ID: 1092871560

View in Genome Browser
Species Human (GRCh38)
Location 12:12810313-12810335
Sequence CCCGTAGGGTACCCAAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 9, 1: 12, 2: 9, 3: 12, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092871550_1092871560 17 Left 1092871550 12:12810273-12810295 CCCTTGTCTCTTAGATTGTTGGG 0: 1
1: 0
2: 1
3: 28
4: 493
Right 1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG 0: 9
1: 12
2: 9
3: 12
4: 41
1092871552_1092871560 16 Left 1092871552 12:12810274-12810296 CCTTGTCTCTTAGATTGTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG 0: 9
1: 12
2: 9
3: 12
4: 41
1092871554_1092871560 -8 Left 1092871554 12:12810298-12810320 CCAGCCTCAACACCACCCGTAGG 0: 16
1: 26
2: 15
3: 10
4: 147
Right 1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG 0: 9
1: 12
2: 9
3: 12
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092871560 Original CRISPR CCCGTAGGGTACCCAAAGTC CGG Intronic