ID: 1092884334

View in Genome Browser
Species Human (GRCh38)
Location 12:12912270-12912292
Sequence TTTCCTCTAAGCGGCCTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092884323_1092884334 25 Left 1092884323 12:12912222-12912244 CCTTTCTCATGGCCCCTAGATGG 0: 1
1: 0
2: 1
3: 8
4: 143
Right 1092884334 12:12912270-12912292 TTTCCTCTAAGCGGCCTCACGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1092884328_1092884334 11 Left 1092884328 12:12912236-12912258 CCTAGATGGCCACTTGAAGGAAT 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1092884334 12:12912270-12912292 TTTCCTCTAAGCGGCCTCACGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1092884326_1092884334 13 Left 1092884326 12:12912234-12912256 CCCCTAGATGGCCACTTGAAGGA 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1092884334 12:12912270-12912292 TTTCCTCTAAGCGGCCTCACGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1092884327_1092884334 12 Left 1092884327 12:12912235-12912257 CCCTAGATGGCCACTTGAAGGAA 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1092884334 12:12912270-12912292 TTTCCTCTAAGCGGCCTCACGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1092884331_1092884334 2 Left 1092884331 12:12912245-12912267 CCACTTGAAGGAATGATGGGTCT 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1092884334 12:12912270-12912292 TTTCCTCTAAGCGGCCTCACGGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092884334 Original CRISPR TTTCCTCTAAGCGGCCTCAC GGG Intronic
902255297 1:15185125-15185147 TTTCCCATAAGCCACCTCACCGG + Intronic
904028060 1:27517337-27517359 TTTTCTCTAAGAAGCCTCTCTGG - Intergenic
913397063 1:118383049-118383071 TTTCCTCAAAGCAGACTGACAGG + Intergenic
914804445 1:150982288-150982310 TTTCCTCTACCAGGCCACACCGG + Exonic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
920325663 1:205161354-205161376 TTTTCTCTAACCGGCCTGAGTGG + Exonic
922930538 1:229385753-229385775 TCTCCTTTAAGGGGGCTCACAGG + Intergenic
1064273098 10:13882522-13882544 ATTCCCCAAAGCAGCCTCACTGG - Intronic
1065690690 10:28330533-28330555 TTTCCTCTAAGAGCACTCTCTGG + Intronic
1068882799 10:62067803-62067825 TTTCCTATAACCTGCCTCACAGG + Intronic
1070414699 10:76178833-76178855 TTTCCTCTGAGAGGTGTCACTGG - Intronic
1071172252 10:82880068-82880090 TTTCCTCTATGCCTCCTAACTGG - Intronic
1072618937 10:97067338-97067360 TTCCCTCTCAGCAGCCTCCCTGG + Intronic
1073607491 10:104911028-104911050 TTTTCTCTAAGTGACCCCACTGG + Intronic
1074308751 10:112302801-112302823 CTTCCTCTAAGGGGCTTCCCTGG - Intronic
1076325386 10:129616587-129616609 TCTCCTCTAAGGGCCCTCACTGG + Intronic
1078055344 11:8004493-8004515 TTTCCTCTTAGCGGCAGCTCAGG + Intergenic
1078840768 11:15074052-15074074 TTTCCTCTGAGGCGCCTCCCTGG + Intronic
1083328420 11:61885493-61885515 TTACCTCTAAGTGGACTCTCAGG - Intronic
1084249527 11:67886244-67886266 TTCCCTCTACCCGGCCTAACTGG - Intergenic
1091365718 11:135018647-135018669 TTTACTCTAACGGGCCACACAGG + Intergenic
1092419811 12:8321643-8321665 TTCCCTCTACCCGGCCTAACTGG - Intergenic
1092884334 12:12912270-12912292 TTTCCTCTAAGCGGCCTCACGGG + Intronic
1100373480 12:93990996-93991018 TTCCCTCTAAACGGCAACACAGG - Intergenic
1100874802 12:98950680-98950702 ATTCCTGCAAGCAGCCTCACTGG + Intronic
1101575154 12:105990478-105990500 TTTCCTCTGAGAGGCCTTCCTGG + Intergenic
1101720183 12:107344200-107344222 TTTCTTTTAAGCAGCGTCACTGG + Intronic
1106440091 13:29758912-29758934 TCACCTCTCAGCGTCCTCACTGG - Intergenic
1107115029 13:36737892-36737914 TGTCCACCAAGTGGCCTCACGGG + Intergenic
1111717568 13:91898512-91898534 TTTATTCTAAGCGGTCTCAAAGG + Intronic
1119766754 14:77195347-77195369 TTTCCTGAAAGCAGCATCACAGG - Intronic
1125673934 15:41492813-41492835 TCTCCTCAAAGCAGCCTCGCCGG + Intergenic
1133502863 16:6381971-6381993 TTTCCTGTAAAGGGCCACACAGG + Intronic
1139942413 16:70614996-70615018 TGTCCCATAACCGGCCTCACCGG + Intronic
1143548424 17:7614288-7614310 TTCACTCTAAGCGGTCTCCCAGG + Intronic
1144411828 17:15009183-15009205 ATTCCTCTAAACACCCTCACAGG + Intergenic
1147887539 17:43694583-43694605 TTCTCACTAAGCGGCCCCACAGG + Intergenic
1148719606 17:49741744-49741766 GTTCCTCCTAGCAGCCTCACAGG + Intronic
1152083888 17:78205599-78205621 ATTCCTCTGAGCGTCCTCCCTGG - Exonic
1152927941 17:83096179-83096201 TTTGCTCTTAGCGGCTGCACGGG - Intergenic
1154196689 18:12272096-12272118 TTTTCTCTCAGCGGCCTCTTGGG - Intronic
1156795147 18:41035619-41035641 TTTTCTCATAGCAGCCTCACTGG - Intergenic
1158485779 18:57864585-57864607 ATTCCTCTAAGAGGCATCAGAGG + Intergenic
1158909058 18:62041036-62041058 TTTCCTTTAATTGGCCTCAAAGG - Intergenic
1161595307 19:5148272-5148294 TTTCCTCCCAGTGGCCTCCCTGG - Intronic
925293732 2:2764602-2764624 TTTCCTCTGCGCGACCTCACTGG - Intergenic
925854947 2:8120284-8120306 TTTCCTCTATGTGCACTCACAGG - Intergenic
928314884 2:30237422-30237444 TATCCTCGAAGCGGCATCATTGG - Intronic
928595290 2:32854331-32854353 CTTCCTCTAAGTGGCCTTTCCGG - Intergenic
935396235 2:102612180-102612202 TTTCCTCTTAGAGGTCTGACAGG + Intergenic
1170745714 20:19097408-19097430 CTTCCTCCAGGCTGCCTCACAGG - Intergenic
1178133792 21:29603286-29603308 TTTCCTCTAAGCTGTCTCGATGG + Intronic
1179910432 21:44444532-44444554 TTCACTCTCAGCCGCCTCACTGG - Intergenic
1181469474 22:23128923-23128945 TTTCCTATCAGTGGCCACACTGG - Intronic
1181864167 22:25842093-25842115 GTACCTCTAAGCAGCCACACAGG + Intronic
1182091285 22:27596650-27596672 TTTCCACGAAGCGGCCTCCCAGG + Intergenic
1183250339 22:36725808-36725830 TTGCCTCTGGGCGGCCCCACGGG + Intergenic
1183968543 22:41458553-41458575 TTTCCTCAAAGATGCCTCTCCGG - Intergenic
950771830 3:15317923-15317945 TTTCATCTAAGCAGCCTCAGTGG + Intronic
952530180 3:34255205-34255227 TTTCCTCTGAGCGGAAGCACAGG - Intergenic
953998293 3:47537009-47537031 TATCCTCTGAGAGGCCGCACTGG - Intergenic
959302905 3:104625062-104625084 TTTCCTCTGGGCGGCTTCTCAGG + Intergenic
959968747 3:112384774-112384796 TTTCCTCTAAGCTGCCATTCAGG + Intergenic
961289600 3:125835169-125835191 TTCCCTCTACCCGGCCTAACTGG + Intergenic
962325336 3:134427698-134427720 TCTCCCCTAAGTGGCCTCAAAGG + Intergenic
963414784 3:144981485-144981507 TTTCCTCTAAGATTCCTCCCAGG - Intergenic
965104244 3:164338575-164338597 TTCCCTCTACCCGGCCTAACTGG - Intergenic
976410077 4:84703332-84703354 TTTTCACTACGCAGCCTCACAGG + Intronic
979107322 4:116705027-116705049 TTTCCTACAAGCGTACTCACTGG - Intergenic
993756673 5:91739646-91739668 TTTCCACTAAGCAGGTTCACAGG + Intergenic
994081297 5:95711194-95711216 TTTCCTCTACCCGGCCTAACTGG - Intergenic
997345597 5:133189731-133189753 TTTCCTTCCAGTGGCCTCACAGG - Intergenic
997380261 5:133430863-133430885 TTTCCTCTAAGCCTCCTCTGCGG - Intronic
1000938208 5:167328590-167328612 GTTAATCTAAGCTGCCTCACTGG + Intronic
1001929304 5:175661359-175661381 TTTCTTCTAAGGGGCCTGCCAGG - Intronic
1003325029 6:5084919-5084941 TCTCCTCTTGGCTGCCTCACGGG - Exonic
1005738848 6:28772871-28772893 TTCCCTCTACCCGGCCTAACTGG - Intergenic
1006750840 6:36375829-36375851 TTTCCTCTAAGCGGGAACCCTGG - Intronic
1007039483 6:38708682-38708704 TTTCCTCTAAGGGGCAGCAGAGG + Intergenic
1015182896 6:130379716-130379738 TTTCCCCTAAGATGTCTCACAGG - Intronic
1021444438 7:20717372-20717394 TGTCTTCTATGCGTCCTCACAGG + Intronic
1023153141 7:37221376-37221398 TTTCTTCTAAACGAACTCACTGG + Intronic
1034845737 7:154442913-154442935 TTTCCTCTAAGCAGCTCCCCTGG + Intronic
1035063021 7:156083154-156083176 TTTACTGTAAGGGACCTCACTGG - Intergenic
1035107231 7:156452071-156452093 TTTCTTCTAAGCTCCCACACAGG + Intergenic
1035655303 8:1300885-1300907 GTTTATCTACGCGGCCTCACTGG - Intergenic
1037283610 8:17271706-17271728 TTGTCTCTCAGCAGCCTCACTGG - Intronic
1049094245 8:140539177-140539199 TGTCCTCTAAGGGGCTTCATGGG - Intronic
1050412595 9:5382357-5382379 TTTCCTCACAGAGGCCTCTCAGG - Intronic
1062064340 9:134518132-134518154 TTTCCACTTAGCGGCCTCCCAGG + Intergenic
1188263361 X:28042156-28042178 GTTCCTCTGAGCGCCCACACTGG + Intergenic
1189586050 X:42463159-42463181 TTTCTTCTAACCAGCCTCAGTGG - Intergenic