ID: 1092881877

View in Genome Browser
Species Human (GRCh38)
Location 12:12893020-12893042
Sequence ACCTCTCCACGCCCTTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092881877_1092881884 26 Left 1092881877 12:12893020-12893042 CCTCTCCAAGGGCGTGGAGAGGT 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1092881884 12:12893069-12893091 AGCAGAACCCTTTGGTTTCCCGG 0: 1
1: 0
2: 2
3: 11
4: 152
1092881877_1092881883 18 Left 1092881877 12:12893020-12893042 CCTCTCCAAGGGCGTGGAGAGGT 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1092881883 12:12893061-12893083 ATGGAATGAGCAGAACCCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 187
1092881877_1092881879 -10 Left 1092881877 12:12893020-12893042 CCTCTCCAAGGGCGTGGAGAGGT 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1092881879 12:12893033-12893055 GTGGAGAGGTGAGTGCCTCAAGG 0: 1
1: 0
2: 0
3: 31
4: 282
1092881877_1092881880 -9 Left 1092881877 12:12893020-12893042 CCTCTCCAAGGGCGTGGAGAGGT 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1092881880 12:12893034-12893056 TGGAGAGGTGAGTGCCTCAAGGG 0: 1
1: 0
2: 1
3: 15
4: 225
1092881877_1092881885 27 Left 1092881877 12:12893020-12893042 CCTCTCCAAGGGCGTGGAGAGGT 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1092881885 12:12893070-12893092 GCAGAACCCTTTGGTTTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 182
1092881877_1092881881 -1 Left 1092881877 12:12893020-12893042 CCTCTCCAAGGGCGTGGAGAGGT 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1092881881 12:12893042-12893064 TGAGTGCCTCAAGGGCAGAATGG 0: 1
1: 0
2: 2
3: 37
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092881877 Original CRISPR ACCTCTCCACGCCCTTGGAG AGG (reversed) Intronic
901165932 1:7221595-7221617 ACCTCTCCAGGCCCGTGGAATGG + Intronic
904616196 1:31751181-31751203 ACACCTCCACGCCCTTGCACAGG + Intronic
905515511 1:38559141-38559163 ACCTCTCCACGTCCTTATGGGGG - Intergenic
906871721 1:49489609-49489631 AACTCTCCAGGCCATTGGACTGG - Intronic
909083442 1:71143971-71143993 AACTCTCCAGGACATTGGAGTGG - Intergenic
910725301 1:90331754-90331776 AACTCTCCAGGACATTGGAGTGG + Intergenic
915733911 1:158072621-158072643 ACCTCTTCATGCCCTTGCACAGG - Intronic
916268901 1:162919395-162919417 AGCTCTGCACTTCCTTGGAGGGG - Intergenic
920933625 1:210411225-210411247 ATCTCTCCACTCCCTGGGATGGG + Intronic
924294940 1:242577160-242577182 ACCTCTCCACACTGTTAGAGTGG - Intergenic
1064987318 10:21224087-21224109 AACTCTCCAGGACATTGGAGTGG - Intergenic
1065126532 10:22579514-22579536 CCCTATCCTCACCCTTGGAGGGG + Intronic
1066700511 10:38122742-38122764 ATCTCTCCAGGACATTGGAGTGG + Exonic
1066991175 10:42515472-42515494 ATCTCTCCAGGACATTGGAGTGG - Intergenic
1067798871 10:49342967-49342989 GCCTCTCCAGGCCCTTGGGGAGG + Intergenic
1067972888 10:50992022-50992044 AGCTCTCCAGGCCCCTGGATGGG - Intronic
1069723462 10:70563608-70563630 ACCTGTCCCCAGCCTTGGAGAGG + Intronic
1069739357 10:70677690-70677712 TCCCCTCCAGGCCCTGGGAGTGG + Intronic
1069984535 10:72274348-72274370 AGCTCTCCAGGCTCGTGGAGCGG - Exonic
1073322869 10:102626200-102626222 ACCCCACCACGCCCTGGGTGAGG - Intronic
1077143205 11:1033878-1033900 ACCTCTCCAGGCCCTTCTTGGGG + Intronic
1077358166 11:2128122-2128144 CCCTCTCCCTTCCCTTGGAGTGG + Intergenic
1077428719 11:2503100-2503122 AACTCTCCAGGACATTGGAGTGG + Intronic
1078025884 11:7695349-7695371 CCCTCTCGACTCACTTGGAGGGG + Intronic
1078342083 11:10504845-10504867 ACCTCTACGCCTCCTTGGAGAGG + Intronic
1079420867 11:20286578-20286600 AACTCTCCAGGACTTTGGAGTGG - Intergenic
1083291848 11:61694951-61694973 ACGTCTCCCCGCCAGTGGAGGGG + Intronic
1083610890 11:64003802-64003824 CCCTGTCCACGCTCTTGGGGAGG + Intronic
1084364172 11:68686711-68686733 TCCTCTCCCTGCCCATGGAGTGG + Intronic
1084485954 11:69448465-69448487 ATCTCTTCACACCCATGGAGGGG - Intergenic
1086072856 11:82818608-82818630 ACCTCCACACCGCCTTGGAGAGG - Intergenic
1087387093 11:97485343-97485365 ACCTTTCCAAGCCTTTGGAAAGG + Intergenic
1088364446 11:109024616-109024638 AGCTCTCCAGGACATTGGAGTGG - Intergenic
1092881876 12:12893019-12893041 ACCTCTCCAAGGGCGTGGAGAGG + Intronic
1092881877 12:12893020-12893042 ACCTCTCCACGCCCTTGGAGAGG - Intronic
1093419570 12:18959252-18959274 AACTCTCCAGGACATTGGAGTGG - Intergenic
1093607772 12:21113611-21113633 AACTCTCCAGGACATTGGAGTGG - Intronic
1095163730 12:38947134-38947156 AACTCTCCAAGACATTGGAGTGG + Intergenic
1097308389 12:58093615-58093637 ACCTCTCCCAGCCCCAGGAGGGG + Intergenic
1098648314 12:72933365-72933387 ACCTCTCCAAGACATTGAAGTGG - Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1102033822 12:109759772-109759794 ACCTCTCAAAGGCCTGGGAGCGG + Intronic
1102041512 12:109803972-109803994 ACCCCTCCACTCCCTTCTAGGGG - Intronic
1103902290 12:124309631-124309653 ACCTCCCTGAGCCCTTGGAGCGG + Intronic
1106463783 13:29995006-29995028 ATCTCTCCCCTGCCTTGGAGCGG - Intergenic
1106512162 13:30421666-30421688 ACCACTCCCCGCCCTGGGGGCGG - Intergenic
1113398946 13:109974002-109974024 GCCTCTGCATGCCTTTGGAGGGG + Intergenic
1118728559 14:68650183-68650205 ACCTCTGCACCCTCTTGGACTGG + Intronic
1121876399 14:97457132-97457154 AGCTCTCCAGGCCCTGTGAGTGG - Intergenic
1122627580 14:103092095-103092117 AGCTCCCCACGACCTTGGAGAGG - Intergenic
1122848281 14:104512794-104512816 ACCTCACCATTCCCTTGGCGGGG - Intronic
1124826777 15:33104978-33105000 ACCTCTCAGAGCTCTTGGAGAGG - Intronic
1125721925 15:41849357-41849379 ACCTCTCCATTGCCATGGAGTGG + Intronic
1126370930 15:47946333-47946355 ACCTCTCCAAGCCCTTGCAGAGG + Intergenic
1126971009 15:54111768-54111790 TCCTCTCTGCCCCCTTGGAGTGG - Intronic
1129314118 15:74730931-74730953 ACCTCTCCACACCCCTGGACTGG + Intergenic
1131190424 15:90311088-90311110 AACTCTCCAGGACATTGGAGTGG - Intronic
1131317733 15:91355165-91355187 ACCTCTCCACACCCAGTGAGAGG + Intergenic
1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG + Exonic
1139479866 16:67224529-67224551 ACCTCACCACCCCCTAGGTGGGG - Intronic
1140034431 16:71361546-71361568 AGCTCTCCAGGTCCCTGGAGTGG + Intronic
1141699356 16:85635359-85635381 AACCCTCCACGCCCTTGGCAGGG + Intronic
1142976582 17:3648302-3648324 AACTGTCCAGGCCCCTGGAGTGG + Intronic
1148215476 17:45831843-45831865 CCCTCTCCTCCCCCATGGAGGGG + Intronic
1150541760 17:66108216-66108238 AACTCTCCAGGACATTGGAGTGG + Intronic
1151388592 17:73770624-73770646 CCCTCGCCACTCCCTTGGGGTGG - Intergenic
1151942888 17:77303861-77303883 ACCTCGCCAGGCCCTTGCTGTGG - Intronic
1152589304 17:81203538-81203560 ACCGCTACACCCCCTCGGAGAGG - Exonic
1153793049 18:8597050-8597072 ACCTTTCCCAGGCCTTGGAGGGG - Intergenic
1156557456 18:38083576-38083598 ACCACCCCACCCCCTTGCAGTGG + Intergenic
1158267364 18:55674892-55674914 ACCTCTCCAGGACATTGGATTGG - Intergenic
1160138058 18:76291140-76291162 AACTCTCCAGGACATTGGAGTGG - Intergenic
1161088590 19:2346253-2346275 AACTCTCCTGGCCCTGGGAGTGG - Intronic
1161616750 19:5275022-5275044 GCCTCTCCATGCTGTTGGAGAGG - Intronic
1163437674 19:17305023-17305045 ACCTCACTCAGCCCTTGGAGAGG + Intronic
930521626 2:52474570-52474592 ACCTCTCCCTGCCCTTGTAGAGG - Intergenic
934870806 2:97863313-97863335 ATCTCTCCAGGACGTTGGAGTGG + Intronic
937116679 2:119410490-119410512 AACTCTCCAGGACATTGGAGTGG - Intergenic
937557972 2:123183038-123183060 AACTCTCCAGGACATTGGAGTGG + Intergenic
937917178 2:127105095-127105117 ACATCACCACCTCCTTGGAGGGG + Intronic
943558601 2:189434696-189434718 ACCTTTCCACGCTCATGGAGAGG + Intergenic
944079069 2:195765294-195765316 AGCTCTCCAGGACCTTGGATTGG + Intronic
944208558 2:197183225-197183247 ACCTCTCCACGCTTTTTGATGGG - Intronic
945017930 2:205539479-205539501 CCCTGACCACGGCCTTGGAGGGG - Intronic
947683630 2:232060308-232060330 AACTCTCCAAGACATTGGAGTGG - Intronic
947812050 2:233010868-233010890 ACCTCTCCCCACCTTGGGAGAGG - Intronic
948524296 2:238560674-238560696 GCCTCTCCACGCCCAAGGAAGGG + Intergenic
948775104 2:240283101-240283123 AACTCTCCAGGACCTTGGACTGG + Intergenic
1171144187 20:22767325-22767347 TCCTCTCCCTGCTCTTGGAGGGG + Intergenic
1172125501 20:32623019-32623041 ACCTCTCCCTTCCCTAGGAGAGG - Intergenic
1173738162 20:45376293-45376315 CTCTCTCCACGCCCTTGGCTAGG - Intronic
1175751397 20:61500410-61500432 CCCTCTCCACGCCCGTGATGTGG - Intronic
1177652124 21:23970456-23970478 AACTCTCCAGGCCCTTGGACAGG - Intergenic
1182542122 22:31049343-31049365 ACCTCCCCACTCCCCTGCAGGGG + Intergenic
1185045353 22:48525847-48525869 ACATCTCCACGCCTCTGCAGGGG - Intronic
949235388 3:1802719-1802741 AACTCTCCAGGACATTGGAGTGG - Intergenic
950695041 3:14692805-14692827 AACTCTCCAGGACGTTGGAGTGG - Intronic
951124854 3:18971366-18971388 AACTCTCCAGGGCATTGGAGTGG - Intergenic
954395858 3:50292944-50292966 ACCTCACTAAGCCCATGGAGAGG - Exonic
960861624 3:122160142-122160164 ACCTCTCCAGGACATTGGATTGG - Intergenic
961864761 3:129945586-129945608 ACCTGTCCAAGCCCCTGGAAGGG - Intergenic
964804485 3:160593013-160593035 AACTCTCCAGGACATTGGAGTGG + Intergenic
965692568 3:171373024-171373046 AGCTCTCCAGGCGCTTGGATTGG - Intronic
966285052 3:178285815-178285837 ACCTCTCCCCACCCCTAGAGAGG + Intergenic
974167371 4:58221031-58221053 AACTCTCCAGGACATTGGAGTGG + Intergenic
977257521 4:94757755-94757777 ACTTCTCAACGCACTTGGAGCGG - Intergenic
977330380 4:95629888-95629910 TCCTCTGCACGCCCTTCTAGAGG + Intergenic
979280420 4:118861105-118861127 AACTCTCCAGGACATTGGAGTGG - Intronic
982223375 4:153143376-153143398 ACCACTCCAGGCACTTGGGGAGG + Intergenic
985690041 5:1303175-1303197 AACTCTCCAGGACATTGGAGTGG - Intergenic
990503215 5:56418044-56418066 AACTATCCACACCCTAGGAGTGG - Intergenic
991394781 5:66192752-66192774 ACCTCTCCAGGACATTGGAGTGG - Intergenic
996931204 5:128890606-128890628 AACTCTCCAGGACATTGGAGTGG - Intronic
1001015423 5:168136706-168136728 ACCTCTCCTCACCCTTAGACAGG + Intronic
1001654341 5:173337856-173337878 ACCTCTCTACAACCTTGGAAGGG + Intergenic
1003769070 6:9277165-9277187 ATCTCTTCAGGACCTTGGAGTGG - Intergenic
1007001008 6:38312478-38312500 AACTCTCCAGGCCATTGGAATGG - Intronic
1007034593 6:38661762-38661784 GCCTCTCCTCTGCCTTGGAGGGG - Intergenic
1008847740 6:55988311-55988333 AACTCTCCAGGACATTGGAGTGG - Intergenic
1014883969 6:126756893-126756915 ACCTCTGCATGCCCTAGGAGAGG - Intergenic
1017050265 6:150385190-150385212 ATGTCTTCACGACCTTGGAGTGG - Intronic
1019257667 7:62208-62230 ACCTCCACACAGCCTTGGAGGGG + Intergenic
1019563042 7:1667353-1667375 ACCTCTCCCCGCCCTCAGATGGG - Intergenic
1020370608 7:7428282-7428304 ACCACTCCAAGGCTTTGGAGCGG + Intronic
1021046542 7:15929656-15929678 AACTCTCCAGGACATTGGAGTGG + Intergenic
1025825667 7:65008481-65008503 ACCTGCCCACTCCCTTGGTGAGG - Intergenic
1025898676 7:65726297-65726319 ACCTGCCCACTCCCTTGGTGAGG - Intergenic
1028184619 7:87768294-87768316 ACCTCTCCCTCCCCTAGGAGTGG + Intronic
1032138228 7:129301435-129301457 AACTCTCCAGGACATTGGAGTGG - Intronic
1034436287 7:151064267-151064289 ACCGCTCCACGCCCAGGGTGCGG - Exonic
1035732023 8:1860197-1860219 TCCTCTCCACGCCCCCGAAGTGG + Intronic
1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG + Intronic
1035881118 8:3244897-3244919 ACTTCTCAGCGCCCTTGGGGTGG - Intronic
1041652668 8:60316423-60316445 ACCTTGCAAGGCCCTTGGAGAGG - Intergenic
1044857158 8:96488274-96488296 CCCTTTCCAGGGCCTTGGAGAGG + Intergenic
1045989465 8:108288385-108288407 ACCTATCCAAGCCCATGGACTGG + Intronic
1049056261 8:140239593-140239615 ACCTCCTCACGGCCGTGGAGGGG + Intronic
1049223982 8:141440980-141441002 CCCACTCCCAGCCCTTGGAGGGG - Intergenic
1049227895 8:141466408-141466430 ACATCTCCATCCCCTTGGACAGG - Intergenic
1049998240 9:1051039-1051061 ACCTCTTCAAGCCCAAGGAGGGG + Intronic
1055387566 9:75779559-75779581 AACTCTCCAGGACATTGGAGTGG + Intergenic
1059453950 9:114388023-114388045 ACCTCTCCCCGCCCCTGCCGTGG + Intronic
1061954094 9:133952800-133952822 ACCTCTGCAGGCTCTAGGAGAGG - Intronic
1062441412 9:136571372-136571394 ACCGCGCCACGCCCTCGGTGAGG + Intergenic
1191072046 X:56411014-56411036 AACTCTTCACTCCCTTGGAAAGG - Intergenic
1192530587 X:71880121-71880143 AACTCTCCAGGACGTTGGAGTGG + Intergenic
1196425194 X:115562072-115562094 ACCTCTCCCGACTCTTGGAGAGG + Intronic
1199048744 X:143209901-143209923 AACTCTCCAGGACATTGGAGTGG + Intergenic
1199362323 X:146936429-146936451 AACTCTCCAGGACATTGGAGTGG - Intergenic
1199593371 X:149488269-149488291 ACCTCTCCACTCTCTCGGGGAGG + Intronic
1199598648 X:149527162-149527184 ACCTCTCCACTCTCTCGGGGAGG - Intronic
1199698838 X:150362227-150362249 TCCTCCCCTCGCCCTGGGAGGGG - Intronic
1200333996 X:155329023-155329045 AACTCTCCAAGACATTGGAGTGG + Intronic