAGAGAAAAGG - Intronic
1072496811 10:95969906-95969928 GCCTAACAAACTAAGAGGCAGGG + Intronic
1080428856 11:32180133-32180155 CCCAAACAATCTGACAGACGTGG + Intergenic
1081178776 11:39961743-39961765 CCCTAACAATCTAAAAAACATGG - Intergenic
1084990601 11:72920785-72920807 CCCCCAAAATCTAAGAGAAAAGG - Intronic
1086733867 11:90282576-90282598 CCCCAACAAGCTAAGAGTTGAGG - Intergenic
1089214206 11:116825955-116825977 CCCCAACAATCACGGAGAGATGG - Intergenic
1091897481 12:4117060-4117082 CCCAAACATTGTAAGACACAGGG + Intergenic
1092786810 12:12033857-12033879 CCCCAGGAATCTAAGGGAGAAGG - Intergenic
1092871552 12:12810274-12810296 CCCCAACAATCTAAGAGACAAGG - Intronic
1093557816 12:20498218-20498240 GCCCACCAATCTATGAGACTTGG - Intronic
1096127643 12:49131360-49131382 CCCCGACAAGCTAAGAGTCGAGG + Exonic
1101250148 12:102925498-102925520 TCACAACAATCTAAGAGACACGG + Intronic
1102113333 12:110381754-110381776 TCATAACAATCTAAGCGACAAGG + Exonic
1106833580 13:33611046-33611068 CCTCAGAAATCTTAGAGACACGG + Intergenic
1106993513 13:35452576-35452598 CTCCAACATGCTAAGAGCCAAGG + Intronic
1113119766 13:106913782-106913804 CCCCCACCATCCAAGAGAAAAGG + Intergenic
1114642300 14:24231898-24231920 CTCCAAGAATCTGAGAGACGGGG + Intronic
1117328385 14:54689357-54689379 CACCACCAATCTAAGGGACCAGG - Intronic
1121643690 14:95503004-95503026 CCCCAAGAATCTAAGGCACGGGG + Intergenic
1124179800 15:27461957-27461979 CACCAAGAATCCAAGAGTCAGGG - Intronic
1128846190 15:70898013-70898035 CCAAAACAATCTCAAAGACATGG + Intronic
1129387157 15:75202386-75202408 CCCCAGCAATCCACGTGACAGGG - Intronic
1135288279 16:21212826-21212848 CCCCAACAATGTCAGGGACCAGG + Intronic
1143876169 17:9992268-9992290 CCCCAACCTTCTAAGAGCCGCGG + Intronic
1154094582 18:11400388-11400410 CAAAAACAATCTAAGAGAGATGG - Intergenic
1154328584 18:13410697-13410719 GGCTAACAATCTAAGAGATAAGG + Intronic
1155001596 18:21692946-21692968 CCAAAACAAACTCAGAGACATGG + Intronic
1155274845 18:24176917-24176939 CCCCAACACTCTTAGACACCAGG + Intronic
1160074200 18:75656569-75656591 ACCCAACTATCTAATAGAAAAGG + Intergenic
1160592766 18:79952975-79952997 CCCCAACAATCGAGGAAACAGGG + Intergenic
1165701724 19:37943286-37943308 CCCCAACAGCCTATGTGACAAGG - Intronic
1166224584 19:41387081-41387103 CCCAAATAATCTAAGAGCCATGG + Intronic
1166229035 19:41414868-41414890 CCCCAAGCATCTAAGACAAAGGG - Intronic
926607443 2:14911575-14911597 CTCCTACAATCTCCGAGACATGG + Intergenic
932793788 2:74678083-74678105 CCCCAAAAAACTAAAAGACCAGG - Intronic
933054424 2:77643704-77643726 CCCCAAAAATAGAAGAGAAAGGG - Intergenic
938211220 2:129467003-129467025 CAAAAATAATCTAAGAGACAGGG + Intergenic
945636501 2:212359555-212359577 CCCCATCAGTCTCAGAGACAAGG + Intronic
947560342 2:231144171-231144193 TCCCAACACTCTGAGAGGCAAGG - Intronic
948062469 2:235051928-235051950 CCCCAGGAAGCTAACAGACAGGG - Intronic
948876757 2:240833489-240833511 CCCCGAGACTCTCAGAGACAGGG - Intergenic
1169374230 20:5053499-5053521 CCACAACAATAGCAGAGACAGGG - Intergenic
1169411973 20:5379031-5379053 CCCCAACAGTGTCAGACACACGG - Intergenic
1170533543 20:17317749-17317771 CCCCCAAAATAAAAGAGACATGG + Intronic
1170770479 20:19328262-19328284 CCCCAAGACCCTAAGAGACCTGG - Intronic
1177043130 21:16137197-16137219 CACCAACCATCTTAAAGACAAGG + Intergenic
1177377083 21:20284846-20284868 CCCTATCAATCAAAGGGACAAGG - Intergenic
1177608217 21:23409187-23409209 TCCCAACAAGCTAAGAGTCAAGG + Intergenic
949416402 3:3819477-3819499 CCCCCAGAAGCTAAGAGGCAAGG - Intronic
951947452 3:28156390-28156412 CTCTAACAATCTAAGAGTTAGGG + Intergenic
953581087 3:44157273-44157295 CCTTAACTATCTAAGAGAAAGGG - Intergenic
958095115 3:88934493-88934515 CCACAAAAAACAAAGAGACAAGG - Intergenic
960038325 3:113124156-113124178 CCCCAACCCTCTGAGAGACTTGG + Intergenic
966765584 3:183459084-183459106 CCCGAACACACTAAGACACAGGG - Intergenic
974050106 4:56933270-56933292 CACCAACCATCTATGAGAAAAGG - Exonic
974214038 4:58821293-58821315 AACCAACAATCTAACAGCCATGG + Intergenic
975779303 4:77821485-77821507 TCCCAACTATCTAAGAGTCTAGG + Intergenic
983160020 4:164401404-164401426 CCCCAACAGTACAAGAGACCTGG + Intergenic
986611376 5:9571224-9571246 CCCAACTAATCAAAGAGACACGG - Intergenic
995663319 5:114510705-114510727 CCCCAACCATCTTAGGCACATGG + Intergenic
996185529 5:120469354-120469376 GCCCTACAACCTAAGTGACAGGG - Intronic
997658514 5:135572940-135572962 CCTCAACACTCTAAGAAAGAGGG + Intronic
999448406 5:151659746-151659768 ACACAACAACCTATGAGACAAGG + Intergenic
1001105917 5:168854400-168854422 CCCAAGGAATCTGAGAGACAAGG - Intronic
1007186155 6:39974029-39974051 CCTCAAAAATCTGAGAGAAATGG - Intergenic
1009962548 6:70541252-70541274 CCCCAACACTCTCAGAAAAAGGG - Intronic
1014424277 6:121285433-121285455 CCCCAAAAACCTAAGGGACTGGG - Intronic
1017276512 6:152575397-152575419 CCCCAAGACTCTCTGAGACAAGG + Intronic
1018312766 6:162527932-162527954 CACCACCAATCTCAGAGGCATGG + Intronic
1020347997 7:7185519-7185541 ACACAACAAGCTAAGAGGCATGG - Intronic
1020514745 7:9104346-9104368 CCCAAATTATCTAAGAAACATGG - Intergenic
1026562193 7:71459487-71459509 GCCCAAATATCTAAGAGACCTGG + Intronic
1028695732 7:93709307-93709329 CCACAACAAACTCAGAGAAAAGG - Intronic
1031136655 7:117891970-117891992 CCCCAACACTGTAAGAGCCTGGG + Intergenic
1040519380 8:48161894-48161916 CCTCAACAAACTAACACACATGG - Intergenic
1048156089 8:131953645-131953667 TCTCAAAAATTTAAGAGACATGG - Intronic
1050104384 9:2150376-2150398 CCCACACAAGCTTAGAGACAGGG + Intronic
1051237398 9:15016112-15016134 AGACAACAATGTAAGAGACAAGG - Intergenic
1052527200 9:29633246-29633268 CTCCAACAATTTAAGTCACAAGG + Intergenic
1053589038 9:39491722-39491744 CCACAAAAAGCTAGGAGACAAGG + Intergenic
1053788707 9:41670667-41670689 CCCCATCAATCTCAGAGCCTGGG + Intergenic
1054577264 9:66873573-66873595 CCACAAAAAGCTAGGAGACAAGG - Intronic
1054873724 9:70073938-70073960 CCCCAAGAGTTTAAGAAACATGG - Intronic
1060062835 9:120476273-120476295 CCCCAACAATCAGAGAGCCAGGG + Intronic
1060536041 9:124388939-124388961 CCCCAACAGTCTCTGACACATGG + Intronic
1186077961 X:5900915-5900937 TCCCAACAAACTAATAAACAAGG + Intronic
1190550457 X:51574411-51574433 CCCAAACAAACTAAGACATAGGG + Intergenic
1200860752 Y:7989174-7989196 CTCCAAATATCAAAGAGACAGGG + Intergenic
1202256542 Y:22927512-22927534 CTCCAAATATCAAAGAGACAGGG - Intergenic
1202409533 Y:24561265-24561287 CTCCAAATATCAAAGAGACAGGG - Intergenic
1202461249 Y:25108812-25108834 CTCCAAATATCAAAGAGACAGGG + Intergenic