ID: 1092882889

View in Genome Browser
Species Human (GRCh38)
Location 12:12901487-12901509
Sequence AAGGGGAGTCAGGAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1724
Summary {0: 1, 1: 0, 2: 14, 3: 168, 4: 1541}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092882889_1092882902 28 Left 1092882889 12:12901487-12901509 CCGTCCTCCTCCTGACTCCCCTT 0: 1
1: 0
2: 14
3: 168
4: 1541
Right 1092882902 12:12901538-12901560 CTGCCTCATCTATTCTGGTTAGG 0: 1
1: 0
2: 2
3: 8
4: 155
1092882889_1092882901 23 Left 1092882889 12:12901487-12901509 CCGTCCTCCTCCTGACTCCCCTT 0: 1
1: 0
2: 14
3: 168
4: 1541
Right 1092882901 12:12901533-12901555 TCTTGCTGCCTCATCTATTCTGG 0: 1
1: 0
2: 0
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092882889 Original CRISPR AAGGGGAGTCAGGAGGAGGA CGG (reversed) Intronic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900624529 1:3602206-3602228 GAGGGGTGTGTGGAGGAGGAGGG - Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900753745 1:4418633-4418655 GAGGGAAGGAAGGAGGAGGAGGG - Intergenic
900859757 1:5219790-5219812 GAGGCGAGTCATGAGGAGCATGG - Intergenic
900940904 1:5798096-5798118 ATGGGGAGAGAGGAGGTGGAGGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901154256 1:7124903-7124925 AGTGGGAGTCAGGAAGGGGAAGG + Intronic
901214932 1:7550004-7550026 GAGGGAAGGAAGGAGGAGGAGGG + Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901278312 1:8010487-8010509 AGTGGCTGTCAGGAGGAGGAGGG - Intronic
901316781 1:8315097-8315119 AGGGAGAGTGAGGGGGAGGAAGG - Intergenic
901403981 1:9033825-9033847 AAGGGGGTTGGGGAGGAGGAAGG - Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
901785143 1:11619631-11619653 AGGGGCAGTCAGGAGGTAGAGGG - Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
901812766 1:11777173-11777195 AGTGGGAGTCAGGAGCAAGAAGG + Intronic
902006481 1:13236370-13236392 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902025534 1:13380755-13380777 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902057255 1:13611629-13611651 AAAGGGGTTCAGGAGGTGGATGG + Intronic
902278763 1:15359174-15359196 AAGAGGAGACAAGAGGAGTAAGG + Intronic
902318080 1:15638922-15638944 AAGGGGAGTTAGGAAGAAAAAGG - Intronic
902456814 1:16539333-16539355 AATGAGAGTCAGGAAGATGAGGG + Intergenic
902495355 1:16868580-16868602 AATGAGAGTCAGGAAGATGAGGG - Intronic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
903344420 1:22675344-22675366 ATGGGCAGGCAGGAGAAGGAAGG - Intergenic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903559375 1:24216404-24216426 GCGGGGAGTCAGGAGGCGGGTGG - Intergenic
903751490 1:25624206-25624228 AGGGGGAGTGAGGAGGAAGACGG - Intronic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
903989196 1:27253428-27253450 AGGAGGAGGAAGGAGGAGGAGGG - Intronic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904087084 1:27916786-27916808 AGGAGGAGAGAGGAGGAGGAGGG - Intergenic
904087096 1:27916828-27916850 AGGAGGAGAGAGGAGGAGGAGGG - Intergenic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904435577 1:30492674-30492696 AAGGGGTGCCAGGAGCAGGCAGG - Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904789777 1:33010726-33010748 AAGGGTGGTCAGGGTGAGGATGG - Intronic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
905029375 1:34871342-34871364 ACAAGGAGCCAGGAGGAGGAAGG - Intronic
905074884 1:35261699-35261721 AAGAGGAGGAAGGAGGAAGAAGG - Intergenic
905237601 1:36560813-36560835 AAGAGGAGTGTGGAGGAGGCTGG + Intergenic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905343534 1:37295628-37295650 CAGGAGAGTCAGGATGAGTACGG + Intergenic
905420969 1:37843839-37843861 GAGGGGAGACAGGAGGAGTAGGG - Intronic
905553198 1:38859919-38859941 AGGAGGAGTCACGAGGAGGGCGG + Intronic
905602730 1:39268288-39268310 AGGGAGGGCCAGGAGGAGGAGGG - Intronic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
905875229 1:41427908-41427930 AAGGAGTGAGAGGAGGAGGACGG - Intergenic
906859304 1:49341877-49341899 AAGGAGAGAGAGGAGGAGAAAGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
907364545 1:53947132-53947154 AAGGGGAGGCAGGTGAAGGTTGG + Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907404129 1:54243339-54243361 AACCGGAGACAGGAGGAGGGAGG + Intronic
907535456 1:55151467-55151489 AAGGGGAGGAAGTAAGAGGAAGG + Intronic
907888926 1:58619768-58619790 AAGTGGAGACAGGAGAAGAAGGG + Intergenic
907890298 1:58630738-58630760 AAGGGTGGTCAGGGTGAGGATGG - Intergenic
907901894 1:58748685-58748707 AAGGGGGGTCAGGGAGAAGATGG - Intergenic
908322406 1:62991220-62991242 GAGAGGAGACAGGAGGAGGTGGG + Intergenic
908598933 1:65718527-65718549 AAGGGGAGGGAAGAGTAGGAAGG - Intergenic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
908884541 1:68773311-68773333 CAGGAGAGTGATGAGGAGGATGG - Intergenic
909182260 1:72439542-72439564 AAGGGGAGGCAAGAGTGGGAAGG - Intergenic
909431607 1:75593835-75593857 AAGGGTAGTCAGGGGATGGAGGG + Intronic
909480583 1:76125468-76125490 GAGGGGAGAGAGGTGGAGGAGGG - Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909986953 1:82172906-82172928 AAGGGGAGTTGGAAGGGGGATGG - Intergenic
910028509 1:82687913-82687935 AAGGGGAGGCAGGAGAGGCAGGG - Intergenic
910332977 1:86097463-86097485 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
910332982 1:86097476-86097498 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
911209592 1:95125513-95125535 AAGACTAGTCAAGAGGAGGAGGG + Intronic
911310701 1:96289065-96289087 AATGGCAGTCAGAAGGGGGATGG + Intergenic
911326353 1:96473861-96473883 AATGGGAGTCAGGAGGTGTGTGG - Intergenic
911434733 1:97843100-97843122 AAGAGAAGTCAGGATGATGAAGG - Intronic
912503478 1:110137940-110137962 AAGGGCAGTCTAGAGGAGCAGGG + Intergenic
912795253 1:112689384-112689406 AAGGGGAGTCAAGGGGGGGTTGG - Intronic
912953772 1:114138171-114138193 AAGTGGGGTCAAGAAGAGGAAGG - Intronic
913046304 1:115076270-115076292 AAGGAGAGTCTGGGGGAGGTCGG + Intronic
913082967 1:115406759-115406781 AAGAGAAGTCAGCAGTAGGAGGG - Intergenic
913494398 1:119415040-119415062 AAAGGGATTCTGGAGGAGGAGGG + Exonic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
914815638 1:151060004-151060026 GAGGCGAGTCTGGAGGAGCAGGG + Exonic
915304960 1:154971811-154971833 AAGGGGTGTCAGGAGAAGATGGG + Intronic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915662501 1:157415878-157415900 AAGGAGAGTCAGACGGAGGCAGG - Intergenic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
915973536 1:160370632-160370654 AGGGGGAGGAAGGGGGAGGAAGG - Exonic
916144535 1:161727122-161727144 AAGAGGGGTGAGGAGGAGGGCGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916614965 1:166429904-166429926 AAGGCTAGTTAGGAGGTGGATGG - Intergenic
916693783 1:167217006-167217028 AAGGGAAGTTTGGAGGAGGGGGG - Intergenic
916932447 1:169592831-169592853 AAGGGGATTATGGAGGAGGCAGG - Intronic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
917562095 1:176168820-176168842 AAGGGAAGTCAGGAGGAAGAGGG + Intronic
918107177 1:181425232-181425254 AAGCGAAGCCAGGAGGAGAAGGG + Intronic
918289092 1:183089053-183089075 AAGAGGAGTTAGGAAGAAGATGG - Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919176715 1:194028416-194028438 AGGGGGAGGAAGGAGGAGGAAGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919850363 1:201668238-201668260 AGGGGGTGGCAGGAGGCGGAGGG - Intronic
919870587 1:201817989-201818011 AGGCTGAGACAGGAGGAGGATGG + Intronic
919982040 1:202647820-202647842 AGGGGGAGGGAGGAGGGGGAAGG - Intronic
920053167 1:203175521-203175543 AAGGTGGGGCAGGGGGAGGAGGG - Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920181352 1:204133907-204133929 AAGGTGGGTGAGGAGGAGAAGGG + Intronic
920199416 1:204250342-204250364 AAGGGGGATGAGGAGGAGGTAGG + Intronic
920255611 1:204652219-204652241 AAGGGGAGAGAGGAGGGGGAAGG - Intronic
920565623 1:206970446-206970468 AAGGGGACACAAGAGGAGGAAGG - Exonic
920717034 1:208349826-208349848 AAAGGGAGGCAGGCAGAGGAGGG + Intergenic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
920823675 1:209404316-209404338 AAGGGGAGAGAGGAGCAGAAAGG + Intergenic
921262157 1:213394071-213394093 AAGGGGTGTACGGAGGAGGCTGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921380284 1:214517629-214517651 AACAGGAGGCAGGAGGAGTAGGG + Intronic
921559377 1:216639131-216639153 AATGGGAGGCAGGAGTAGGGAGG + Intronic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922085514 1:222343259-222343281 AAAGGGAGTCAGGAAGGAGAAGG + Intergenic
922322788 1:224502958-224502980 AGGGTGAGGGAGGAGGAGGAGGG + Intronic
922705905 1:227789867-227789889 GAGGGGAGCCAGGAGAAGCAGGG - Intergenic
922722645 1:227906521-227906543 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
922731842 1:227952602-227952624 AAGGGGAGTCGGGATGAGCCTGG - Intergenic
922799832 1:228360135-228360157 ATGGGCAGCCTGGAGGAGGAGGG + Intronic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923022505 1:230175648-230175670 GAGGACAGTGAGGAGGAGGAGGG - Intronic
923051195 1:230392581-230392603 GAGGAGAGTCCGGAGGAGGCAGG - Intronic
923539870 1:234880371-234880393 AATGGGAGTCAGGAAGACCATGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924035370 1:239930719-239930741 AAGGGGATTATGGAGGATGAAGG + Intergenic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
924703160 1:246474728-246474750 AAGGGGAGACAGGAGACAGAGGG + Intronic
924801288 1:247331238-247331260 AACGTGAGTGAGGCGGAGGAGGG + Intronic
1062782318 10:225447-225469 AAGCTGAGGCAGGAGGAGGCTGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062812525 10:477426-477448 GGGGGGAGGCAGGGGGAGGAAGG + Intronic
1062833577 10:622257-622279 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1062833584 10:622270-622292 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063104948 10:2984844-2984866 AGGTGGATTCAGGAGAAGGATGG + Intergenic
1063159497 10:3408908-3408930 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1063257099 10:4340467-4340489 AAAAGGAGGGAGGAGGAGGAAGG - Intergenic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1063527086 10:6796416-6796438 ATGGGGAGTCAGGAGGCAAATGG - Intergenic
1063901505 10:10737619-10737641 AAGGGGATTCAGGCAGAGGATGG - Intergenic
1063995298 10:11612673-11612695 AAGGGGTGGAAGGAGGAGGCAGG + Intergenic
1064124881 10:12651080-12651102 ACGGGGAGGAAGGAGGAGGTGGG - Intronic
1064680182 10:17803589-17803611 AAGGGGTGGGAGGTGGAGGATGG - Intergenic
1064681563 10:17815525-17815547 TAGGGCGGTCAGCAGGAGGAAGG + Intronic
1064737695 10:18399531-18399553 AAGGGTAGAAGGGAGGAGGAGGG + Intronic
1065530131 10:26661163-26661185 AAGGTCAGTCAGGAGGTAGAGGG + Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1066047198 10:31604044-31604066 ATGGGGAGGCAACAGGAGGAGGG - Intergenic
1066235643 10:33481624-33481646 TAGGGGAGCCTGCAGGAGGAGGG + Intergenic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1067438111 10:46292908-46292930 AAGGAGGGTCAGGGAGAGGAAGG + Intronic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068510095 10:57954901-57954923 AAGGTGAGTGAGAAGGAGAATGG + Intergenic
1068610970 10:59059697-59059719 AAAGAGAGTCAGGAAAAGGAAGG + Intergenic
1068892068 10:62158282-62158304 AAGAGCAGTTAGGAAGAGGAAGG + Intergenic
1069026161 10:63544486-63544508 ATTGGGTGTGAGGAGGAGGAAGG + Intronic
1069060968 10:63894139-63894161 AAGGAAAGAGAGGAGGAGGAAGG - Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1069874857 10:71555574-71555596 AGGGGGAGCCTGGAGGAGGCAGG + Intronic
1069980792 10:72251024-72251046 GAGGGGACTTAGGAGGGGGATGG + Intergenic
1070314238 10:75295225-75295247 GAGGGGTGGCAGGAGGAGGCAGG + Intergenic
1070328807 10:75403982-75404004 GAGGGGAGTCAGGTGGGGGAGGG - Intergenic
1070330255 10:75411196-75411218 AAGGGGATGCTGGAGGAGGTTGG + Intergenic
1070967127 10:80536482-80536504 AAGAGGAGACAAGGGGAGGAAGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071152233 10:82649245-82649267 AAGGGGAGGCAGGAGGTAGAGGG - Intronic
1071290387 10:84184824-84184846 AAGGGGAGACAGGAGGCTGCTGG - Exonic
1071530522 10:86387819-86387841 TAGGGGAGATAGGAGAAGGAGGG - Intergenic
1071857963 10:89645045-89645067 TGGGGGAGTCGGCAGGAGGAGGG - Exonic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072444573 10:95487519-95487541 AAAGGCAGTCAGACGGAGGAAGG + Intronic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1073112827 10:101072731-101072753 GAGGGGAGTCAGGAAAGGGAGGG + Intergenic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1073449105 10:103599068-103599090 AATGGCAGTGAGGAGGAGCACGG + Exonic
1073496475 10:103896089-103896111 AAAGGGAGTGAGAGGGAGGATGG + Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1074226854 10:111493431-111493453 AAGGGAAGGGAGGAGAAGGAAGG - Intergenic
1074722262 10:116273062-116273084 AAGGGGTGGCCGGAGGAGGGGGG + Intronic
1074724111 10:116289842-116289864 AGAGAGAGTCGGGAGGAGGAAGG - Intergenic
1074765057 10:116694533-116694555 AAGGGGAGGGAGGAGGTGGAGGG - Intronic
1074889117 10:117720539-117720561 AAGGGGAGAAAGCAGAAGGAAGG + Intergenic
1074938965 10:118216210-118216232 TAAGGAAGTCAGGGGGAGGAGGG - Intergenic
1074945862 10:118280010-118280032 AAGGAGAATAAGGAGGTGGAAGG - Intergenic
1074994979 10:118748948-118748970 AAGAAGAGTCAGGAGGAGGGAGG + Intronic
1075048761 10:119166316-119166338 AAGGGCAGGTGGGAGGAGGAAGG - Intergenic
1075058934 10:119241150-119241172 AAGCTGAGGCCGGAGGAGGAGGG - Intronic
1075223375 10:120603355-120603377 AAGGGGATTGTGGAGGATGAGGG + Intergenic
1075482720 10:122796316-122796338 AAGGAGAGTGAGGGAGAGGAAGG + Intergenic
1075482725 10:122796339-122796361 AAGGAGAGTGAGGGAGAGGAAGG + Intergenic
1075628697 10:123985919-123985941 AAGGGGATTATGGAGGATGAGGG + Intergenic
1075632104 10:124006643-124006665 GGTGGGAGTCAGGAGCAGGACGG - Intergenic
1075639319 10:124053378-124053400 AGGGGGAGACAGGTGGAGCAGGG + Intronic
1075688507 10:124380006-124380028 CAGGGGAGTCGGGAGGAGCAGGG - Intergenic
1075688595 10:124380375-124380397 CTGGGGAGTCGGGAGGAGCACGG - Intergenic
1075688622 10:124380481-124380503 TTGGGGAGTCAGGAGGAGCATGG - Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075753361 10:124791757-124791779 AAGGGCAGTCCCGGGGAGGACGG - Exonic
1075992113 10:126846798-126846820 GTGGGGAGTCAGGACGGGGATGG - Intergenic
1076009359 10:126974994-126975016 TATGGGAGGCAGGAGGAGGAAGG - Intronic
1076024706 10:127101696-127101718 AAGGGGAGCCAGCAGCAGGTGGG + Intronic
1076071168 10:127490970-127490992 AAGGGGACTGGGGAGGGGGAGGG - Intergenic
1076099271 10:127761825-127761847 AAGGGGATTGTGGAGGATGAGGG - Intergenic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076121432 10:127939928-127939950 AGGAGGAGACAGGAGGAGGCAGG + Intronic
1076442344 10:130488606-130488628 AAGGGGATTGAGGAAGAGGCAGG + Intergenic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077164947 11:1130766-1130788 AGGGGGAGTGAGGAGGTGGGAGG - Intergenic
1077281087 11:1746577-1746599 ATGATGAGTCAGGAGCAGGAGGG + Intronic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077391338 11:2301962-2301984 AAGGGCAGGCAGGAAGGGGAGGG - Intronic
1077483855 11:2830008-2830030 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1077557245 11:3231597-3231619 AACAGGAGGGAGGAGGAGGAGGG + Intronic
1077701140 11:4443571-4443593 AAGGGGAGGGTGGAGAAGGAAGG + Intergenic
1077701147 11:4443590-4443612 AAGGGGAGGGTGGAGAAGGAAGG + Intergenic
1077761751 11:5107726-5107748 AGGGGGAGGGGGGAGGAGGAAGG + Intergenic
1077922259 11:6650413-6650435 AAGGGGGGTCAGCAGGAAGCTGG + Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1079069183 11:17328523-17328545 AAGAGGAGTGAAGAGCAGGAAGG - Intronic
1079341976 11:19618811-19618833 AAGTGGAGTAAGAAGGAAGATGG + Intronic
1079360281 11:19765323-19765345 AAGAGGAGGAAGGATGAGGAAGG - Intronic
1079875049 11:25845856-25845878 AAGGAGGTTCAAGAGGAGGATGG - Intergenic
1079996845 11:27304597-27304619 AACGGGAGCCAGGAAGAGGCGGG + Intergenic
1080268103 11:30422644-30422666 GAGGGGGGAAAGGAGGAGGAGGG + Intronic
1080575706 11:33597371-33597393 GAGGGGAGAAGGGAGGAGGAGGG + Intronic
1080616962 11:33952954-33952976 AAAGGGATTGAGTAGGAGGAAGG - Intergenic
1080656817 11:34264823-34264845 AAGTGGGGTCGGGATGAGGAGGG - Intronic
1080947926 11:36995889-36995911 GAGAGGAGTGAGGAGGATGAGGG - Intergenic
1081670620 11:44940231-44940253 ATGGGGAGGCTGGAAGAGGAAGG - Intronic
1081730758 11:45370193-45370215 AGGGGCAGTCAGGAGGAGGAGGG + Intergenic
1081851029 11:46275452-46275474 AAGGGGTGGCAGGGGGAGGAGGG - Intergenic
1081875207 11:46403839-46403861 AAGGGGAGTGGGGAGGGGCAGGG + Intronic
1082012696 11:47460986-47461008 AAAGGGAGTGAGGGAGAGGATGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083185866 11:61017548-61017570 AAGGTGAGTCAGGATGGGAAGGG + Exonic
1083814674 11:65125921-65125943 AGGGGGCCTCAGGAGGAGGGAGG + Exonic
1083865007 11:65448938-65448960 AAGAGGTGTCAGCAGGAGGAGGG - Intergenic
1083886889 11:65577309-65577331 GAGGGGAGTAAGCAGGAGGCTGG + Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084644203 11:70445198-70445220 AGGGGGGCACAGGAGGAGGAAGG + Intergenic
1084665062 11:70571841-70571863 AAAGCGAGAGAGGAGGAGGAGGG + Intronic
1084682099 11:70672435-70672457 GGGAGGAGTCAGGAGGAGAAGGG - Intronic
1084887506 11:72220809-72220831 ACGAGGTGGCAGGAGGAGGAGGG + Intronic
1085521858 11:77143783-77143805 GAGGAGAGTCAGGAGAAAGAGGG + Intronic
1085554677 11:77409787-77409809 AAAGGGAGTGAGGAGGATGAAGG + Intronic
1085572063 11:77568518-77568540 AAGGGGAGGGAAGAGGGGGAAGG - Intronic
1086114239 11:83230387-83230409 TAGGGGAGTCAGAGGGAGGTAGG - Intronic
1086872021 11:92049249-92049271 AAGTGGAGTAAGGGAGAGGAGGG - Intergenic
1087211894 11:95453472-95453494 AGGAGGGGTCAGGAGGAGCAGGG - Intergenic
1087850285 11:103019843-103019865 AAGGGGAGTGAGAAGGAAGAAGG + Intergenic
1087951572 11:104227172-104227194 GGGGGGAGTGAGGGGGAGGAAGG + Intergenic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088154786 11:106790214-106790236 AAGGGGAGGGAAGAGTAGGAAGG - Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088466731 11:110147701-110147723 AAGGGGAGGCAAAAGGAGTAAGG - Intronic
1088599632 11:111462984-111463006 AAGGGGAGTGAGAAGAAAGAAGG + Intergenic
1088626355 11:111733180-111733202 AAAGGGAGGCAGCAGCAGGAAGG - Intronic
1088645476 11:111913320-111913342 GAGGGGAGTCAGGAGGAGTAGGG - Intronic
1088678337 11:112217963-112217985 AAGGGGGGCAAGGAGGAAGAGGG + Exonic
1088908413 11:114171981-114172003 AAAGGGAGACAGGAGCAGCAGGG + Intronic
1088920266 11:114255477-114255499 ACGGGGAGCCAGAGGGAGGAGGG - Intergenic
1088938157 11:114425661-114425683 AAGTGGAGGCAAGAGTAGGAAGG - Intronic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089269916 11:117295036-117295058 AAGGGGAATTAGCAGAAGGAGGG - Intronic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1089905847 11:122037714-122037736 AAGAGGAGGAAGGAAGAGGAAGG + Intergenic
1089915532 11:122152098-122152120 AAGGGGGCTGAGGTGGAGGAAGG - Intergenic
1090025380 11:123163096-123163118 AAGAAGAGTCAGGAGAAAGAAGG + Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090845629 11:130527769-130527791 AAGGGGAGAGAGGAAGAGAAAGG - Intergenic
1090868993 11:130726315-130726337 AAGGGGAGTGTGGAGGGAGATGG + Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091325030 11:134679636-134679658 TGGAGGAGTCAGGAGGAGGAGGG + Intergenic
1091382460 12:70920-70942 AAGGGTAGTGAGGCAGAGGAGGG - Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091538364 12:1435323-1435345 GAGGGGAGTTAGGAGAAGAAAGG + Intronic
1091541352 12:1465656-1465678 CAGGGGAGTCAAGTGGAGAATGG - Intronic
1091583440 12:1802393-1802415 AAGGGGAGCCGGGGGCAGGAGGG - Intronic
1091665924 12:2418542-2418564 GAGGAGAGAGAGGAGGAGGAGGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091963280 12:4717679-4717701 AGGCTGAGGCAGGAGGAGGATGG - Intronic
1092226908 12:6753462-6753484 AAGGGGAAACTGGAGGACGAGGG + Exonic
1092239474 12:6828352-6828374 AAGGGGAGGGAGGGGGAGGAAGG - Intronic
1092493446 12:8967976-8967998 AAGGGAAGGAAGGAGGAGGGAGG + Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093236250 12:16611114-16611136 AAAGGGTGTTATGAGGAGGAGGG + Intergenic
1093474154 12:19536155-19536177 ATGGGGAGTGAGCAGGAAGATGG + Intronic
1093670415 12:21867774-21867796 AAGGGGCCTGAAGAGGAGGATGG + Intronic
1094170507 12:27486336-27486358 AAGGGGATGCAGGAGAAGGCTGG - Intronic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094327980 12:29260611-29260633 CAGGGGAGTGAAGAGTAGGAAGG + Intronic
1095440838 12:42237878-42237900 GAAGGGAGTCAGGAAGAGGCAGG + Intronic
1095484881 12:42674421-42674443 AAGGGCAGCCAGGAGCAGGATGG - Intergenic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1095639828 12:44475336-44475358 AAGGGGAGGGAAGAGTAGGAAGG - Intergenic
1096069329 12:48766312-48766334 TAGAGGAGTCAGGAGGTGGGAGG - Exonic
1096225770 12:49865981-49866003 AAGTGGGGTCAGGAGGCGCATGG - Intergenic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096537680 12:52286008-52286030 AAGGGGCCTCAGGAGCAGGAAGG - Exonic
1096590430 12:52655377-52655399 GAGGCGAGTCAGCAGGAGGCTGG + Intergenic
1096595009 12:52689471-52689493 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1096630852 12:52925921-52925943 TAGGGGAGGAAGGAGGAGAAAGG + Intronic
1096648974 12:53052774-53052796 GAGGAGAATGAGGAGGAGGAAGG + Intronic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1096797807 12:54089633-54089655 AAAGGGAGTGAGGAGGCGGCTGG + Intergenic
1096804014 12:54129352-54129374 AAGGGGAGTGAGGGGAAGGCGGG + Intergenic
1096838804 12:54369024-54369046 AAAGGGAGCGAGAAGGAGGAGGG - Intergenic
1097282660 12:57854250-57854272 AAGGGGAGGAAGGAGGAAGAAGG + Intergenic
1097351401 12:58553209-58553231 AAGGGTAGGAAGGAGGAGCAGGG - Intronic
1097790664 12:63811970-63811992 AAGAGGAGGAAGGAGGGGGAGGG + Intergenic
1098079180 12:66765859-66765881 ATGGGGAGACAGGAAGAAGATGG + Intronic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099064935 12:77963997-77964019 AAGAGGAGGGAGGAGGAGGGAGG - Intronic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099945597 12:89240225-89240247 AAGGGTAGTCAGGAGTTGGAGGG - Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1100217754 12:92470056-92470078 CAAGGGAGTCCGGAAGAGGAGGG - Intergenic
1100565723 12:95791238-95791260 AGGGGGTGGCTGGAGGAGGAGGG - Intergenic
1100679535 12:96903715-96903737 AAGAGGAGAAAGGAGGAGAAGGG - Intergenic
1101061757 12:100979605-100979627 AACAGGAGCCAAGAGGAGGAAGG + Intronic
1101706532 12:107225735-107225757 AGGGGGAGGAAGGAGGAGGAGGG + Intergenic
1101843141 12:108342070-108342092 GGAGGGAGTAAGGAGGAGGAGGG + Intergenic
1102303087 12:111785071-111785093 AAAGGCAGGGAGGAGGAGGAAGG - Intronic
1102419463 12:112792349-112792371 AAGGGTAGTTGGGAGGAGAAGGG + Intronic
1102430992 12:112882677-112882699 CTGGGGAGTGAGGAGGAGCAGGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102471716 12:113163202-113163224 CAGGGGAGCCAAGAGGCGGAGGG - Exonic
1102645830 12:114403275-114403297 AGGAGGAGGCAGGAGGAGGCGGG + Intronic
1102786118 12:115606349-115606371 AAGGGGAGAGAGGAGGGGGATGG + Intergenic
1103191598 12:119006500-119006522 ATGGGGAGTCGGGAGCAGAAGGG - Intronic
1103219472 12:119231874-119231896 AGGGGGAGGAGGGAGGAGGAAGG - Intergenic
1103461447 12:121108002-121108024 AAGGGGAGTGAAGAGTGGGAAGG + Intergenic
1103819955 12:123689653-123689675 GAGGGTAGTGAGTAGGAGGAGGG - Intronic
1103903848 12:124317436-124317458 AAGGGGAGTGAGGAACGGGACGG - Intergenic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1104636458 12:130440555-130440577 GTGGGGAGTCAGGAGGTGAAGGG - Intronic
1104670671 12:130677939-130677961 AGAGGGAGCCAGGTGGAGGAGGG - Intronic
1105387630 13:19946327-19946349 AAGGAGAGTCAAGAGCAGGCGGG - Intergenic
1105789879 13:23788000-23788022 ACTGGGAGTCAGCTGGAGGAGGG + Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106002321 13:25735621-25735643 AAGGTAAGTCAGGAGGATAAGGG + Intronic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106665575 13:31847157-31847179 ACATGGAGGCAGGAGGAGGACGG - Intergenic
1106869165 13:34000378-34000400 AAAGGAAATCATGAGGAGGAAGG - Intergenic
1107227888 13:38072845-38072867 AAGGTTGGTCAGGAGGAAGATGG - Intergenic
1107355465 13:39561165-39561187 ATGGGGAGTGGGGAGGAGGCAGG - Intronic
1107421005 13:40246385-40246407 AAGAGGAATCAGGAGGAAGGAGG - Intergenic
1107550313 13:41468401-41468423 CAGGAGAGTGAGGAGCAGGAAGG - Intronic
1107824299 13:44313624-44313646 AAAGGGAGGCTGGAGGAGCAGGG + Intergenic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108499850 13:51060092-51060114 AAGGCGTCTTAGGAGGAGGAAGG - Intergenic
1108821751 13:54359324-54359346 AATGGGAGGTAGGAGGTGGAAGG - Intergenic
1110563005 13:76929354-76929376 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1110947437 13:81440439-81440461 AAGGGTAGTGGGGAGGAGGGGGG + Intergenic
1111184859 13:84720422-84720444 ATGGGGAGCCAGGAGGGAGATGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111396346 13:87672929-87672951 AAGGGGAGGGAGGAGAGGGAAGG - Intronic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111764006 13:92503225-92503247 AAGGTGAGACAGTAGGAGGGAGG - Intronic
1111996067 13:95167450-95167472 AAGGCAAGTCAGGTGGGGGAAGG + Intronic
1112232263 13:97601117-97601139 TAGGGGAGCAAGGAGGATGAGGG + Intergenic
1112323282 13:98426527-98426549 AGGGAGAGACAAGAGGAGGATGG + Intronic
1112336593 13:98522000-98522022 AAGGAGAGAGTGGAGGAGGAGGG - Intronic
1112505267 13:99971192-99971214 AAGGGGTGGGAGGAAGAGGAGGG + Exonic
1112840546 13:103572255-103572277 AAGGGAAGAGAGGTGGAGGAAGG - Intergenic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113251043 13:108452804-108452826 AGGGGGAGTGAGGAGGAGAGTGG + Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113447411 13:110379910-110379932 GAGAGGAGGCAGGTGGAGGAGGG - Intronic
1113558708 13:111258996-111259018 AAGGGGAGTGAAGAGTGGGAAGG + Intronic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113637078 13:111926999-111927021 ACGGGCAGCCAGGAGGAGGCTGG + Intergenic
1113659520 13:112096123-112096145 AAGGGGAGGGAGGAGGAAGGGGG - Intergenic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1113843089 13:113371423-113371445 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843097 13:113371443-113371465 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843106 13:113371463-113371485 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843113 13:113371482-113371504 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843122 13:113371502-113371524 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843130 13:113371522-113371544 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843139 13:113371542-113371564 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843147 13:113371562-113371584 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843156 13:113371582-113371604 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843164 13:113371602-113371624 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843173 13:113371622-113371644 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843181 13:113371642-113371664 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843190 13:113371662-113371684 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843198 13:113371682-113371704 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843213 13:113371721-113371743 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843221 13:113371741-113371763 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843229 13:113371761-113371783 GAGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843237 13:113371780-113371802 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843258 13:113371839-113371861 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843267 13:113371859-113371881 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843276 13:113371879-113371901 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113890713 13:113734331-113734353 AAGGGGTCACAGGATGAGGAGGG + Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1113933465 13:113980916-113980938 GAGAGGAGTGAGCAGGAGGATGG + Intronic
1114349926 14:21838414-21838436 AAAGGGACTCAGTAGCAGGAAGG + Intergenic
1114363530 14:22002574-22002596 AAAGGGAGTGGGGAGAAGGAAGG + Intergenic
1114465922 14:22922671-22922693 AAGGGAAGAAAGCAGGAGGAAGG + Intronic
1114525876 14:23366488-23366510 CAGCGGAGTCCGGAGGAGGAAGG - Intergenic
1114552115 14:23538721-23538743 AAGAGGAGGAAGGAGGAAGAGGG + Intronic
1114822452 14:26037816-26037838 AATGGGAGTCAGTGGGAGTATGG - Intergenic
1114987921 14:28252829-28252851 AAGGGGAGAAAAGAGTAGGATGG - Intergenic
1115492144 14:33967887-33967909 AAGAGAAGTCAGGAAGGGGAAGG + Intronic
1115539060 14:34401797-34401819 AAGGGTAGTCAGGGGCAGGGGGG + Intronic
1115724511 14:36198502-36198524 AGGGGGAGTCGGGAGGGGGAGGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116416968 14:44689811-44689833 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416974 14:44689826-44689848 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416980 14:44689841-44689863 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416992 14:44689868-44689890 AAGGAGGGGGAGGAGGAGGAGGG + Intergenic
1116529769 14:45955805-45955827 AAGTGGACTGAGGACGAGGATGG - Intergenic
1117557804 14:56904563-56904585 AAAGGTAGTAAGGAGGATGAGGG - Intergenic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118623698 14:67637483-67637505 AAGAGGAGTGAGGAGGCTGATGG - Intronic
1118676310 14:68188351-68188373 AAGGGGAGAAAGGAGGAGGGGGG - Intronic
1118867254 14:69713242-69713264 AAGAGGCTTCAGGAGAAGGAAGG - Exonic
1119067405 14:71542652-71542674 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
1119162571 14:72465334-72465356 AAGCAGAGTGAGGAGGAAGAAGG + Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119217706 14:72881777-72881799 AAGGGGCTTCAGGAGGGGGTGGG + Intronic
1119532742 14:75374296-75374318 AGTGGGAGTGGGGAGGAGGAAGG + Intergenic
1119724711 14:76914972-76914994 TGGGGGTGTCAGGTGGAGGAGGG - Intergenic
1119771450 14:77222595-77222617 TAGGGGAGTTGGGAGGAGTAAGG - Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120167970 14:81220675-81220697 GAGCGGAGAGAGGAGGAGGAGGG + Exonic
1120218161 14:81703147-81703169 AATTAAAGTCAGGAGGAGGAGGG + Intergenic
1120346224 14:83294013-83294035 AAGGGGAGGGGAGAGGAGGAAGG - Intergenic
1120746171 14:88153842-88153864 GAGAGGAGGCAGGAGCAGGAAGG + Intergenic
1120895422 14:89527072-89527094 AAGGGAGGAGAGGAGGAGGAAGG + Intronic
1120899909 14:89566867-89566889 AAGGAGGGTAAGGAAGAGGAGGG - Intronic
1121083067 14:91124330-91124352 AAGAGGAGGCATCAGGAGGAGGG - Intronic
1121098366 14:91233498-91233520 AAGGGAAGACTGGAGGGGGAAGG - Exonic
1121125021 14:91400309-91400331 AATGGGGATCGGGAGGAGGACGG + Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121662337 14:95644655-95644677 AAGTGGATTCAGCAGGATGATGG + Intergenic
1121735710 14:96216685-96216707 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122036098 14:98950407-98950429 AAGGGGAGGGGAGAGGAGGAAGG + Intergenic
1122284394 14:100642161-100642183 AAGGGGACTAGGGAGGAGGGAGG + Intergenic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122327336 14:100890565-100890587 AAGGGGAGTAAGGGAGAGGTGGG + Intergenic
1122454889 14:101842451-101842473 AAGGGGAGTGAGGAGCAAGCTGG + Intronic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122878240 14:104678595-104678617 AAAGGGAGTGAGGAGGAGAGAGG - Intergenic
1122985530 14:105209910-105209932 GAGGGGGGTCTGGAGGAGGCAGG + Exonic
1123068110 14:105628256-105628278 GAGGGGGGGCAGGAGGAGCAGGG - Intergenic
1123434888 15:20247760-20247782 AAGGGGAGTGAAGGGGAGGTGGG + Intergenic
1123703735 15:22935617-22935639 TACTGGAGGCAGGAGGAGGAAGG + Intronic
1123871730 15:24581700-24581722 ATGAGGAGGCAGGAGCAGGAAGG + Intergenic
1123895888 15:24829480-24829502 ATGAGGAGGCAGGAGAAGGAAGG + Intronic
1123899558 15:24862913-24862935 ATGAGGAGGCAGGAGCAGGAAGG + Intronic
1124430998 15:29608493-29608515 AGGAGGAGGCAGGAGGAGGCAGG - Intergenic
1124600029 15:31126453-31126475 AAGAGGAGTGGGGAGGAGAAGGG - Intronic
1125159882 15:36630806-36630828 ATGGTGAGAGAGGAGGAGGAGGG + Intronic
1125457910 15:39879546-39879568 AAGGGGAGTAAGGTCAAGGAGGG - Intronic
1125617824 15:41031489-41031511 GAGGGGAGGAAGGAGAAGGAAGG + Intronic
1125753833 15:42049082-42049104 AGGCAGAGTCAGGAAGAGGAAGG + Intronic
1126114859 15:45199218-45199240 AGGAGGAGTCAGGAGGAGTCAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126517565 15:49553619-49553641 AAGGGGAGGGAAGAGTAGGAAGG - Intronic
1127022238 15:54760734-54760756 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
1127123342 15:55789715-55789737 AACGGGAGTGGGGAGGGGGAGGG - Intergenic
1127177958 15:56382080-56382102 AAGGGGAGTGAACAGCAGGAAGG - Intronic
1127647249 15:60971215-60971237 TAGGGGAGTCCAGAGGAGGGCGG - Intronic
1127733635 15:61821980-61822002 AAGGGGAGACAGGACAAGGCGGG - Intergenic
1128013012 15:64316451-64316473 AATGGAACTCAGGAGGTGGAGGG + Intronic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128363451 15:66979555-66979577 AAGGGGAGGGAGGAAGGGGAAGG - Intergenic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128683669 15:69668563-69668585 AGGGGAAGAAAGGAGGAGGAGGG + Intergenic
1128740978 15:70083532-70083554 GAGGGGAGGGAGGAGGGGGAAGG - Intronic
1128762006 15:70223497-70223519 GAGGGGAGGCAGGAGGGGCAGGG - Intergenic
1128783360 15:70377421-70377443 GAGGGGAGGTTGGAGGAGGAAGG - Intergenic
1129410921 15:75349851-75349873 GAGGAGAGCCAAGAGGAGGATGG + Intronic
1129524747 15:76206614-76206636 AAGGTGAGCCTGGAGGAGGAGGG - Intronic
1129524957 15:76208001-76208023 AAGGAATGTCAGGAGGAGGGTGG + Intronic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1129674235 15:77623666-77623688 AAGGGGAGGCAGGTGGGGGCGGG - Intronic
1129681796 15:77662342-77662364 AAGGGCGGTCAGAGGGAGGAAGG + Intronic
1130025238 15:80265359-80265381 ACATGGAGTCAGTAGGAGGATGG - Intergenic
1130060026 15:80563048-80563070 GAAGGAAGTCAGCAGGAGGAAGG - Intronic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130300890 15:82679545-82679567 AAGGAGGGTCAGGGGGAGAAGGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130441092 15:83955240-83955262 AAGGGGAGGGAAGAGGGGGAAGG - Intronic
1130630073 15:85558940-85558962 AAAGGGAGGGAGGAGGAGGAGGG - Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131215399 15:90530977-90530999 AAGGGGGGTCAGCAGGAGTGGGG + Intronic
1131229181 15:90647512-90647534 GAGGGGGGTGAGGCGGAGGAGGG - Intergenic
1131229235 15:90647660-90647682 AGGAGGGGTGAGGAGGAGGAGGG - Intergenic
1131338269 15:91571308-91571330 ATGGGGATTCAGGAGGAGCTAGG + Intergenic
1131537974 15:93253446-93253468 AATTGGATTCAGGAGGTGGAGGG - Intergenic
1131671597 15:94625680-94625702 TTGAGGAGTCAGGAGGAGGTTGG + Intergenic
1131901091 15:97088616-97088638 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1131965799 15:97840933-97840955 AAGAAGAGTAAGGGGGAGGATGG - Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132185338 15:99798349-99798371 AAGGGGAGGAAGAAGGAGGGAGG + Intergenic
1132219559 15:100095142-100095164 AAGGAGAGGCAGGAGCAGGTTGG - Intronic
1132399460 15:101496556-101496578 AAGGGGCGGCAGGGGCAGGAAGG - Intronic
1132702585 16:1228451-1228473 AAGGGGGCTCAGGATGGGGAAGG + Exonic
1132725059 16:1334803-1334825 AAGGGGAGTCGGGGGGCTGAGGG + Intronic
1132860941 16:2071492-2071514 AAGGCCTGTCAGGAAGAGGATGG - Exonic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1132989829 16:2786941-2786963 GAGGGGAGTGAGGAGGAGGGGGG - Intronic
1132989868 16:2787065-2787087 GAGGGGAGTGAGGAGGAGCAGGG - Intronic
1132989972 16:2787387-2787409 GAGGGGAGTGAGGAGGAAGGGGG - Intronic
1133026349 16:2990513-2990535 GGAGGGAGTCAGGAGGAGGGAGG - Intergenic
1133327251 16:4949262-4949284 AGGAGGAGCCAGGAGGAGGGAGG - Intronic
1133392789 16:5422898-5422920 GAGGGGAGGAAAGAGGAGGAGGG + Intergenic
1133392821 16:5422994-5423016 GAGGGGAGGAAGGAGGAGAAAGG + Intergenic
1133392848 16:5423076-5423098 AAGGAGAGGGAGGAAGAGGAAGG + Intergenic
1133417310 16:5616626-5616648 AGGAGGGGTGAGGAGGAGGAGGG - Intergenic
1133460706 16:5984077-5984099 AGTGGGAGGGAGGAGGAGGAGGG - Intergenic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520202 16:6549315-6549337 GAGGGGAGGAGGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133736232 16:8617866-8617888 ATGTGGAGTCAGGCGGAGAATGG - Intergenic
1134066606 16:11232481-11232503 AGGGGGAGGGGGGAGGAGGAGGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134111428 16:11517710-11517732 AAGGGCAGGCGGGAGGAGCACGG - Intronic
1134171917 16:11976109-11976131 AAGGAGATTGAGGAGGTGGAGGG - Intronic
1134358422 16:13506464-13506486 AAGGAGTGTGATGAGGAGGACGG + Intergenic
1134692141 16:16197920-16197942 ATGCTAAGTCAGGAGGAGGAAGG + Intronic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1135166826 16:20146492-20146514 AAGGGGAGGAAGGAGGGAGAAGG + Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135381188 16:21997427-21997449 AGGGGGAGGCAGGAGGAGCGAGG + Intronic
1135538811 16:23314601-23314623 GAGGTGAGTGTGGAGGAGGAGGG + Intronic
1135543340 16:23349002-23349024 AAGGAGAGAAAGGAGAAGGAAGG - Intronic
1135780193 16:25293335-25293357 GAAGGGAGTCAGGAGGTGGGGGG + Intergenic
1136367417 16:29815142-29815164 ATGAGGAGGCAGGAAGAGGAAGG - Intronic
1136397998 16:30003459-30003481 CAGGGGAGTGAGGAGATGGAAGG + Intronic
1136705966 16:32188218-32188240 CGGGAGAGTCAGGAGGAGCAGGG - Intergenic
1136761947 16:32741187-32741209 CGGGAGAGTCAGGAGGAGCAGGG + Intergenic
1136806153 16:33129201-33129223 CGGGAGAGTCAGGAGGAGCAGGG - Intergenic
1136849729 16:33603223-33603245 AAGGGGAGTGAAGGGGAGGTGGG - Intergenic
1137374567 16:47941623-47941645 AGGGGGAGTGAGGAGGAGGGTGG + Intergenic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137749146 16:50845722-50845744 AAGGGGAGGCTGGAAGATGAGGG + Intergenic
1138126162 16:54440461-54440483 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1138224730 16:55282850-55282872 AATGGGAGAGAGGAGGAAGAAGG + Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138287394 16:55820797-55820819 TAGGGGAGGCAGGCAGAGGAAGG - Intronic
1138339863 16:56281569-56281591 AAGGGGACTGAGAAGGAGGGAGG - Intronic
1138444616 16:57055522-57055544 AAGTTGAGGGAGGAGGAGGAAGG + Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139330325 16:66183570-66183592 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
1139330328 16:66183580-66183602 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
1139424995 16:66873873-66873895 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1139846387 16:69924644-69924666 AAGGGGAGACAGGGGAAAGAAGG - Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140018683 16:71215257-71215279 AAAGGGAGGAAGGAGGGGGAAGG + Intronic
1140372511 16:74420945-74420967 AGGAGGAGGAAGGAGGAGGAAGG - Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141270990 16:82541123-82541145 AGGGAGAGTCAGGAGGAGGGAGG + Intergenic
1141372476 16:83500559-83500581 AAGAGGAGGAGGGAGGAGGAGGG - Intronic
1141485215 16:84334255-84334277 AAGGGGAGGAAAGAGCAGGAAGG + Intergenic
1141612223 16:85188088-85188110 AAGGGGAGGCAGGTGTGGGATGG + Intergenic
1141775798 16:86121880-86121902 AGGAGGAGGCAGGAGTAGGAGGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1141946104 16:87311071-87311093 AAGGGGAGATGGGAGGAAGAAGG - Intronic
1141980891 16:87549718-87549740 AAGGGGAGTGAGGAGCAGGAAGG - Intergenic
1141992447 16:87618299-87618321 AAGAGGAGGCAGGAGGAGGGAGG + Intronic
1142137995 16:88460315-88460337 AAGGTGGGTCAGGAGGAGTGGGG + Intronic
1142246547 16:88972802-88972824 AAGGGGGGACAGGAGGCGGGAGG + Intronic
1142259031 16:89033792-89033814 AGGGGGACTCAGGAGGTAGAAGG + Intergenic
1142266504 16:89066406-89066428 CAGTGGAGTCAAGAGGGGGACGG + Intergenic
1142362237 16:89632941-89632963 GAGGGGCTGCAGGAGGAGGAGGG + Intronic
1203064105 16_KI270728v1_random:1001503-1001525 CGGGAGAGTCAGGAGGAGCAGGG + Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142562934 17:821822-821844 AGGGGGAGGAAGGGGGAGGATGG - Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142641718 17:1288894-1288916 ATGGGGAGTCTGGTGGGGGATGG - Intronic
1142641736 17:1288931-1288953 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142641745 17:1288950-1288972 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142641797 17:1289060-1289082 ATGGGGAGTCTGGTGGGGGATGG - Intronic
1142641815 17:1289097-1289119 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142641824 17:1289116-1289138 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142666719 17:1467695-1467717 TTGGGGGGTCAGGAGGTGGATGG - Intronic
1142705821 17:1693573-1693595 AAAGGGAGTGAGTAGGAGGAGGG + Intergenic
1142958175 17:3535238-3535260 AGGAGGAGTAAGGAGGGGGAGGG - Intronic
1143095266 17:4475476-4475498 GAGGGGAGTGAGGGTGAGGAAGG + Intronic
1143095631 17:4476975-4476997 AAGGACAGTCAGGATCAGGACGG - Intronic
1143102216 17:4510663-4510685 GGGCGGAGTCAGGAGGAGGCAGG - Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143478906 17:7217612-7217634 AAGGGGAGAGAGGAGGAGAGAGG + Intronic
1143561160 17:7696026-7696048 AAGGGGAGTGAGGAGCACCAGGG + Intronic
1143629982 17:8133521-8133543 AAGGGCAGCCAGGAAGAGGCTGG - Intergenic
1143779589 17:9222232-9222254 AGCTGGAGTGAGGAGGAGGACGG - Intronic
1143965797 17:10755837-10755859 AGGGAGAGAGAGGAGGAGGAAGG - Intergenic
1144045724 17:11452931-11452953 AAGGAGAGGGAGGAAGAGGAGGG - Intronic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144952247 17:19000597-19000619 AAGGTGAGTGAGGAGGCGGAAGG + Intronic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1145263450 17:21368072-21368094 AAGGGGAGTTGGGAGTGGGAAGG + Intergenic
1145727161 17:27140809-27140831 AAGAGGAGAAAGGAGGAGGAAGG - Intergenic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1146034130 17:29390926-29390948 GTGAGGAGTGAGGAGGAGGAGGG - Exonic
1146187317 17:30732199-30732221 AAGTGGACTCCCGAGGAGGAAGG - Intergenic
1146265576 17:31450605-31450627 AAAGGGACCCAGGAGGAGGGCGG - Intronic
1146332374 17:31937596-31937618 AAGTGGACTCCCGAGGAGGAAGG - Intronic
1146466292 17:33089267-33089289 AAAGGGAGGCAGGAGGATCAAGG + Intronic
1146710496 17:35036899-35036921 AAGGGGAGAGAGGAGTAGAAGGG + Intronic
1147498826 17:40942615-40942637 AAGAGGAGGGGGGAGGAGGAAGG - Intergenic
1147565901 17:41536329-41536351 AGAGGGAGTGAGGAGGAGGCAGG - Intergenic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1147610217 17:41797599-41797621 AAAGGAAGAAAGGAGGAGGAAGG - Intergenic
1147844353 17:43394391-43394413 AAGAGGAGTCTGCAGGAGTAGGG - Intergenic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1147947293 17:44087254-44087276 AAGGGGAGTGGGAAGGAGGCCGG - Intronic
1147955734 17:44133298-44133320 CAGAGGAGTCAGGGGAAGGAGGG - Intergenic
1147995893 17:44360151-44360173 AAAGGGAGTGAGGACGAGGGAGG + Intronic
1148127189 17:45242932-45242954 ACAGGGAGCCTGGAGGAGGAGGG - Intronic
1148193300 17:45695207-45695229 TAAAGGAGTCAGAAGGAGGAGGG + Intergenic
1148324778 17:46776898-46776920 AGGGGGAGGAAGGAGGAGGCAGG - Intronic
1148343788 17:46890122-46890144 AAGAGGAGCGAGGAGGAGGAGGG - Intergenic
1148695246 17:49554917-49554939 AAGGGGAGACAGGAGGATCTGGG + Intergenic
1148744702 17:49911777-49911799 AAGAGGGGTGAGGAAGAGGAGGG + Intergenic
1148758265 17:49985966-49985988 AAGGGGAGAATGGAGGGGGAAGG - Intergenic
1148774799 17:50089285-50089307 AAGGGGACACTGGGGGAGGAGGG - Exonic
1148902330 17:50887766-50887788 ATGGAGAGTTGGGAGGAGGAAGG + Intergenic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149170559 17:53805342-53805364 GAGGAGAGTCAGGAGTAGGGAGG + Intergenic
1149297492 17:55273772-55273794 AAGGGAAGCGAGGGGGAGGAGGG - Intronic
1149654706 17:58304152-58304174 AAGGGGAGCAGGGAGGGGGAGGG + Intronic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151389313 17:73775073-73775095 TGGGGAAGTGAGGAGGAGGAAGG + Intergenic
1151524283 17:74653264-74653286 AAGGGAAGAGAGGAAGAGGAGGG + Intergenic
1151549411 17:74813447-74813469 AAGGGGAGACAGGAGAATGAGGG - Intronic
1151726350 17:75887053-75887075 AGGCTGAGGCAGGAGGAGGAAGG + Intronic
1151842043 17:76625834-76625856 AAGGGCAGTGAGCAGCAGGAGGG + Exonic
1151955724 17:77379234-77379256 CCGGGGTGTCAGGAGGTGGAGGG + Intronic
1151964512 17:77424462-77424484 AAGGGGCTTCAGGAGGTGGGAGG + Intronic
1152000082 17:77639908-77639930 AAGAGGAGGAGGGAGGAGGAGGG - Intergenic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152315945 17:79580260-79580282 ATGGGGGGGGAGGAGGAGGACGG - Intergenic
1152326620 17:79645315-79645337 GTGGCTAGTCAGGAGGAGGAGGG - Intergenic
1152336879 17:79703703-79703725 GAGAGGGGTCAGGAGGAGGAAGG + Intergenic
1152441372 17:80312273-80312295 AAGGAGAGGGAGGAAGAGGAAGG + Intronic
1152598375 17:81249257-81249279 AGGAGGAGGGAGGAGGAGGAAGG + Intronic
1152800788 17:82329822-82329844 AGGGGGAGTCAGGGAGATGAGGG - Intronic
1153184765 18:2473717-2473739 AAAGGGAGAGGGGAGGAGGAAGG + Intergenic
1153524440 18:5980934-5980956 AAGGCTAGTGAGGCGGAGGATGG + Intronic
1153767079 18:8385055-8385077 AAGGGGAGGCATGAAGAGTAAGG + Intronic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1154180331 18:12132460-12132482 AAAGGGAGTTGGGAGAAGGAAGG - Intergenic
1154200445 18:12296225-12296247 ATGATGAGTCAGGAGGTGGATGG - Intergenic
1155066557 18:22273824-22273846 AGGGGGAGGAGGGAGGAGGAGGG - Intergenic
1155066572 18:22273863-22273885 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066581 18:22273889-22273911 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1155066589 18:22273915-22273937 AAGAGGAGGAGGGAGGAGGAGGG - Intergenic
1155066597 18:22273938-22273960 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066606 18:22273964-22273986 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066611 18:22273977-22273999 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066620 18:22274003-22274025 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155177333 18:23312437-23312459 AAGGTGACTCAGGAGAAGGCAGG - Intronic
1155208390 18:23580279-23580301 TAGGGGAGGCAGGAGGACAAGGG - Intronic
1155229306 18:23757447-23757469 GAGGGGACTGGGGAGGAGGAGGG - Intronic
1155996149 18:32333235-32333257 AAGGGGAGTGGAGAGGGGGAGGG + Intronic
1156055653 18:32999259-32999281 AAGGGGAGGAAAGAGGGGGAAGG + Intronic
1156338386 18:36188803-36188825 AGGGAGAGTCAGGAGGGAGACGG + Intronic
1156439266 18:37167445-37167467 ATGGGGTGTCAGAAGGGGGATGG + Intronic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157249171 18:46079132-46079154 AAGGAGATTCATGAGAAGGATGG + Intergenic
1157491997 18:48129951-48129973 GGTGGGAGTCAGGAGGAGGGCGG + Intronic
1157551227 18:48583053-48583075 GAGGGGAGGGAGGAGGATGATGG + Intronic
1157681465 18:49610672-49610694 AAGGGGAGACAGGGGGCGTAGGG + Intergenic
1157768650 18:50325088-50325110 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768653 18:50325098-50325120 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768656 18:50325108-50325130 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768659 18:50325118-50325140 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768662 18:50325128-50325150 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1158149319 18:54349644-54349666 AAAGGGTGGGAGGAGGAGGATGG - Intronic
1158516900 18:58138334-58138356 GAGGGGAGGGAAGAGGAGGAGGG - Intronic
1158516907 18:58138352-58138374 GAGGGGAGGGAAGAGGAGGAGGG - Intronic
1158516914 18:58138370-58138392 GAGGGGAGGAAAGAGGAGGAGGG - Intronic
1158610432 18:58935295-58935317 AGGAGGAGTAAGGGGGAGGAGGG - Intronic
1158975923 18:62711761-62711783 AAGTGGTGTCGGGAGGAGGCAGG - Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159863393 18:73675535-73675557 AAGGAGTTTCAGGAAGAGGAGGG - Intergenic
1159923387 18:74246717-74246739 ATGGGGAGATAGCAGGAGGATGG - Intergenic
1159927385 18:74281455-74281477 AAAAGGAGACAGGAGGTGGAGGG + Intronic
1159933089 18:74334324-74334346 AAGGGGAGAAAAGAGGAGGAGGG + Intronic
1160237670 18:77098935-77098957 AGGAGGAGTGAGAAGGAGGAGGG - Intronic
1160254216 18:77233835-77233857 GAGGAGGGTGAGGAGGAGGAGGG - Intergenic
1160254221 18:77233850-77233872 GAGGAGGGTGAGGAGGAGGAGGG - Intergenic
1160293558 18:77617230-77617252 AAGGGGAGACAGGATCAGCAAGG + Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160804414 19:985731-985753 AAGAGGAGTCGGGAGCAGGGTGG - Intronic
1160829834 19:1098589-1098611 GAGGGGAGGCAGCAGCAGGAGGG + Intergenic
1160869995 19:1273338-1273360 TAGGGGAGCCAGGCGGGGGACGG + Intronic
1160965788 19:1746339-1746361 AGGGGGAGGAAGGGGGAGGATGG + Intergenic
1161346517 19:3771145-3771167 GAGGGGAGTGAGGAGTTGGAGGG - Intronic
1161347907 19:3777290-3777312 TGGGGGAGGCAGGAGGAGGAGGG + Intergenic
1161404052 19:4081965-4081987 AAGAGGAGAGAGGAGGAGCAGGG - Intergenic
1161404057 19:4081988-4082010 AGGGGGAGGGAGGAGGAGTAGGG - Intergenic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1161513769 19:4685370-4685392 AGGGAGAGTCAGCAGGCGGAGGG + Intronic
1161657172 19:5523421-5523443 AAGGGGAGGCAGGGAGGGGACGG - Intergenic
1161821508 19:6533478-6533500 AAGGGGTTTCTGGAGGGGGAGGG - Intronic
1161821543 19:6533558-6533580 AAGGGGTCTCTGGAGGGGGAAGG - Intronic
1161821604 19:6533705-6533727 AAGGGGACTCTGGAGGGGGCAGG - Intronic
1161851842 19:6741200-6741222 AAGGGGAGACAGAGGTAGGAGGG - Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162080463 19:8214885-8214907 AAGGGCAGTGGGGAGGAGGTGGG + Intronic
1162094519 19:8302624-8302646 CAGAGGAGTAAGGAGGGGGAAGG + Intronic
1162151873 19:8651869-8651891 AAGGGTAGTGAGGAGGAAGAGGG - Intergenic
1162339208 19:10081742-10081764 AGGAGGAGGGAGGAGGAGGAAGG + Intergenic
1163003786 19:14384719-14384741 AAGGGGAAACAGGAGGAGATGGG - Intronic
1163153028 19:15425829-15425851 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163424787 19:17235435-17235457 AAGGGAGGTTAGGAGGAGGGCGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163624683 19:18382401-18382423 AAGGAGAGCCAGGAGGAGCTGGG + Intronic
1163751346 19:19080077-19080099 GGTGGGAGTCAGGAGGAGAACGG + Intronic
1163775619 19:19215586-19215608 GTGTGAAGTCAGGAGGAGGATGG + Intronic
1164441249 19:28282287-28282309 CAGGGGAGTCAGAAAGAAGATGG - Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164572616 19:29385276-29385298 AGGGGGTGGCAGGAGGTGGATGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1165098238 19:33422064-33422086 CAGGGGAGTAAGGGGGAGGTGGG - Intronic
1165117436 19:33537380-33537402 AGGGGCAGTCAGGAGAAGGAGGG - Intergenic
1165416022 19:35694062-35694084 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1165419612 19:35716442-35716464 AAGGGGAGGCCGGTGAAGGAAGG - Intronic
1165669142 19:37660581-37660603 AGGGTGAGTCAGGGGGAAGAGGG - Intronic
1165894960 19:39136082-39136104 AAGGGGGGTGACGAGGAAGAGGG - Intronic
1166552482 19:43675597-43675619 CAGGTGAGTCACGAGGAGGAAGG - Intergenic
1166912692 19:46171320-46171342 AAGGGGAGTCAGCCAGAGGGAGG + Intergenic
1167104573 19:47422389-47422411 AAGGAGGATGAGGAGGAGGACGG - Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167314089 19:48753716-48753738 AAGGGGGGGCAGGATAAGGAGGG + Intronic
1167426814 19:49433870-49433892 TGGGGGGGTCAGGAGGGGGATGG + Intronic
1167554191 19:50183043-50183065 AAGGAGGGGAAGGAGGAGGAAGG - Intergenic
1167579247 19:50332247-50332269 GGGGGGAGTGTGGAGGAGGATGG - Intronic
1167608190 19:50492864-50492886 AGGAGGGGTGAGGAGGAGGAGGG + Intergenic
1167719508 19:51168716-51168738 ATGGTGAGTCAGGATGAGGCAGG - Intergenic
1168122439 19:54259395-54259417 AAGGGGAGGGATGAGTAGGAAGG - Intronic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168236448 19:55066674-55066696 AAGGAGAGAGAGGAAGAGGAAGG - Intronic
1168241769 19:55092341-55092363 GAGGAGGGTCAGGTGGAGGATGG + Intronic
1168294264 19:55370879-55370901 AGGTGGAGGCAGGAGGAAGAGGG + Intergenic
1168345885 19:55650039-55650061 AGGGGGGGACAGGAGGAGGCCGG - Intronic
1168357719 19:55712862-55712884 AAGGAGGGGGAGGAGGAGGAGGG + Intronic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1168487774 19:56779249-56779271 AAGGGGAGTACTGAGGAGAAAGG + Intronic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925752427 2:7101034-7101056 AGGAGGAGACAGGAGGAAGAGGG - Intergenic
925827842 2:7867498-7867520 AAGAAGAGTCAGGAGAAGAATGG - Intergenic
925886184 2:8395239-8395261 AAGGGGAGTTGGAAAGAGGAGGG - Intergenic
925933851 2:8734149-8734171 AAGGGGAGGCAGCAGGAGTGGGG + Intronic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926123665 2:10258251-10258273 AAGGTGAGCAAGGAGGAGGAAGG - Intergenic
926142662 2:10377604-10377626 CACGGGAGCCAGGGGGAGGAGGG - Intronic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926266797 2:11330753-11330775 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
926266839 2:11330876-11330898 AAGAGGAATGAGGAGGAGGGAGG + Intronic
926962902 2:18378311-18378333 ATGAGGAGTCAGGAGGAGAATGG + Intergenic
927462326 2:23309955-23309977 GAGGGGAGTAAGGGGGAGGGAGG - Intergenic
927705637 2:25294879-25294901 AATGGGAGGGAGGAGGAGGAGGG - Intronic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
927916302 2:26938839-26938861 CAGGGGAGTCAGGTGGGGGAGGG - Intronic
928103916 2:28455350-28455372 AAGGGGGGTATGGAGTAGGAAGG - Intergenic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
928269298 2:29841993-29842015 AAGAGGAGTGAAGAGGAGGATGG - Intronic
928861938 2:35868898-35868920 AAGGGGAGTGAGGGGAGGGAGGG + Intergenic
929011508 2:37449839-37449861 AAGGGGAGGCAGGGCGTGGATGG - Intergenic
929034720 2:37679754-37679776 AGGAGGACTCAGGAAGAGGAAGG - Intronic
929240297 2:39647074-39647096 AAGGTGGGTCAGGAGGCAGAGGG + Intergenic
929242237 2:39665554-39665576 AAGGGGAGAGAGGAGGATGAGGG + Intronic
929444486 2:41991914-41991936 AAGGGGAGGGGAGAGGAGGAGGG + Intergenic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929548717 2:42875381-42875403 AAGCGGCGCCGGGAGGAGGAGGG - Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
930198453 2:48530651-48530673 AACAGCAGTCAGAAGGAGGAGGG - Intronic
931152010 2:59585017-59585039 AGGGGGAGTAAGAAGAAGGAGGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931348801 2:61470759-61470781 GAGGGGAGAGAGGCGGAGGAGGG + Exonic
931430147 2:62202851-62202873 GAAGGGAGGTAGGAGGAGGAGGG - Intronic
931847378 2:66218563-66218585 TAGGGGGGTGAGGTGGAGGAAGG + Intergenic
931985388 2:67736657-67736679 AAGGGGATGGAGGAGGAGAATGG - Intergenic
932297219 2:70636318-70636340 AAGGGCAGTCACCAGGAGTATGG - Intronic
932299703 2:70657631-70657653 AACGTGAATCAGAAGGAGGATGG - Exonic
932467110 2:71931012-71931034 AAGAGAAGGCAGGAGGAGAAAGG + Intergenic
932539411 2:72636425-72636447 AAGAGGAGGGAGGAGGAAGAAGG + Intronic
932781268 2:74560111-74560133 AGGGGAAGTAAGGAAGAGGAGGG + Intronic
932851869 2:75195375-75195397 AAGGGAAGGTAGGAGAAGGAGGG - Intronic
932916478 2:75864769-75864791 AAGTGGTGTCAGGTGAAGGAAGG + Intergenic
933042464 2:77487150-77487172 AATGGGAGCCAGGAACAGGAGGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933180631 2:79222643-79222665 AAAAGAAGGCAGGAGGAGGAAGG - Intronic
933628861 2:84633713-84633735 AAGGGAAGCCAGCAGGAAGAAGG - Intronic
933745024 2:85564272-85564294 AAGTGGAGTTGGGGGGAGGAAGG + Intronic
933792055 2:85890708-85890730 AAGGGGAATCTGGAAGAGAAGGG - Intergenic
934578671 2:95420405-95420427 AATGGGAGACTGGAGGAAGATGG - Intergenic
934653267 2:96104233-96104255 AGGGAGAGGAAGGAGGAGGAGGG - Intergenic
934765214 2:96876718-96876740 AAGAGGAGTCAAGAAGAGGCAGG + Intronic
934987874 2:98900401-98900423 GAGGGGAGGCAGGAGGATGGAGG + Intronic
935093834 2:99924598-99924620 GAGGGCTGTCATGAGGAGGAGGG + Intronic
935122565 2:100195835-100195857 TAGGGGAGTTGGAAGGAGGAGGG + Intergenic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935412964 2:102785227-102785249 AAGGGGACTGAGGAGGAGTGGGG - Intronic
935753673 2:106260876-106260898 AAGGGGAGAAGGGAGGATGAGGG + Intergenic
936067004 2:109339925-109339947 TGGGGGAGTGAGGAGGAGGCAGG + Intronic
936416201 2:112315276-112315298 TAGGGGACTCAGGAGAAGTAAGG + Intronic
936496560 2:113027281-113027303 AGGGGGAGGCAGGAGAAGCAGGG + Intronic
936534146 2:113298442-113298464 AATGGGAGACTGGAGGAAGATGG + Intergenic
937009206 2:118546544-118546566 AAGAGGAGTCATAAGCAGGAGGG - Intergenic
937046056 2:118852656-118852678 GCGGGGAGTCAAGAGGAGAAAGG - Intergenic
937112717 2:119378784-119378806 CAAGAGAGTGAGGAGGAGGAGGG - Intergenic
937217349 2:120321220-120321242 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
937307194 2:120879525-120879547 ATGAGCAGTTAGGAGGAGGATGG + Intronic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937573354 2:123390973-123390995 AAGGAGAATGGGGAGGAGGAAGG - Intergenic
937814081 2:126231736-126231758 AAGAGGGGAGAGGAGGAGGAGGG - Intergenic
938095116 2:128456516-128456538 AAGGGGAGGCAGGGGGATGAGGG - Intergenic
938321827 2:130371224-130371246 CTGGGGAGTCCGGAGGAAGAGGG - Exonic
938341167 2:130537558-130537580 GGGGGGGTTCAGGAGGAGGATGG + Intergenic
938348664 2:130583151-130583173 GGGGGGTTTCAGGAGGAGGATGG - Intronic
938614530 2:132983698-132983720 CATGGGAGTCGGGAGGAGGGGGG + Intronic
938630427 2:133160722-133160744 AAGGGTAGTAAGTAGCAGGAAGG - Intronic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939172482 2:138711726-138711748 ATGGGCAGTCAGGAGCTGGAGGG - Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939590651 2:144059910-144059932 AAGAGGGGTGAGTAGGAGGAAGG - Intronic
939679488 2:145112630-145112652 GAGGGAAGTCAGTAGGAGAAAGG + Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
940667852 2:156630976-156630998 CAGGGCAGTCAGGAGGCAGACGG + Intergenic
941117484 2:161488555-161488577 AAGGGGGGGAAGGAGAAGGAAGG - Intronic
941961483 2:171257852-171257874 AAGGGTAGTTTGGAGGAGTAGGG - Intergenic
942289591 2:174455622-174455644 ATGGGAGGTCAGGGGGAGGAGGG + Intronic
942524806 2:176841798-176841820 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
942709341 2:178815007-178815029 ATGTGGAGACAGGAGGAAGATGG + Intronic
942720603 2:178948472-178948494 AAGTGGAGTCAGGAGAAGAGCGG + Intronic
943433220 2:187830122-187830144 AAGGTGGGTCAGTAGGAGGTGGG + Intergenic
943585498 2:189734607-189734629 AAGGAGGGTCAGGAGGTGGGTGG + Intronic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
944046232 2:195414508-195414530 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
944215238 2:197247989-197248011 AAGGGGAATGATGAGGAGGGAGG - Intronic
944743253 2:202632940-202632962 AGGGGGAGAGAGGAGGAGAAAGG + Intergenic
944770809 2:202912475-202912497 AGGAGGAGGCAGGAGGAAGACGG - Intronic
945027917 2:205637063-205637085 AAGGGGGGTGGGGGGGAGGAGGG - Intergenic
945575712 2:211525867-211525889 AAGGGGAGGGAAGAGTAGGAAGG + Intronic
945927232 2:215818059-215818081 TAGGGGAGTCATGGGGAGAAGGG + Intergenic
946016309 2:216606822-216606844 AAGGGGGGCCAGGAGGGGGCCGG - Intergenic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
946153623 2:217792733-217792755 AAAGGGAGCCAGGGGGAGGTGGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946380684 2:219346693-219346715 AAGGGGTGACTGGAGGAGGAAGG - Intergenic
946412011 2:219520157-219520179 AAGGAGGGTCGGGAGGGGGAGGG - Intronic
946482887 2:220073811-220073833 AAGGGGAGGCAGAAGGAAAATGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947522959 2:230862548-230862570 AAGGGGAGCCAGGAGGCTGCGGG - Intergenic
947817458 2:233047798-233047820 AGGAGGAGGCGGGAGGAGGATGG + Intergenic
948091926 2:235302165-235302187 AAGGGGAGGAGGGAGGAGGAGGG - Intergenic
948091955 2:235302235-235302257 AAGAGGAGGGAGGAGGAAGAGGG - Intergenic
948233221 2:236366801-236366823 AAAGAGAGAGAGGAGGAGGAAGG - Intronic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
948687672 2:239679220-239679242 AATGGGAGTGAGGAGGAGGCCGG - Intergenic
948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG + Intergenic
949082964 2:242120017-242120039 AGGGGGGGTCAGGAAGGGGATGG + Intergenic
1168771122 20:417617-417639 ATGGTGAGTGAGGAGGCGGAGGG + Exonic
1168880202 20:1199967-1199989 ACTGGGATTCAGTAGGAGGAAGG - Intergenic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1168940354 20:1706357-1706379 AAGGGGAGTCAGGCAGAGGGAGG - Intergenic
1169074119 20:2751028-2751050 AAGGGGAAGGAGGAGGAGAAGGG + Intronic
1169210868 20:3765707-3765729 AGGGGGAGGCAGGAGGAGGGAGG - Intronic
1169357764 20:4922360-4922382 AAGCGGAGACAGCAGGATGAAGG + Intronic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169765619 20:9144764-9144786 GAGGGGAATGAGGGGGAGGAGGG + Intronic
1169895007 20:10494710-10494732 AGGGGGAGATAGGAGGAAGAAGG - Intronic
1169953207 20:11071402-11071424 AAGAGGTGTCAGAAGGAGTAAGG - Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171401122 20:24873537-24873559 CAGGGGTGTCAGGAGGAAGTAGG - Intergenic
1171424831 20:25042860-25042882 GAGGGGTGTCTGGAGGATGAGGG - Intronic
1171486393 20:25489463-25489485 CGGGGGAGTAAGGAGAAGGAGGG - Intronic
1172034814 20:32003218-32003240 AATGGGGGTCAGGGGGATGAGGG - Exonic
1172180426 20:33000193-33000215 AAAGAGAGTGACGAGGAGGAGGG - Intronic
1172228772 20:33323158-33323180 AAGAAGGGGCAGGAGGAGGAAGG + Intergenic
1172474693 20:35227432-35227454 AAGGGCTGTCAGGTGGAGGTAGG + Intronic
1172488499 20:35315251-35315273 GAGGAGAGTGAGGGGGAGGAGGG + Intronic
1172617292 20:36297842-36297864 AGGGGGAGGCCGGAAGAGGATGG - Intergenic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1173131946 20:40402194-40402216 ATGGGGAGTCAGAAGAAGTAAGG - Intergenic
1173383874 20:42570738-42570760 AAATAGAGTCAGGAGGAAGAGGG - Intronic
1173571413 20:44079137-44079159 CAGGGGAGTGGGGAGTAGGAGGG + Intergenic
1173733193 20:45342480-45342502 AAGGGGAGGCAGGGAGAGGCTGG - Intronic
1173815593 20:45985736-45985758 AATGGAAGGCAGGAGGAGGCAGG + Intergenic
1173837657 20:46136344-46136366 ATTGGGGGTCAGGAGGAGGAAGG + Intergenic
1173876630 20:46376415-46376437 AGGGAGAGTCAGGAGGGAGAGGG - Intronic
1174078762 20:47956482-47956504 GAGCGGAGTCAGCAGGGGGAGGG + Intergenic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174216620 20:48921238-48921260 AAGGGGCGTCAGGAGGAAGGAGG - Intergenic
1174338613 20:49882413-49882435 AAGGAGAGAAAGGAGGAGCATGG - Intronic
1174501655 20:50989369-50989391 GTAGGGAGTCAGGAGGAGGCAGG + Intergenic
1174641771 20:52050472-52050494 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1174961023 20:55156959-55156981 GAGGAGAGTGAGGAGGAGAAGGG - Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175237592 20:57525245-57525267 AAGGGGAGTAGGGAGGGGGAGGG + Intronic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175531102 20:59674692-59674714 AAGGGGGGACAGGAGAAGGCAGG - Intronic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175879310 20:62247582-62247604 AGGAGGAGGCAGGAGGAGGCAGG + Intronic
1175978585 20:62725836-62725858 AGGGGGAGGGAGGAGGAGGGAGG + Intronic
1176057120 20:63154780-63154802 AAGAGGAGAGGGGAGGAGGAGGG - Intergenic
1176057152 20:63154859-63154881 AGAGGGAGTCGGGAGGAGGGAGG - Intergenic
1176270518 20:64233451-64233473 AAGGGGAGGAAGGTGGGGGAAGG - Intronic
1176282747 20:64323915-64323937 AAGGGTAGTGAGGCAGAGGAGGG + Intergenic
1176389172 21:6154821-6154843 AGGGGGGCTCAGGAGGGGGACGG + Intergenic
1176676114 21:9778960-9778982 AATCTGAGTCAGGATGAGGAAGG + Intergenic
1177156949 21:17510380-17510402 AAAAGGATTTAGGAGGAGGAGGG - Intergenic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177791724 21:25729938-25729960 ATGGGGAATAAGGAGGAGAAGGG - Intronic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178162620 21:29937571-29937593 AAAGGAACTCAGGAGGAGAAGGG - Intronic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178454244 21:32732554-32732576 GAGGGGAGCCTGGAGGAGGCTGG - Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178778583 21:35576615-35576637 AAGGGGAGTGTGAAGGAGCAAGG - Intronic
1178824598 21:36004898-36004920 AGGGGGAGGCAGGGGGAGGCAGG + Intergenic
1178824631 21:36004965-36004987 AGGGGGAGACAGGGGGAGGCAGG + Intergenic
1178980769 21:37262705-37262727 ACAGGGAGTCAGGAAGAGTAAGG + Intronic
1178998662 21:37432204-37432226 AAAGGGAGGGAGGAAGAGGATGG + Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179131187 21:38638803-38638825 AAGGGGATGTGGGAGGAGGAGGG - Intronic
1179157414 21:38862581-38862603 AAGAGGACCCAGGAGGAGGCTGG + Intergenic
1179426630 21:41284575-41284597 AGGGGTAGTCAGGAGGCCGAAGG - Intergenic
1179732019 21:43373357-43373379 AGGGTGAGTGAGGAGGAGGGGGG - Intergenic
1179734300 21:43383427-43383449 AGGGGGGCTCAGGAGGGGGACGG - Intergenic
1180081636 21:45490087-45490109 GGGGGGAGTCAGGGGGAGGGGGG - Intronic
1180728893 22:17966419-17966441 CAGAGGAGTGAGGAGGTGGAGGG - Intronic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181038939 22:20182894-20182916 AAGGGGAGGCAGGGGTGGGAGGG + Intergenic
1181114886 22:20625812-20625834 AGGGGGTATGAGGAGGAGGAGGG - Intergenic
1181317232 22:21978598-21978620 AGGGTGAGTCAGGAGGGGTAAGG + Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181434362 22:22901586-22901608 AAGGGGTGTCTGGGTGAGGAAGG - Intergenic
1181435302 22:22906953-22906975 AAGGGGTGACTGGAAGAGGAAGG - Intergenic
1181534356 22:23534013-23534035 AAGGGAAGGCAGGAGGGAGAGGG + Intergenic
1181627731 22:24133064-24133086 AAGGAGAGACAGGCAGAGGAGGG - Intronic
1181632343 22:24157779-24157801 AAGCGGAGCCAGGAAGGGGATGG - Intronic
1181886083 22:26023504-26023526 AAGAGGAGGAGGGAGGAGGAGGG - Intronic
1181924719 22:26348871-26348893 AAGGGGAGTGAAGGGGAGGGAGG + Intronic
1181948785 22:26539433-26539455 AGGGGGAGTGAAGGGGAGGATGG + Intronic
1181990420 22:26832750-26832772 AAAGGGAGTCGGGGGCAGGATGG - Intergenic
1182006018 22:26960297-26960319 AGGGAGAGAAAGGAGGAGGAAGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182415172 22:30216791-30216813 AAGGGAAGTGTGAAGGAGGAGGG + Intergenic
1182754589 22:32668547-32668569 GAGTGGAGGAAGGAGGAGGAAGG - Intronic
1182931456 22:34178253-34178275 GAGGGGGATAAGGAGGAGGAAGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183218266 22:36495354-36495376 AAGGGCAGTCAGGTAGAAGAGGG - Intronic
1183281737 22:36935985-36936007 ATGGGGTGTCAGGAGGCAGAAGG + Intronic
1183385411 22:37511390-37511412 GAAGGGGGTGAGGAGGAGGAGGG + Intronic
1183442266 22:37830026-37830048 GAGGGGAGGCAGGGGCAGGAGGG - Intergenic
1183471409 22:38008940-38008962 AAGGGGTGTCAGGAGTAGAGGGG + Intronic
1183497264 22:38154017-38154039 AAGGGGAGGGAAGAGCAGGAAGG + Intronic
1183684987 22:39356598-39356620 AGGAGAAGCCAGGAGGAGGAGGG + Intronic
1183836577 22:40459121-40459143 AGTGGGAGTCAGCAGGATGACGG + Intronic
1184291899 22:43501825-43501847 AAGATGAGGGAGGAGGAGGAGGG - Intronic
1184306806 22:43608707-43608729 AAGGTGATTAAGGAGGTGGATGG - Intronic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184600022 22:45537906-45537928 AAGGGGGGTCCGGAGGAGGCTGG + Intronic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184663234 22:45975179-45975201 TAGGGGTGCCAGGAGGGGGAAGG + Intronic
1184889962 22:47373624-47373646 AAGGGAGGCCAGGAGGAGAAGGG + Intergenic
1184889968 22:47373642-47373664 AAGGGAGGCCAGGAGGAGAAGGG + Intergenic
1184950645 22:47840364-47840386 AAAGGAAGTCAGGAGGAGGAAGG - Intergenic
1185047157 22:48534299-48534321 GAGGGGAGTCAGGCAGATGAGGG + Intronic
1185088590 22:48753712-48753734 ACGAGGAGTCAGGAGGTGGAGGG + Intronic
1185249223 22:49791011-49791033 CAGTGCAGTCAGGAGGAGCAGGG - Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
949597725 3:5565507-5565529 AAGAGGAATCAGGGGGAGGGTGG - Intergenic
949990360 3:9573859-9573881 AAGGGGATTGTGGAGGATGAGGG + Intergenic
950235927 3:11320164-11320186 AAGGGGAGGTAGGGGGAGGGAGG - Intronic
950521859 3:13502136-13502158 GGGGGCAGTCAGGAGGAGGGAGG - Intronic
950830941 3:15875601-15875623 AAGAAGAGTTAGGAGAAGGAGGG - Intergenic
951149964 3:19277197-19277219 AAGGGGAGGCAGGGGGATGAAGG + Intronic
951194143 3:19804718-19804740 AGGGGGAGGAGGGAGGAGGAGGG + Intergenic
951719186 3:25679747-25679769 AGGGGGAGAGAGGAGGGGGAAGG + Intergenic
952003338 3:28810859-28810881 ATAGGGAGCCAGGAGGGGGATGG + Intergenic
952014287 3:28938616-28938638 AAGGGGAGTCAGGAGATTGTGGG - Intergenic
952832807 3:37579135-37579157 GAGAGGAGTCAAGAGAAGGAGGG - Intronic
952962491 3:38601394-38601416 AAGGGGAGGGATGAGGATGAGGG - Intronic
953482685 3:43265097-43265119 ATGGGGAATCGGGAGGAGCAAGG - Intergenic
954100630 3:48369892-48369914 AAGGGCAGTCAGGAGGCAGAAGG + Intergenic
954317871 3:49811120-49811142 GAGGGGGGTCAGGAGGTGGCAGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954411579 3:50373518-50373540 AGGGGGAGGGAGGAGGGGGATGG + Intronic
954412975 3:50379202-50379224 GAGGGGAGTGAGGCGGAGGCAGG + Intronic
954432945 3:50480907-50480929 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
954432950 3:50480917-50480939 AGGGGGAGGAAGGGGGAGGAAGG + Intronic
954432956 3:50480927-50480949 AGGGGGAGGAAGGGGGAGGAGGG + Intronic
954535805 3:51358478-51358500 ACAGGGAGAGAGGAGGAGGAGGG - Intronic
954539501 3:51384464-51384486 CCGGGGAGGCAGGAGGAGGCTGG + Intergenic
954852754 3:53617310-53617332 GAGGGGAGGCAGGAGGAGGTAGG + Intronic
954855573 3:53641128-53641150 AAGGGGCATCAGGAGGGGCAGGG + Intronic
954876456 3:53805930-53805952 AAGATGAGGGAGGAGGAGGAGGG - Intronic
955059551 3:55483680-55483702 CAGAGGAGTGAGGTGGAGGAGGG + Intronic
955592353 3:60551495-60551517 GAGGGGAGACGGGAGGGGGAGGG + Intronic
956135930 3:66098977-66098999 AAGGGGAGGGGAGAGGAGGAAGG - Intergenic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956600684 3:71018759-71018781 ACAGGGAGTCAGGAGTAGCAGGG + Intronic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957462819 3:80544225-80544247 AAGGGCAGCCAGGATGATGAAGG - Intergenic
957467073 3:80608069-80608091 AAGGGGAGTGGGAGGGAGGAGGG + Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958028884 3:88083018-88083040 AGGAGGAGTGAGGAGGGGGAGGG - Intronic
958074500 3:88658239-88658261 ATGGGGAGCCAGAAGGCGGATGG + Intergenic
958182991 3:90083923-90083945 AGGGGGATACAAGAGGAGGATGG - Intergenic
958415387 3:93867691-93867713 AAAGTGAGGCAGGAGGAAGAGGG - Intergenic
958541343 3:95478256-95478278 AGGGTCAGTCAGGAGGAAGAAGG - Intergenic
959142932 3:102507541-102507563 GAGGGGAGTTAGGAGAAGGAAGG + Intergenic
959977926 3:112482956-112482978 AAGGGAAGTTAGGAGGCTGAGGG - Intronic
960273447 3:115699541-115699563 AATGGGAGGAAAGAGGAGGAGGG - Intronic
960396290 3:117141755-117141777 AAGGGGAGGGAAGAGGAGGGAGG - Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960945855 3:122966116-122966138 ATGGGAAGTGGGGAGGAGGAGGG - Intronic
960952467 3:123008571-123008593 GAGGAGAGTCAGGAGGAAGCTGG + Intronic
960995057 3:123335247-123335269 CAGGGCAGTCAGGAGGCCGAGGG - Intronic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961122628 3:124385678-124385700 AAGTGGAGAAAGGAGAAGGAAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961254871 3:125540892-125540914 AAGGAGCATGAGGAGGAGGAAGG + Intronic
961445362 3:126978122-126978144 ACGGGAAGTCAGAGGGAGGAGGG + Intergenic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961523786 3:127483824-127483846 AAGAGGAGGGAGGAGGAAGAGGG + Intergenic
961591481 3:127984910-127984932 AAGGGGATTCTGAAGGAGAATGG - Exonic
961611888 3:128146045-128146067 AAGGGGGATCAGGAGTAGGGAGG + Intronic
961813284 3:129533970-129533992 AAGATGAGTTGGGAGGAGGAGGG - Exonic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
961940938 3:130636896-130636918 GAGGGGAGGAAGGGGGAGGAAGG - Intronic
961964369 3:130887552-130887574 AAGGGGAGGGAAGAGCAGGAAGG - Intronic
962072193 3:132044659-132044681 AAGGGGAGGGAGGGGGAGGGAGG + Intronic
962682554 3:137815290-137815312 TAGAGTTGTCAGGAGGAGGAGGG + Intergenic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
962948990 3:140200800-140200822 AAGAGGAGGCAGGTGGGGGAGGG - Intronic
963084006 3:141420084-141420106 GGGAGGAGTCAGGATGAGGAAGG + Intronic
963989026 3:151631824-151631846 AAGGAGAGGCAGGAGGAGCCAGG + Intergenic
963990635 3:151649456-151649478 AAGGGGAGCCAGGAGAGGGTGGG - Intergenic
964119196 3:153164036-153164058 AAGGGGAGTCTGGGGGAGAATGG + Exonic
964306166 3:155342573-155342595 GAGGAGGGTGAGGAGGAGGAGGG + Intergenic
964669466 3:159209345-159209367 AAGGGGAGCCGGAAGGGGGATGG - Intronic
964698787 3:159540109-159540131 AAGGGAAGTGGGGAAGAGGAAGG - Intronic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
965067130 3:163864339-163864361 ATGGGGATCCAGGAGGATGAGGG - Intergenic
965144941 3:164889587-164889609 AAGGGGAGGCAAGAGTGGGAAGG - Intergenic
965328864 3:167344207-167344229 ATAGGGAGATAGGAGGAGGATGG + Intronic
966279996 3:178215012-178215034 AAGAGGAGTGGGGAGGGGGAAGG - Intergenic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966383274 3:179365651-179365673 AAGGGAAGTTAGAAGGAGGTAGG - Intronic
966446988 3:180011760-180011782 AAGGGAAGGGAGCAGGAGGAAGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966559203 3:181300120-181300142 AAGGGGAGGGAGGAGAAGAAGGG + Intergenic
966918153 3:184596105-184596127 AAGGGGAGACTAGAGGGGGAGGG - Intronic
967067265 3:185929904-185929926 AAGGGGAGTCAAAACAAGGAAGG - Intronic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
967847925 3:194058558-194058580 GAGGGGAGTGGGGAGGGGGACGG + Intergenic
967987687 3:195107517-195107539 AGGAGGAGGAAGGAGGAGGAGGG + Intronic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968038265 3:195567067-195567089 AAAGGCAGTGAGGAGGAGGTGGG - Intergenic
968358484 3:198128001-198128023 AAGGAGATTCAGCAGGAAGATGG - Intergenic
968471190 4:783162-783184 AATGGGAGGCTGGGGGAGGATGG + Intergenic
968581376 4:1396941-1396963 CAGGGCAGTCGGGAGGAGGTGGG + Intergenic
968628590 4:1638803-1638825 AAGGACAGGCAGGAGGAGGGGGG - Intronic
968653697 4:1769831-1769853 CAGGGAAGTCAGGTGGAGTAAGG + Intergenic
968744438 4:2352393-2352415 AAGGGGAGATAGGAGGAGGGAGG + Intronic
968827051 4:2906310-2906332 AAGGGGAGACAGGAAGAAGGGGG - Intronic
968889283 4:3359165-3359187 AGGGGGAGGAGGGAGGAGGAGGG - Intronic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969163288 4:5280424-5280446 AGGGAGAGTCAGGAAGATGAGGG - Intronic
969495318 4:7523048-7523070 AAGGGGAGAGAAGGGGAGGAAGG - Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
970234486 4:13944768-13944790 TGGGGGAGTCAGAAGGAAGATGG + Intergenic
970444209 4:16110295-16110317 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
970602412 4:17650750-17650772 AAGTGGTGTGAGGAGCAGGAAGG - Intronic
971393714 4:26209662-26209684 AGGGGGAGACGGAAGGAGGAAGG - Intronic
971574525 4:28256554-28256576 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574530 4:28256567-28256589 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574535 4:28256580-28256602 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574547 4:28256612-28256634 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574552 4:28256625-28256647 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
972078528 4:35118026-35118048 AAAGGGATTTAGGAAGAGGATGG + Intergenic
972082244 4:35167676-35167698 TAGGGGAGTTAGGAGTAGCATGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
972813744 4:42620664-42620686 AAGAGGAGGCAGGAGGGGTACGG - Intronic
973754714 4:54063975-54063997 AAGGGGTGTGTGGAGGAGGAAGG + Intronic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
975431008 4:74290851-74290873 AAGGAGAGTCAGGAGAAGATGGG - Intronic
975460863 4:74651285-74651307 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460870 4:74651298-74651320 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460877 4:74651311-74651333 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
976108118 4:81641225-81641247 ATGGGGATTCTGGAGGTGGATGG - Intronic
976132299 4:81897551-81897573 AAGGGGGGAGAGGAGGAGGAAGG - Intronic
976440847 4:85072522-85072544 AAGGGGAGTCAGGGACGGGAGGG - Intergenic
977210821 4:94215624-94215646 AAGGGGGGTGGGGGGGAGGAGGG + Intronic
977299923 4:95256031-95256053 AAAGCAAGTCAGGAGGAGGAAGG - Intronic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
978112472 4:104978979-104979001 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
978310141 4:107378655-107378677 ATGGGGAGACAGTAGGGGGATGG + Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978795226 4:112702081-112702103 AAATTGAGTTAGGAGGAGGATGG + Intergenic
979395096 4:120178173-120178195 AAGGGGAGGGAAGAGTAGGAAGG + Intergenic
979878408 4:125923396-125923418 ATGAGGGGTCAGGAGGAGAAGGG - Intergenic
980347269 4:131636747-131636769 AAGGGGAGAGAAGAGGAAGAAGG + Intergenic
980532841 4:134076520-134076542 GTGGGGAGTCAGGAAAAGGAAGG + Intergenic
980636993 4:135518950-135518972 AATGGGATTCATGAGGAGAAAGG + Intergenic
980784351 4:137532741-137532763 AGGGGGAGTGGGGAGGAAGAAGG - Intergenic
980992050 4:139746720-139746742 AAAGGGAGAGAGGAGGAGAAGGG - Intronic
981010734 4:139922277-139922299 AAGGTGAGTGAGAAGGTGGAGGG - Intronic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
982244178 4:153333328-153333350 AAGGGGAGTAAGTAGCAAGAGGG + Intronic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
982324802 4:154119394-154119416 AAGGTGAGCTGGGAGGAGGAAGG + Intergenic
982416581 4:155140405-155140427 AAGGAGGATGAGGAGGAGGAGGG - Intergenic
982420040 4:155184005-155184027 AAGCGGAGACAGGAGGAAGAAGG - Intergenic
982521380 4:156420642-156420664 GAGGGGAGTGAGGTGCAGGAGGG + Intergenic
982687814 4:158513038-158513060 AAGGGCAGGTGGGAGGAGGATGG - Intronic
982750012 4:159149595-159149617 AAAGGGAGTGAGGAGGATGAGGG - Intronic
983477927 4:168238480-168238502 AAGGGGAGAAAGGAAGAGGAAGG + Intronic
983919718 4:173333480-173333502 AAGGTGAGGCAGGAGAGGGACGG - Exonic
984573963 4:181425948-181425970 ATGGGGAGCCAGGAAGACGAAGG + Intergenic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
984703172 4:182831886-182831908 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703183 4:182831917-182831939 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703194 4:182831948-182831970 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703225 4:182832043-182832065 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703236 4:182832074-182832096 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703247 4:182832105-182832127 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703258 4:182832136-182832158 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703269 4:182832167-182832189 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703280 4:182832198-182832220 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703296 4:182832245-182832267 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703307 4:182832276-182832298 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984957543 4:185060401-185060423 AAAGGGAGTGGTGAGGAGGAGGG - Intergenic
985011633 4:185588593-185588615 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985117390 4:186605409-186605431 AAGTGGAGTAGGGAGGAGGTTGG + Intronic
985168478 4:187123229-187123251 AAGTAGACTGAGGAGGAGGAAGG - Intergenic
985314674 4:188643940-188643962 GAGGGGAGACAGGAGGAACATGG - Intergenic
985399414 4:189579786-189579808 AATCTGAGTCAGGATGAGGAAGG - Intergenic
985440057 4:189976301-189976323 AAGGAGATTCAGCAGGAAGATGG + Intergenic
985542289 5:492592-492614 GAAGGGAGTCAGTTGGAGGAGGG + Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985898072 5:2762239-2762261 GAGGGGAGGCAGCAGGAGGCTGG + Intergenic
985971022 5:3378548-3378570 AAGGGGAGGAGGGAGGAGAATGG - Intergenic
986011077 5:3715853-3715875 ATGGGGAGGCAGGTGGACGAGGG - Intergenic
986016741 5:3764034-3764056 TAGAGGAGTCAGGAGAAGGCGGG + Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986443073 5:7798195-7798217 GAGGGTAGTGAGGAGCAGGAGGG + Intronic
986790251 5:11152718-11152740 CAGTGGAGTGAGGAGGAGTAAGG - Intronic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987141727 5:14953375-14953397 GAGGGGACTCAGGAGAAAGAGGG + Intergenic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987496521 5:18652536-18652558 AAGGGGAGGGAAGAGTAGGAAGG - Intergenic
987616169 5:20276939-20276961 AAGGGGAGGAAGGAGTAGGAAGG + Intronic
988360387 5:30229870-30229892 AAAGAGAGAGAGGAGGAGGAAGG + Intergenic
988497265 5:31756094-31756116 AAGGTCAGTCATGATGAGGAAGG + Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988922205 5:35953945-35953967 AAAGGGAGAAAGGAGGAGGCAGG + Exonic
989226094 5:39030792-39030814 AACAGTACTCAGGAGGAGGAGGG + Intronic
989693472 5:44171734-44171756 AAGGGCATTCAGGAGCAGGAGGG - Intergenic
990119443 5:52431937-52431959 AAGGGGATCCTGGAGGATGAGGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991198541 5:63962257-63962279 AAGGGAAGTGAGGAGGAAGAGGG - Intronic
991411360 5:66348544-66348566 AAGCAGACTCAGGAGAAGGACGG + Intergenic
992159845 5:73990646-73990668 GAGGGGAGTCAGCAGGGAGAAGG - Intergenic
992168438 5:74077775-74077797 AAGGGAAGTGGGGAGGAGAAGGG - Intergenic
992205629 5:74427823-74427845 AAGGGGAGTAAGGAGTTGGAAGG + Intergenic
992523053 5:77576302-77576324 AAGGGGTGTCAGGTTGAGGGGGG - Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993077647 5:83254381-83254403 AAGGGTAATGAGGAGGAGGGTGG - Intronic
993091379 5:83430675-83430697 TAGGAGTGTCAGGTGGAGGAAGG - Intergenic
994044969 5:95297316-95297338 AAGAGGAGTCTGGACAAGGATGG - Intergenic
994094811 5:95839134-95839156 AGGGGGACCCAGGAGGAGAAGGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
995402343 5:111757281-111757303 AAGAGGAGGGAGGAGGGGGAAGG + Intronic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
995573097 5:113502587-113502609 AAGGGGAGGGAAGAGTAGGAAGG - Intergenic
995926912 5:117385918-117385940 AAAGGGAGTTAGGAGCAGGCAGG + Intergenic
997003100 5:129785163-129785185 AAGGGGAGAGAAGAGTAGGAAGG + Intergenic
997197075 5:131987458-131987480 ATAGGGAGGCAGGAGAAGGAGGG + Intronic
997737648 5:136225910-136225932 AAGGGGAGCCAGGAGCTGGGAGG - Intronic
997756353 5:136403162-136403184 GAGGGGAGGCTGGAGGTGGATGG + Intergenic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
997882921 5:137606301-137606323 CACTGCAGTCAGGAGGAGGATGG + Intergenic
998028014 5:138837501-138837523 GAGGGGAGGGAGGAGGGGGAGGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998215840 5:140238165-140238187 AAAAGGAGGCAGGAGGAGTAGGG + Intronic
998407579 5:141882816-141882838 GAGGGGAGACAGGAGCAGGAAGG + Intergenic
998604040 5:143615506-143615528 AGGGGGAGGGAGGAGGAGGAAGG - Intergenic
998798090 5:145840123-145840145 AAGGGAAGTCAGAAGAAGGTCGG - Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999322496 5:150624298-150624320 AAGGAGAGCCAGGAAGAGGTAGG + Intronic
999442700 5:151614979-151615001 AAGAGGAGTCAAGAGAAGGCAGG - Intergenic
999452243 5:151687009-151687031 AGGAGGAGACAGGAGGAGGAGGG - Exonic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
999926078 5:156379660-156379682 AAGGGGAGAGGGGAGAAGGAAGG + Intronic
999990464 5:157045427-157045449 AAGAGGAGTGGGGAGGAGGGAGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000371660 5:160542360-160542382 AAGGGGATTAAGGAAGAGAAAGG - Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000551837 5:162675796-162675818 AAGGGGAGTCAAGAGCAATAAGG - Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001132891 5:169079491-169079513 GGGGGGAGGGAGGAGGAGGAAGG + Intronic
1001132989 5:169079816-169079838 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
1001845595 5:174918153-174918175 AAGGGGAGGAAGGTGGAGGGAGG - Intergenic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002132862 5:177092100-177092122 ATGGGGAGCCAGGTGGTGGAGGG + Intronic
1002511761 5:179724747-179724769 AAGGGAGATGAGGAGGAGGAAGG + Exonic
1002795669 6:469425-469447 AGGGGGAGAGAGGAGGGGGACGG - Intergenic
1003316937 6:5021534-5021556 AAGGGTAGTGAGAAGGAGGGAGG - Intergenic
1003628426 6:7764855-7764877 TAGGGGAGTGAGGTCGAGGAGGG + Intronic
1003666106 6:8112719-8112741 CAAGGGAGTCAGGAGGAGAGAGG + Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004171369 6:13297830-13297852 AAGGGCAGTCAGAAAGATGATGG + Intronic
1004282486 6:14292899-14292921 TAGGGGAGTCATGAGGATCAAGG - Intergenic
1004287901 6:14339613-14339635 CAGGTGGGTCAGGGGGAGGAGGG - Intergenic
1004377890 6:15106476-15106498 GTAGGGATTCAGGAGGAGGAGGG + Intergenic
1004516376 6:16325584-16325606 CAGGTGGGTCAGGAGGTGGAGGG - Intronic
1004537397 6:16515807-16515829 AAGCGGATGCAGGAGGGGGATGG + Intronic
1004757943 6:18633605-18633627 GAGGGGAGGGAGTAGGAGGAGGG + Intergenic
1004764736 6:18713464-18713486 GAGGGGAGACACGAGGAGAAAGG + Intergenic
1004883409 6:20030646-20030668 AAGAGGAGACAGGAGAAGTAGGG + Intergenic
1004899928 6:20184341-20184363 GAGGGGGGACAGGTGGAGGACGG + Intronic
1005510284 6:26506362-26506384 AATGGGAGCCAAGAGGATGAAGG - Intronic
1005512264 6:26521676-26521698 ACGGGGAGTAAGGATGAGGTGGG - Intergenic
1006021812 6:31121746-31121768 AAGGGCGGTCAGGAGGTAGAGGG - Intronic
1006113349 6:31762060-31762082 AAGGGGAGTGGGGAAGAGAAGGG - Intronic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006188166 6:32192038-32192060 AAGGGGAGTCTGGAGGAGGTGGG + Intronic
1006191375 6:32211643-32211665 AAGGTATGTGAGGAGGAGGAAGG + Intronic
1006299506 6:33186117-33186139 AAGGGGAGGTAGTAGGGGGAAGG - Intronic
1006341776 6:33451382-33451404 AGGGGGTTTCAAGAGGAGGAGGG + Intronic
1006371973 6:33650424-33650446 CGGAGGAGTCAGGAGGAGCAGGG + Intronic
1006384677 6:33723773-33723795 GAGGGGAGCCTGGTGGAGGAGGG + Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1006963786 6:37961275-37961297 AAGGGGAGGGAAGAGTAGGAAGG + Intronic
1007485706 6:42179207-42179229 AAAGGGAATCAGGGGGAGGAGGG - Intronic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007708538 6:43806411-43806433 GAGAGGAGTCAGAGGGAGGAAGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008420322 6:51291701-51291723 ATGTGGAGACAGGAGGGGGATGG + Intergenic
1008863216 6:56176864-56176886 AAGGGGAGGAAAGAGGAGGAAGG + Intronic
1008863233 6:56176903-56176925 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
1009760663 6:68001331-68001353 AGTGGGAGTGAGGAGGAGGTGGG - Intergenic
1009804003 6:68578760-68578782 AAGGGGAGGGAAGGGGAGGAGGG + Intergenic
1009981400 6:70730063-70730085 AAGGAGGGTCAGGGGGAGAAGGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010035862 6:71324857-71324879 GAAGGGAGTCCTGAGGAGGAAGG + Intergenic
1011227723 6:85126519-85126541 AGGGGGAGCCAGCAGGAGCAAGG - Intergenic
1011514345 6:88136038-88136060 AAGGAGAGTAATGAGGATGAGGG - Intergenic
1011741127 6:90361871-90361893 AAGGTGAGCCTGGAGGAGGTGGG - Intergenic
1012638894 6:101583212-101583234 AAGGGGAGTCGGCTGGTGGAGGG + Intronic
1012980998 6:105830870-105830892 AAAGGGAGGCAGCTGGAGGAGGG + Intergenic
1013056587 6:106589180-106589202 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
1013056598 6:106589203-106589225 AGGGGGAGGAGGGAGGAGGAGGG + Intronic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013374054 6:109496999-109497021 AAGGCGAGGCTGGAGGTGGAGGG - Intronic
1013825138 6:114202296-114202318 AAGTGGGGTCAGGAGGACCAAGG - Intronic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1014144612 6:117983191-117983213 AAGGGCAGTCAGCAACAGGATGG + Intronic
1014207569 6:118672789-118672811 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1014287114 6:119512953-119512975 TCAGGGAGTGAGGAGGAGGAGGG - Intergenic
1015051802 6:128850038-128850060 AAGTGGATTCAGTAGCAGGAGGG - Intergenic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1015553005 6:134431619-134431641 ATAGGGAGTAAGAAGGAGGACGG + Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015849004 6:137552410-137552432 AAGGGAAGGAAGGGGGAGGAAGG - Intergenic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1016479526 6:144467226-144467248 ATGAGCAGACAGGAGGAGGAGGG - Intronic
1016486812 6:144549639-144549661 TGGGGGAGCCAGGATGAGGAAGG + Intronic
1016989389 6:149918843-149918865 AAGAGGAGTCAGGAGGGAGAAGG + Intronic
1016993743 6:149946831-149946853 AATAGGAGTCAGGAGGGAGAAGG - Intronic
1016997266 6:149969529-149969551 AAGAGGAGTCAGGGGGAAGAAGG - Intronic
1016998637 6:149979249-149979271 AAGAGGAGTCAGGAGGGAGAAGG - Intergenic
1016999753 6:149988561-149988583 AAGAAGAGTCAGGAGGGAGAAGG + Intergenic
1017004587 6:150020705-150020727 AATAGGAGTCAGGAGGGAGAAGG + Intronic
1017006863 6:150033713-150033735 AAGAAGAGTCAGGAGGGAGAAGG - Intergenic
1017103487 6:150867081-150867103 AAGGGGAGTGGGGAGGAAAATGG - Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017616322 6:156250406-156250428 AAGGGAAGGAAGGAGGAAGAAGG - Intergenic
1017687479 6:156928009-156928031 GAGGACAGTAAGGAGGAGGAAGG + Intronic
1017772341 6:157652910-157652932 AAGGGGAGAGAGGAGGAAGGGGG + Intronic
1017885250 6:158594039-158594061 CAGGGGTGTGAGGAGGAGGGAGG - Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1019230994 6:170562923-170562945 AAAGGGAGTATGAAGGAGGAAGG - Intronic
1019320690 7:414167-414189 AGGGGGAGGAGGGAGGAGGAGGG - Intergenic
1019320778 7:414374-414396 AGGGGGAGGGAAGAGGAGGAGGG - Intergenic
1019346170 7:531764-531786 CAGGGGAGCCACGAGGCGGAGGG + Intergenic
1019419063 7:942323-942345 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419076 7:942378-942400 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419081 7:942396-942418 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419086 7:942414-942436 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419091 7:942432-942454 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419096 7:942450-942472 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419112 7:942509-942531 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419127 7:942575-942597 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419132 7:942593-942615 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419137 7:942611-942633 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419153 7:942670-942692 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419167 7:942720-942742 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419172 7:942738-942760 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419188 7:942797-942819 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419202 7:942847-942869 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419218 7:942906-942928 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419241 7:943006-943028 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419266 7:943097-943119 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419285 7:943181-943203 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419298 7:943233-943255 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419308 7:943267-943289 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419317 7:943303-943325 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419322 7:943321-943343 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419338 7:943380-943402 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419375 7:943523-943545 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419393 7:943588-943610 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419398 7:943606-943628 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419403 7:943624-943646 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419440 7:943767-943789 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419454 7:943817-943839 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019508355 7:1404804-1404826 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508370 7:1404838-1404860 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508385 7:1404872-1404894 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508400 7:1404906-1404928 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019637178 7:2082160-2082182 GAAGGGAGGCAGGAGGGGGAGGG + Intronic
1019776136 7:2913066-2913088 GAGGGAAGTGAGGAGGGGGAGGG + Intronic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019815192 7:3194782-3194804 AAGGTCAGTTAGGAGGTGGAGGG + Intergenic
1019828526 7:3302356-3302378 TGGGGGAGTCAGGAGCAGGCGGG - Intronic
1019880607 7:3857279-3857301 AAGGGGAAGGAGGAGGAGAAAGG + Intronic
1020080033 7:5282226-5282248 AGGGGGAGAAAAGAGGAGGATGG + Intronic
1020125794 7:5531866-5531888 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1020155902 7:5724232-5724254 AAGGGCAGTCAGGCTGATGAAGG + Intronic
1020254165 7:6492773-6492795 TAGAGGAGGAAGGAGGAGGAGGG + Intergenic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020361123 7:7327955-7327977 AAGGGGGCTCGAGAGGAGGAGGG + Intergenic
1020574759 7:9912894-9912916 AAGGGGAGGCAAGAGTGGGAAGG - Intergenic
1020787116 7:12587348-12587370 GTGGGGAGTGAGGATGAGGATGG + Intronic
1020819897 7:12954196-12954218 AATGTGAGTCTGGAGGAGTAAGG + Intergenic
1021469168 7:20981652-20981674 AAGGGGAGGGAGGGGAAGGAGGG - Intergenic
1021623516 7:22570769-22570791 AAGGGGAATTGGGAGAAGGATGG + Intronic
1022026037 7:26448771-26448793 TAGGGGTGTGGGGAGGAGGAAGG + Intergenic
1022820610 7:33956542-33956564 AAGGGGAGACAGGAGAGGCAGGG - Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023053340 7:36272403-36272425 AAGTGAAGTTAGGAGGAGGGAGG - Intronic
1023118633 7:36887023-36887045 AAGGGGAGTCATTAAAAGGAAGG + Intronic
1023372926 7:39530073-39530095 AAGGAGAGTAGTGAGGAGGACGG + Intergenic
1023556585 7:41429874-41429896 AAGAGTAGGCTGGAGGAGGAGGG - Intergenic
1023611089 7:41971854-41971876 AAGAGGATTCAGGAGAGGGACGG - Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023853038 7:44160774-44160796 AAGGGCTGTCCCGAGGAGGATGG + Intronic
1023934908 7:44732798-44732820 AGGAGGAGGCAGGAGGAGGCAGG + Intergenic
1023960077 7:44919064-44919086 AAGGGGTGTCAGTGGGAGGGGGG + Intergenic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1024649077 7:51389470-51389492 ACTGGGAGGCAGGAGGAGGTGGG + Intergenic
1025111452 7:56220129-56220151 AAAGAGAGGAAGGAGGAGGAGGG + Intergenic
1025138036 7:56436903-56436925 AAGGGGAGGGAAGAGTAGGAAGG + Intergenic
1025198743 7:56949553-56949575 AAGGGGAGGGAGGAGGAGGGGGG - Intergenic
1025198883 7:56949990-56950012 AGGGGGAGAAAAGAGGAGGATGG - Intergenic
1025673063 7:63626943-63626965 AGGGGGAGAAAAGAGGAGGATGG + Intergenic
1025757434 7:64357974-64357996 AATTGGAGTCAGGAAGAGAATGG - Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1025888540 7:65622548-65622570 ATGGGGAGTCAGCAGGACAAAGG + Intergenic
1025995428 7:66524553-66524575 AAGGGGGATCAGGAGGGTGAGGG + Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026217653 7:68363989-68364011 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026491439 7:70867419-70867441 AAGGGTAGTCCGGAGGGGAATGG - Intergenic
1026509341 7:71015562-71015584 AAAGGAAGACAGGAGGATGAAGG + Intergenic
1026517818 7:71087876-71087898 AAGGAGTGGCAGGAGGAGGCGGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026806125 7:73430450-73430472 AAGGGGATGGAGGGGGAGGAGGG - Intergenic
1026806137 7:73430474-73430496 AAGGGGAGGGAGGGGGAGGAGGG - Intergenic
1026987078 7:74561419-74561441 AAGGGGGATCAGGAGGGTGAGGG + Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027159772 7:75793791-75793813 AAGGGGAGGAAGGAAGGGGAAGG + Intergenic
1027345801 7:77258234-77258256 AATGGGAGCCAGGGGGTGGAGGG - Intronic
1027448615 7:78303407-78303429 CAGATGATTCAGGAGGAGGAGGG - Intronic
1027878285 7:83799898-83799920 GAGGGGAGGCAGGAGGAATATGG + Intergenic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029306908 7:99626273-99626295 CAGAGGAGTAAGGAGGAGGCAGG + Intronic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029422104 7:100477195-100477217 GAGGGGGGGGAGGAGGAGGAAGG + Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029514672 7:101017826-101017848 AAGGGGTCCCAGGGGGAGGAAGG - Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029619534 7:101681309-101681331 GAGGGAAGCCAGGAGGGGGACGG - Intergenic
1029652962 7:101906327-101906349 GAGGTGAGGCAGGAGGAGCAGGG + Intronic
1029794044 7:102875326-102875348 AAGGGGAGAGAAGAGGTGGAGGG + Intronic
1030099372 7:105931702-105931724 AGGTGGGGTCAGGAGGAGGGTGG - Intronic
1030172388 7:106616473-106616495 AAGGAGAGAGAGGAAGAGGAGGG + Intergenic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030399326 7:109028606-109028628 CATGGCAGTCAGGAGGAGGTAGG - Intergenic
1030583093 7:111384289-111384311 GAGAGGAGAAAGGAGGAGGAGGG + Intronic
1030869084 7:114733522-114733544 ATGGGGAGGGAGGAGGAGAAGGG + Intergenic
1031028293 7:116705986-116706008 AAGAGCAGTCAGCAAGAGGAAGG - Intronic
1031060708 7:117048225-117048247 AAGGGGAGGCAGGAGAGGCAGGG + Intronic
1031083738 7:117282352-117282374 AAGGGGAGGGAGGAGAAAGAAGG + Intronic
1031205731 7:118755169-118755191 AAGGTGAGTCACAAGGAGGCAGG + Intergenic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1031313293 7:120226925-120226947 TAGGGGAGCCTAGAGGAGGAAGG - Intergenic
1031431509 7:121676411-121676433 AAGAGGAATCAGGAGCAGGCAGG + Intergenic
1031442612 7:121812381-121812403 AAGGGGAGGCAAGAGTGGGAAGG + Intergenic
1031819829 7:126486245-126486267 AAGGTGAGGCAGGAGCATGAAGG - Intronic
1031853903 7:126899414-126899436 ATGGGGAGTCAGCAGGACAAAGG - Intronic
1031870086 7:127081619-127081641 AAGGGGAGGGAGGAGGCAGAGGG + Intronic
1031998527 7:128248796-128248818 AAGTGGAATCAGGAGTGGGAAGG - Intronic
1032122816 7:129169163-129169185 ACGGGGAATGAGGAGGAAGAAGG + Intronic
1032248689 7:130234332-130234354 AAGGGGCCCCAGGTGGAGGAGGG + Intergenic
1032375190 7:131407851-131407873 AATAGGAGTTAAGAGGAGGAAGG - Intronic
1032458832 7:132094357-132094379 AAGGGGAGGCTGGAGGCTGAGGG - Intergenic
1032868395 7:135953100-135953122 AAGGGGAGTTTGGAGGAGTTTGG - Intronic
1032934293 7:136711230-136711252 AAGGAGTGGGAGGAGGAGGAGGG + Intergenic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033234423 7:139626830-139626852 AAGGGGAGCCAGGAGAGGGGAGG - Intronic
1033256837 7:139808593-139808615 AAGGGGAGCCAGGAGCACGCTGG - Intronic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1033691387 7:143740699-143740721 AAGGGGAGGCAAGAGTGGGAAGG + Intergenic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034420248 7:150986786-150986808 AGAGGGAGACAGGAGGAGGCAGG + Intergenic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035239565 7:157520926-157520948 AAGGAGACTGGGGAGGAGGAGGG + Intergenic
1035280775 7:157776686-157776708 AGAGGGAGGCAGGAGGAGGGAGG - Intronic
1035722044 8:1799288-1799310 AAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1035899933 8:3448376-3448398 AGGGGGAGGAGGGAGGAGGAAGG + Intronic
1036167779 8:6453138-6453160 TGGGAGAGTCAGGAAGAGGAGGG + Intronic
1036240907 8:7080357-7080379 TACGGGTGTCAGGAGGGGGACGG - Intergenic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1037226783 8:16602235-16602257 ATCGGGAGCCAGGAGGGGGATGG - Intergenic
1037287600 8:17317938-17317960 GTGGGAAGTCAGGAGGAGGTGGG + Intronic
1037399741 8:18483329-18483351 AAAGGTAGTCAGGACAAGGAAGG - Intergenic
1037502202 8:19496977-19496999 GAGGGGAGGCGGGAGGGGGAGGG - Intronic
1037693887 8:21207246-21207268 AAGAGGAGAAAGGAGGAGAATGG - Intergenic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1037859302 8:22393262-22393284 AAGAGGAGGCAGGGGGAGAATGG + Intronic
1037927547 8:22855938-22855960 AGGCTGAGGCAGGAGGAGGATGG + Intronic
1038314039 8:26467526-26467548 AGGGTGGGTCAGGAGGGGGAGGG - Intronic
1038335011 8:26639002-26639024 GAGAGGGGTGAGGAGGAGGACGG - Intronic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1038404051 8:27308888-27308910 AAGGGTAGTTAGAATGAGGAGGG - Intronic
1038417948 8:27411276-27411298 AAGAGGATTCAGGCTGAGGAAGG + Intronic
1038428528 8:27481263-27481285 AGGGAGTGTCAGGAGGTGGAGGG + Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1039002279 8:32995078-32995100 AAGGGGAGGGAAGAGTAGGAAGG - Intergenic
1039048092 8:33468293-33468315 AGGGAGAGGGAGGAGGAGGAGGG - Intronic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1039567784 8:38563854-38563876 AAGGGGAATGGGGAGGAGGAGGG - Intergenic
1039691292 8:39867639-39867661 AAGGAGGGGGAGGAGGAGGAAGG - Intergenic
1039714717 8:40095040-40095062 AAGGGGAGGCACCAGGAGGCAGG - Intergenic
1039918238 8:41875318-41875340 AACTGGAGGCAGGAGGAGGCAGG + Intronic
1039931984 8:42001015-42001037 GAGGGAAGGAAGGAGGAGGAAGG + Intronic
1040071919 8:43195606-43195628 AAGGAGGGTGTGGAGGAGGATGG + Intronic
1040079746 8:43274824-43274846 AATGAGAATGAGGAGGAGGAGGG - Intergenic
1040386706 8:46919105-46919127 AAGAGGAGGCAAGGGGAGGAGGG + Intergenic
1040554473 8:48467001-48467023 AAGGAGAGTGACGAGGAGAAGGG - Intergenic
1040684674 8:49857348-49857370 GAGTGGAGGCAGGAAGAGGAAGG + Intergenic
1040690960 8:49937872-49937894 AAAGGAACTCAGAAGGAGGAGGG - Intronic
1040914977 8:52559473-52559495 AAGGAGAGTGAGGAGGAGAAAGG - Intronic
1040937834 8:52799635-52799657 AAGGTGTGTCAGGTGGAGGGTGG + Intergenic
1041462756 8:58130063-58130085 AATGGGTGTAAGGAGGAGGCAGG - Intronic
1041570112 8:59328378-59328400 AAGGAGGGGAAGGAGGAGGAAGG - Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041727575 8:61032231-61032253 CAGGGGTGACAGGAGCAGGAAGG + Intergenic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042416517 8:68526883-68526905 GACAGGAGTCAGGAGGAGGAGGG + Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1043379027 8:79683334-79683356 AAGGGCAGTTATGAGGGGGATGG - Intergenic
1043859276 8:85297354-85297376 AAAGGGAGTGAGGGAGAGGATGG + Intergenic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1044180705 8:89190798-89190820 AAGAGGAGGGAGGAGGAGAAGGG + Intergenic
1044896353 8:96896462-96896484 AAAGGGGGTCAGTATGAGGAAGG - Intronic
1045130012 8:99140624-99140646 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1045508544 8:102795440-102795462 AAGGGGGGTCAGGTGGAGGGAGG + Intergenic
1045621276 8:103980849-103980871 AAGGGGAGGGAAGAGCAGGAAGG + Intronic
1045700947 8:104865511-104865533 AATGGAAGTCAGGAGAAGGAGGG + Intronic
1046114097 8:109764952-109764974 AAGGGGAGGAAAGAGCAGGAAGG - Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046565001 8:115887581-115887603 AAGTGGAGTCAAGAGAATGAAGG - Intergenic
1046588395 8:116175945-116175967 AAAGGAAGGAAGGAGGAGGAAGG + Intergenic
1047025951 8:120824795-120824817 AAGGAGAGAGAGGAGTAGGAAGG - Intergenic
1047228888 8:122979334-122979356 AAGGGCAGCCAGGAGGAAGTCGG + Intergenic
1047518689 8:125577790-125577812 AAGAAGAGAAAGGAGGAGGAAGG - Intergenic
1047577178 8:126169416-126169438 ATGAGGAGTGAGGAGGAGGAAGG - Intergenic
1047590758 8:126324325-126324347 AAGAGGAGTCAAGAGAAGAAGGG + Intergenic
1047717592 8:127609993-127610015 AAGGGTGGTCAGGAGGGAGAAGG - Intergenic
1047718782 8:127619792-127619814 AAGGGGAGGAAGGAGAGGGAAGG - Intergenic
1048507140 8:135031806-135031828 AAGGGGAGTGGGTGGGAGGAAGG - Intergenic
1048581308 8:135731717-135731739 AAAGGGTGGGAGGAGGAGGAAGG + Intergenic
1048696260 8:137031631-137031653 AAGGGGAGGAAGGGAGAGGAGGG - Intergenic
1048988735 8:139749149-139749171 ACAGGGAGTCAGCAGGAGGGAGG - Intronic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049186152 8:141255019-141255041 AAGGGAAGTAAGGAGGTGAAGGG + Intronic
1049335788 8:142083974-142083996 AAGGGGAGTGGGGAGCAGGGTGG + Intergenic
1049429017 8:142550673-142550695 AAGGGGAGGTGGGGGGAGGAAGG + Intergenic
1049457849 8:142702938-142702960 AGGGGGAGTCGGGAGGACGAGGG - Intronic
1049465214 8:142748171-142748193 AAGAGGAGCCAGGAGCAGGCAGG - Intergenic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1050349958 9:4731850-4731872 AAGTAGACTGAGGAGGAGGAGGG - Intronic
1050386271 9:5094319-5094341 AAGGGGAGTCCAGAAGAGGAGGG - Intronic
1050501959 9:6307918-6307940 AGGGGAAGTCAAGAGGGGGAGGG + Intergenic
1050675798 9:8051845-8051867 AAGGGAAGGAAGGAGAAGGAAGG + Intergenic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051549744 9:18315427-18315449 AGGGGGAGTGAGGAGGGGGGTGG + Intergenic
1051921817 9:22275342-22275364 AAGGGGAGGGAAGAGTAGGAAGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053056207 9:34994389-34994411 AAAGGGAGTTGGGAGGATGAGGG - Intronic
1053134332 9:35640638-35640660 GATGGGAGTCAGCAGCAGGATGG + Intronic
1054157703 9:61652014-61652036 AAAGGGAGTGAGGAGGCGGCTGG - Intergenic
1054175699 9:61874092-61874114 AAAGGGAGTGAGGAGGCGGCTGG + Intergenic
1054477477 9:65583019-65583041 AAAGGGAGTGAGGAGGCGGCTGG - Intergenic
1054661840 9:67706718-67706740 AAAGGGAGTGAGGAGGCGGCTGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055446984 9:76393950-76393972 AAGGGGATGCGGGAGGAGGAAGG + Intronic
1055640714 9:78316760-78316782 AATGGGAGTCAGGACTGGGAGGG + Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055931033 9:81560055-81560077 ACAGGGAGTGAGGAGGGGGAGGG + Intergenic
1055967991 9:81883922-81883944 TAGGGGAGTCAGGAGAGGAAGGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056755155 9:89377013-89377035 AAGAGGAGCCAGGAGGAGGGAGG + Exonic
1056860732 9:90178661-90178683 AAGGGGAGGCAGGATAAGCAGGG + Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057073575 9:92121605-92121627 GAGGGGAGTTGGGATGAGGAAGG - Intergenic
1057081986 9:92180085-92180107 AAGGGAAGGCAGGAGGCAGAAGG + Intergenic
1057231547 9:93324535-93324557 ATGGGGAGGCTGGAGGGGGATGG - Intronic
1057236542 9:93366082-93366104 ATGGGGAGGCTGGAGGGGGATGG + Intergenic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057438679 9:95065485-95065507 AAGGGCAGCCAGCAGGAGAAGGG - Intronic
1057797936 9:98171676-98171698 AAGGGGAGGCATGGGGTGGAAGG + Intronic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058672862 9:107375345-107375367 AAAGGGAGCAAGGAGGAAGAGGG + Intergenic
1058715955 9:107722187-107722209 AAGGGGAGTGAAGAGGAGGGGGG - Intergenic
1058873353 9:109221229-109221251 GAGGGGAGGGAGGGGGAGGAAGG + Intronic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059823218 9:117997225-117997247 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1060234438 9:121852603-121852625 AAGGTGACTGAGGATGAGGAAGG + Intronic
1060636828 9:125205956-125205978 ACGGAGAGTCAGGAGGTGGCTGG + Intronic
1060821790 9:126665522-126665544 AGGGTGAGTCTGGAGGAGGCGGG + Intronic
1060894829 9:127210935-127210957 AGGGGCACTCAGGAAGAGGAGGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061492108 9:130951074-130951096 AGGGGGAGACAGGGAGAGGAAGG - Intergenic
1061890117 9:133614855-133614877 GATGGGGGTGAGGAGGAGGAGGG + Intergenic
1061942561 9:133891432-133891454 AAGGGGAGGGATGAAGAGGAGGG + Intronic
1062003688 9:134229025-134229047 AAGGGGAGAAAGGAGGAAGGGGG - Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062159024 9:135069572-135069594 GAGAGGTGTGAGGAGGAGGACGG + Intergenic
1062194306 9:135264422-135264444 AAGGAGACTCAGGATTAGGAGGG + Intergenic
1062282337 9:135757623-135757645 AATGGCTGGCAGGAGGAGGAGGG + Intronic
1062469617 9:136696842-136696864 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469627 9:136696860-136696882 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469659 9:136696922-136696944 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469682 9:136696967-136696989 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469692 9:136696985-136697007 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062469715 9:136697032-136697054 AGGGGGAGGGGGGAGGAGGAGGG - Intergenic
1062469726 9:136697051-136697073 AGGGGGAGGGGGGAGGAGGAGGG - Intergenic
1062546254 9:137064948-137064970 CAGGGGGGCCCGGAGGAGGACGG + Exonic
1062638360 9:137503426-137503448 AAGGAGAATGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062722286 9:138050734-138050756 AAGAGGGGACAGGAGCAGGAGGG - Intronic
1185459839 X:328886-328908 AGGGGGAGAGAGGAGGGGGAGGG - Intergenic
1185459862 X:328929-328951 AGGGGGAGAGAGGAGGAGGAGGG - Intergenic
1185575564 X:1169279-1169301 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1185586329 X:1244445-1244467 AAGGGAAGGAAGGAGAAGGAAGG + Intergenic
1185603604 X:1354987-1355009 GAGGGGAGAGAGGAGGAGGGAGG + Intronic
1185603633 X:1355080-1355102 AAGGAGGGGCAGGAGGAAGAAGG + Intronic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688287 X:1948332-1948354 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688295 X:1948350-1948372 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688310 X:1948386-1948408 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688588 X:2133908-2133930 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1186239965 X:7555307-7555329 GAAGGGAGGAAGGAGGAGGAAGG + Intergenic
1186446044 X:9629873-9629895 TATGGGAGTGAGGAGCAGGACGG + Intronic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1186849892 X:13569824-13569846 AGGGGGGCTCAGGAGGAGGAAGG + Exonic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187102415 X:16207637-16207659 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187319590 X:18227755-18227777 AAGGGGAGACAGGCTGAGCATGG + Intergenic
1187427120 X:19188039-19188061 AAGGGGCCCCAGGTGGAGGAGGG - Intergenic
1187447683 X:19373174-19373196 AGGAGGGGCCAGGAGGAGGAGGG + Intronic
1187579266 X:20591439-20591461 AAGGGGAGGGAAGAGCAGGAAGG - Intergenic
1187783543 X:22857351-22857373 AAGGGGAGAAAAGAGGGGGAGGG - Intergenic
1187841170 X:23490065-23490087 AAGGGGAGGGGGGAGGGGGAGGG + Intergenic
1189058777 X:37729246-37729268 ATGGGGAGGCAGGAGTAAGATGG - Exonic
1189187335 X:39065563-39065585 AATGGGGCTCAGGAGGTGGAGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189502628 X:41577681-41577703 AAGGGGAGTGAGGGGAAGCAGGG - Intronic
1190122285 X:47672172-47672194 AAGGGGAAGCATGAGTAGGAAGG - Intergenic
1190160919 X:48030782-48030804 AAGGGGAGCCAAAGGGAGGAAGG + Intronic
1190432064 X:50387731-50387753 AAAGAGAGAGAGGAGGAGGATGG - Intronic
1190440140 X:50469078-50469100 AAGGGGAGTAGGGAGGAAAAAGG - Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190762445 X:53447854-53447876 AAGGGAATGCAGGAGGAAGAGGG - Intergenic
1190881344 X:54494969-54494991 AAGGGACGTGGGGAGGAGGAGGG + Intronic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1191669993 X:63740126-63740148 AAGGGGAGGCATCAGGAGCAGGG - Intronic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192073223 X:67962673-67962695 AAGGGGAGAAAAGAGTAGGAAGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192226205 X:69229744-69229766 AAGGGAAGCTAGGAGGAGAAAGG - Intergenic
1192452170 X:71251433-71251455 AAGGAGAGTTAGGAGGAGGGAGG - Intronic
1192594865 X:72395692-72395714 AAAGGCAGTCTGGAGGAGGAAGG + Intronic
1193161834 X:78237581-78237603 AAGGGGAGTGAAGAGTGGGAAGG - Intergenic
1193215652 X:78860898-78860920 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
1193911927 X:87316768-87316790 AAGGGGAGGAAAGAGTAGGAAGG - Intergenic
1194257454 X:91652407-91652429 AAGGGGAGAAAAGAGCAGGAAGG - Intergenic
1194584690 X:95717901-95717923 AAGGGCAGGCAGGAGGGGAAGGG + Intergenic
1194586161 X:95736626-95736648 AAGGGGAGGGAAGAGCAGGAAGG + Intergenic
1194795944 X:98210998-98211020 AAGGGGAGGGAAGAGCAGGAAGG + Intergenic
1195502154 X:105613759-105613781 AAGGGGAGGGAAGAGTAGGAAGG + Intronic
1195923111 X:110002404-110002426 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1195986283 X:110634154-110634176 AAGGGAAATCAGGGGGTGGAGGG + Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196237531 X:113299952-113299974 GAGGGGAGATAGGAGGGGGAGGG - Intergenic
1196281627 X:113829401-113829423 AAGAGGAGTCTGGAGGAAGAAGG - Intergenic
1196485540 X:116203085-116203107 AAGGGGAGAAAAGAGTAGGAAGG - Intergenic
1196660585 X:118264624-118264646 AAGGGGAGGGAAGAGTAGGAAGG + Intergenic
1197096739 X:122604903-122604925 AAGGGGAGGCAAGAGTGGGAAGG + Intergenic
1197487089 X:127066101-127066123 AAGGGTAGTTGGGAGGGGGAAGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198308215 X:135403358-135403380 AAGGGGAGAGAGGAAGAGAAGGG - Intergenic
1199277689 X:145964996-145965018 AAGGGGAGAGAAGAGTAGGAAGG + Intergenic
1199326737 X:146507442-146507464 AAGGGGAGAGGGTAGGAGGATGG + Intergenic
1199600237 X:149537324-149537346 AGGGGAAGGCAGGAGCAGGACGG + Intergenic
1199650347 X:149942616-149942638 AGGGGAAGGCAGGAGCAGGACGG - Intergenic
1199715737 X:150506298-150506320 AAGGGGAGGGTAGAGGAGGAGGG - Intronic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1200019775 X:153192840-153192862 AGAGTGAGTCAGGAGGGGGAAGG - Intergenic
1200253103 X:154564271-154564293 AAGGGGAGGATGGAGGGGGACGG - Intronic
1200264664 X:154640144-154640166 AAGGGGAGGATGGAGGGGGACGG + Intergenic
1200576112 Y:4891353-4891375 AAGGGGAGAAAAGAGCAGGAAGG - Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic