ID: 1092874439

View in Genome Browser
Species Human (GRCh38)
Location 12:12835843-12835865
Sequence CGGCACTGGCAGATGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092874439_1092874450 15 Left 1092874439 12:12835843-12835865 CCTTCAATCATCTGCCAGTGCCG No data
Right 1092874450 12:12835881-12835903 GGAGCAGGAGGAATTGGGAAAGG No data
1092874439_1092874451 21 Left 1092874439 12:12835843-12835865 CCTTCAATCATCTGCCAGTGCCG No data
Right 1092874451 12:12835887-12835909 GGAGGAATTGGGAAAGGAACAGG No data
1092874439_1092874452 24 Left 1092874439 12:12835843-12835865 CCTTCAATCATCTGCCAGTGCCG No data
Right 1092874452 12:12835890-12835912 GGAATTGGGAAAGGAACAGGTGG No data
1092874439_1092874443 -6 Left 1092874439 12:12835843-12835865 CCTTCAATCATCTGCCAGTGCCG No data
Right 1092874443 12:12835860-12835882 GTGCCGTCAAAGAGGCCGGAAGG No data
1092874439_1092874446 3 Left 1092874439 12:12835843-12835865 CCTTCAATCATCTGCCAGTGCCG No data
Right 1092874446 12:12835869-12835891 AAGAGGCCGGAAGGAGCAGGAGG No data
1092874439_1092874454 26 Left 1092874439 12:12835843-12835865 CCTTCAATCATCTGCCAGTGCCG No data
Right 1092874454 12:12835892-12835914 AATTGGGAAAGGAACAGGTGGGG No data
1092874439_1092874453 25 Left 1092874439 12:12835843-12835865 CCTTCAATCATCTGCCAGTGCCG No data
Right 1092874453 12:12835891-12835913 GAATTGGGAAAGGAACAGGTGGG No data
1092874439_1092874445 0 Left 1092874439 12:12835843-12835865 CCTTCAATCATCTGCCAGTGCCG No data
Right 1092874445 12:12835866-12835888 TCAAAGAGGCCGGAAGGAGCAGG No data
1092874439_1092874448 9 Left 1092874439 12:12835843-12835865 CCTTCAATCATCTGCCAGTGCCG No data
Right 1092874448 12:12835875-12835897 CCGGAAGGAGCAGGAGGAATTGG No data
1092874439_1092874441 -10 Left 1092874439 12:12835843-12835865 CCTTCAATCATCTGCCAGTGCCG No data
Right 1092874441 12:12835856-12835878 GCCAGTGCCGTCAAAGAGGCCGG No data
1092874439_1092874449 10 Left 1092874439 12:12835843-12835865 CCTTCAATCATCTGCCAGTGCCG No data
Right 1092874449 12:12835876-12835898 CGGAAGGAGCAGGAGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092874439 Original CRISPR CGGCACTGGCAGATGATTGA AGG (reversed) Intergenic
No off target data available for this crispr