ID: 1092885007

View in Genome Browser
Species Human (GRCh38)
Location 12:12917187-12917209
Sequence GGATGTTCCAAGGATGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092885003_1092885007 19 Left 1092885003 12:12917145-12917167 CCTTCTATCGGGGCAGACAGTGC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1092885007 12:12917187-12917209 GGATGTTCCAAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 197
1092885005_1092885007 -8 Left 1092885005 12:12917172-12917194 CCTTTCTTGACTTCAGGATGTTC 0: 1
1: 0
2: 0
3: 17
4: 226
Right 1092885007 12:12917187-12917209 GGATGTTCCAAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092885007 Original CRISPR GGATGTTCCAAGGATGCTGC TGG Exonic
901594918 1:10377353-10377375 GGAAATGCCAAGGATGCTTCTGG + Exonic
901764509 1:11491251-11491273 GGGTTTTCCAAGAATGCTTCTGG + Intronic
903175527 1:21577980-21578002 GAATGTTCCACGGAGGCTTCAGG - Exonic
903503304 1:23814328-23814350 GGATGTTGGCAGGTTGCTGCTGG - Exonic
904485957 1:30824667-30824689 GGATGTTCGGAGGAAGCTCCGGG + Intergenic
904707606 1:32403115-32403137 TGATGTCTCAAGGCTGCTGCTGG + Intergenic
905204336 1:36334465-36334487 GGTTGGTCCAAGGAGGGTGCTGG - Intergenic
905804171 1:40863864-40863886 GGAAGTCCCAAGGATGCCACAGG - Intergenic
906586559 1:46983924-46983946 GGCTGTACCAATGATGCTGAGGG - Intergenic
908404615 1:63802278-63802300 GGATGCTCCGTGGATGCTCCTGG - Intronic
909238483 1:73181553-73181575 GCATGTTCCATGGAGTCTGCAGG - Intergenic
910746911 1:90583940-90583962 GACTGTTCCAAGGCTGATGCAGG - Intergenic
914420294 1:147522642-147522664 GGATGTTTCAGGGAGGCTGAGGG - Intergenic
916933019 1:169599231-169599253 GGAGTTATCAAGGATGCTGCTGG + Intronic
920826112 1:209425575-209425597 GTGTGTTCCCAGGAAGCTGCTGG - Intergenic
923157687 1:231292855-231292877 GGATCTCCCAAGGATACTGAGGG - Intergenic
1067904820 10:50279818-50279840 TGACCTTCCAAGGATGGTGCAGG - Intergenic
1072995205 10:100237440-100237462 GGAAGTTCCAAGGAAGATGTGGG - Intronic
1076076514 10:127537837-127537859 GGACGTGCCCAGGATGCTTCAGG - Intergenic
1076706658 10:132305918-132305940 CGGTGTCCCACGGATGCTGCTGG - Intronic
1076803358 10:132843299-132843321 GGGTGTTCCCAGGGTGCTGTGGG + Intronic
1076803472 10:132843733-132843755 GGGTGTTCCCAGGGTGCTGTGGG + Intronic
1076803482 10:132843770-132843792 GGGTGTTCCCAGGGTGCTGTGGG + Intronic
1076803493 10:132843807-132843829 GGGTGTTCCCAGGGTGCTGTGGG + Intronic
1076803504 10:132843844-132843866 GGGTGTTCCCAGGGTGCTGTGGG + Intronic
1076803531 10:132843953-132843975 GGGTGTTCCCAGGGTGCTGTGGG + Intronic
1076803541 10:132843990-132844012 GGGTGTTCCCAGGGTGCTGTGGG + Intronic
1076803552 10:132844027-132844049 GGGTGTTCCCAGGGTGCTGTGGG + Intronic
1076803563 10:132844064-132844086 GGGTGTTCCCAGGGTGCTGTGGG + Intronic
1076803583 10:132844136-132844158 GGGTGTTCCCAGGGTGCTGTGGG + Intronic
1076803592 10:132844173-132844195 GGGCGTTCCCAGGGTGCTGCGGG + Intronic
1076803603 10:132844208-132844230 GGGTGTTCCCAGGGTGCTGTGGG + Intronic
1078904649 11:15672413-15672435 AGAACTTCCAAGGAGGCTGCAGG - Intergenic
1079339602 11:19601271-19601293 GGATGTTCCAAGTAGGGTGTAGG - Intronic
1079613494 11:22462300-22462322 GGATGTTTCAAGTAGGCTGCTGG - Intergenic
1083706091 11:64517379-64517401 TGATGTTGCAAGGATGTTGCAGG + Intergenic
1090372296 11:126264985-126265007 GGCTATGGCAAGGATGCTGCTGG - Exonic
1091049103 11:132351875-132351897 GGATGTTCCAGGGAGGTAGCTGG - Intergenic
1091389893 12:119684-119706 GGATTGGCCAAGGCTGCTGCTGG - Intronic
1091624771 12:2113501-2113523 GGGTCTTCCAGGGAAGCTGCTGG - Intronic
1092885007 12:12917187-12917209 GGATGTTCCAAGGATGCTGCTGG + Exonic
1093244539 12:16720358-16720380 TGATGTTCCAGGGATACTGCAGG - Intergenic
1094376349 12:29792688-29792710 GCATGTTCTAAGCATGCAGCAGG - Intergenic
1094676288 12:32623441-32623463 TGATGTGCCAGGAATGCTGCTGG - Intronic
1099574407 12:84362162-84362184 GCATGTTCCAAGGAGCCAGCGGG + Intergenic
1100332369 12:93596523-93596545 GAATGTTCAAAGGAAACTGCAGG + Intergenic
1100594954 12:96063625-96063647 GAATGATCCAAGGATGTTGGAGG - Intergenic
1101220679 12:102636110-102636132 AGATGTTGCAGTGATGCTGCTGG + Intergenic
1102282417 12:111628897-111628919 GGCTGAACCAAGGATGCTTCAGG + Intergenic
1107998624 13:45886638-45886660 GGAAGTTCCAGGCATGGTGCTGG + Intergenic
1114888842 14:26890280-26890302 GGATTTTCCAATGTTGCTGGTGG + Intergenic
1115768884 14:36649871-36649893 TGATGTTCCAAGAAAGCTCCAGG + Intergenic
1116215856 14:42016496-42016518 GGATATTCCAAGGACAGTGCAGG + Intergenic
1119588281 14:75859278-75859300 GGAGGTTGCAGGTATGCTGCAGG + Intronic
1119599112 14:75962895-75962917 GAAGGGTCCAAGGATGCTACTGG - Intronic
1119607772 14:76035480-76035502 TGATGTTCCAAGGATACTAAAGG + Intronic
1122273896 14:100581371-100581393 TGAGGCTCTAAGGATGCTGCCGG + Intronic
1124925440 15:34066026-34066048 GGATGTCCCACGGAGGCTTCAGG + Exonic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1129547193 15:76408885-76408907 GGCTGTTTCAAGGATGGTACCGG - Intronic
1129565834 15:76622733-76622755 GTATGTTCCAAGCATTGTGCTGG + Intronic
1131396734 15:92092223-92092245 TGTTTTTCCAAGGATGCTGAAGG + Intronic
1131567208 15:93497120-93497142 GGATGCTCACAGGATGGTGCAGG + Intergenic
1132291201 15:100705064-100705086 GGATGTTTAGAGGATGGTGCAGG + Intergenic
1133984213 16:10655760-10655782 TCATGGTCCAAGGAGGCTGCTGG - Intronic
1134629178 16:15744797-15744819 TGATGGTTCAAGAATGCTGCCGG - Intronic
1135979673 16:27138207-27138229 GGAGGATCCAGGGATGATGCTGG + Intergenic
1141949951 16:87333870-87333892 GGATGTGGTAAGGATGCGGCGGG - Exonic
1143318073 17:6047771-6047793 GGATGTTTTAGGGATGCTGTAGG - Intronic
1143850583 17:9808800-9808822 GCCTGTTCCAAGGATGCTGTTGG + Intronic
1144628461 17:16857559-16857581 GGATGTTCCCAGGAGGTTTCTGG + Intergenic
1144654833 17:17028824-17028846 GGATGTTCCCAGGAGGTTTCTGG - Intergenic
1145160049 17:20568130-20568152 GGATGTTCCCAGGAGGTTTCTGG + Intergenic
1147361452 17:39933384-39933406 ACATGTTCCTGGGATGCTGCTGG + Intergenic
1148917557 17:50995130-50995152 GTATTTTACAAGGATGTTGCTGG - Exonic
1149006264 17:51809558-51809580 GGATGTTGCAGAGAAGCTGCTGG - Intronic
1154417600 18:14190337-14190359 GGATGTTCAAATAATGTTGCAGG + Intergenic
1155505426 18:26528302-26528324 GGATGGTCCCAGGATGGTGGGGG + Intronic
1165882288 19:39052742-39052764 GCCTGGTCCAAGGATGCTCCTGG + Intergenic
1166016030 19:39980077-39980099 GGAGGTTCAGAGGATCCTGCTGG + Exonic
1166159978 19:40945293-40945315 GGCAGTTCCAAGCATGTTGCAGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166646635 19:44537009-44537031 GGATCTTCCAAGTAACCTGCAGG + Intergenic
1167389187 19:49182826-49182848 GCATGTGCTGAGGATGCTGCTGG + Exonic
1202649149 1_KI270706v1_random:165142-165164 GATTGTGGCAAGGATGCTGCTGG + Intergenic
925847407 2:8046184-8046206 GGACATTCCTAAGATGCTGCAGG + Intergenic
928389026 2:30894899-30894921 GAATGTTCCGAGGCTTCTGCTGG + Intergenic
929000852 2:37345284-37345306 GCTTCATCCAAGGATGCTGCTGG + Intronic
929574437 2:43043082-43043104 AGGTGGTCCAAGGATGTTGCAGG - Intergenic
929823387 2:45291154-45291176 GGATGTTCACAGGAGGCTGCTGG - Intergenic
931636328 2:64343832-64343854 GGATGCTCCCAGGAAGTTGCAGG - Intergenic
934499633 2:94846983-94847005 GGATGTTCAAATAATGTTGCAGG - Intergenic
935577665 2:104727681-104727703 GCATGTTATAAGGAAGCTGCAGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
943682970 2:190787050-190787072 TGATTTTCCCAGGATGCTGGGGG + Intergenic
946033845 2:216726067-216726089 GGATGTTCCAGGGGATCTGCTGG + Intergenic
946188542 2:217995273-217995295 TGATGTTCCCAGGATGCTAGAGG + Intronic
948030177 2:234811203-234811225 GGATGTTCCCAGGCTAATGCAGG - Intergenic
1168875670 20:1170686-1170708 GGATCTTGCAAGAATCCTGCAGG - Intronic
1169142903 20:3236143-3236165 GGATGTGCCAAGGAAACTGGCGG - Intronic
1170268566 20:14498560-14498582 AGATGTTCCAAGGATTCTGCTGG + Intronic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1175481242 20:59312753-59312775 GGATGTTCAAGGGATGGTGAGGG + Intronic
1176210024 20:63915080-63915102 GGCTGCTCCATGGATGCTCCTGG + Intronic
1176269649 20:64229305-64229327 GGATTTGGCAAGGATCCTGCTGG + Intronic
1176602669 21:8807400-8807422 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1178904238 21:36623522-36623544 GGATGCTCCAAGGAGGCTTGGGG - Intergenic
1180344954 22:11698957-11698979 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1180352781 22:11817904-11817926 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1181864261 22:25842846-25842868 GCATGTGCCAAGCATGATGCTGG + Intronic
1185155123 22:49188878-49188900 CGAGGTTCTAAGGATGCTGACGG + Intergenic
950769534 3:15300674-15300696 GGATGTTCAAAGGCTGAGGCAGG - Intronic
951664672 3:25109361-25109383 GCTTGTTCCAAAGATGCTGTGGG - Intergenic
953545724 3:43862513-43862535 GGCTCTCCCAAGGATGCAGCAGG + Intergenic
954425071 3:50438865-50438887 GGAAGGGCCAAGGAAGCTGCAGG + Intronic
957991811 3:87635750-87635772 TGATTCTCCAAGGAGGCTGCAGG + Intergenic
962275329 3:134008989-134009011 GGGTGGACCAAGGATGCAGCTGG - Intronic
963519031 3:146342117-146342139 AGATGTTCCTAGAATGATGCAGG + Intergenic
968952622 4:3702679-3702701 GGCTGGACCAAGGATGCTGCCGG - Intergenic
969724389 4:8910727-8910749 GCAAGTTCCAGGGATTCTGCTGG - Intergenic
973375318 4:49282285-49282307 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973376219 4:49288298-49288320 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973377139 4:49294453-49294475 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973378058 4:49300589-49300611 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973379006 4:49306887-49306909 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973380087 4:49314763-49314785 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973381003 4:49320918-49320940 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973382093 4:49327956-49327978 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973385623 4:49512571-49512593 GATTGTGGCAAGGATGCTGCTGG + Intergenic
974170695 4:58263305-58263327 GGGTGTTCTAGGGGTGCTGCAGG + Intergenic
974683916 4:65199498-65199520 GGAGCTTCTAAGGATGATGCAGG + Intergenic
982983202 4:162167887-162167909 GGATGTACCATGAATGCTGAGGG + Intergenic
984386550 4:179067036-179067058 GGATTTTCAAAGCCTGCTGCAGG + Intergenic
990324601 5:54662134-54662156 GGAGGTTCCAGGGATCTTGCTGG - Intergenic
992156922 5:73964452-73964474 TGACTTTCCTAGGATGCTGCTGG + Intergenic
997446540 5:133944343-133944365 GGATGCTGGAAGGATGCTTCTGG - Intergenic
997699345 5:135885518-135885540 GGAAGGACCATGGATGCTGCTGG - Intronic
997725082 5:136113668-136113690 GCATGTTACAGGGATGTTGCAGG + Intergenic
997811541 5:136975108-136975130 GCATGTGCCAGGGGTGCTGCAGG + Intergenic
998346138 5:141465625-141465647 GGATGTTCAAAGCATTTTGCTGG - Intronic
998463604 5:142326102-142326124 GGCTGCGCCGAGGATGCTGCCGG + Intronic
999231623 5:150065342-150065364 GGAGGGTCCAGGGAGGCTGCTGG - Intronic
999973859 5:156891647-156891669 GGAAGTTCCAAAGAGGCTCCCGG - Intergenic
1000487923 5:161871290-161871312 CAAAGTTCCAAGGATGCTGAAGG - Intronic
1000825478 5:166038697-166038719 AGATGGTGCAAGGAAGCTGCAGG + Intergenic
1000977736 5:167783362-167783384 GGATGATCACTGGATGCTGCAGG + Intronic
1010778132 6:79909935-79909957 GAATTTTCCAAGGATGCTGGTGG + Intergenic
1011025307 6:82862296-82862318 GTCTGTTCCAAGGATGTAGCAGG - Intergenic
1012181276 6:96156073-96156095 TGATGTTCAAAGGATGCTTCTGG + Intronic
1015813313 6:137182781-137182803 GGATGCTCCAGGGATGCTAGGGG + Intergenic
1017057836 6:150453871-150453893 GCAAGCTCCAATGATGCTGCTGG + Intergenic
1017991232 6:159491511-159491533 TGATTTTCCAAGGATGCAACTGG - Intergenic
1018028796 6:159826082-159826104 GGGGGTTACGAGGATGCTGCTGG + Intergenic
1018252759 6:161888684-161888706 TGATGATCAAAGGATGCTGGAGG - Intronic
1019446726 7:1075072-1075094 GGCTGCTCCTGGGATGCTGCAGG - Intronic
1022581982 7:31564624-31564646 GGATTTTCCCAGGTTTCTGCAGG - Intronic
1026852656 7:73734924-73734946 GGAAGTTTCTAGGATGCAGCAGG + Intergenic
1029008398 7:97233232-97233254 GAATGTTGCAAGGATGTGGCAGG + Intergenic
1037162338 8:15788729-15788751 GAATGTGCCAAGAATGCTGTAGG + Intergenic
1039954690 8:42197899-42197921 GGATGCTCCAAGGTTGCCTCCGG + Intronic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1044057185 8:87585817-87585839 GGATATTCCAATGAAGCTCCGGG + Intronic
1044307905 8:90658704-90658726 GGCTATTCCAAGGTTCCTGCTGG - Intronic
1044910493 8:97053515-97053537 AGTTGTTCCAAAGGTGCTGCTGG + Intronic
1047341595 8:123985763-123985785 GTATCTTTCTAGGATGCTGCTGG - Intronic
1049031613 8:140042436-140042458 GCATGCTCCAAGGATGGTTCCGG + Intronic
1049118979 8:140717042-140717064 GTAAGGTCTAAGGATGCTGCCGG + Intronic
1049332744 8:142063833-142063855 GGGGGTTCCCAGGCTGCTGCCGG - Intergenic
1049386725 8:142346670-142346692 GTAGGTCACAAGGATGCTGCTGG + Intronic
1049784253 8:144443049-144443071 GGATTGCCCAAGGAGGCTGCGGG + Intronic
1052255887 9:26455954-26455976 GGATGTTTCACAGAGGCTGCAGG + Intergenic
1053093862 9:35307013-35307035 GGTTGTTCCAGAGATGCTGTAGG + Intronic
1053502281 9:38608922-38608944 GGATGTTCAAATAATGTTGCAGG - Intergenic
1053657525 9:40233557-40233579 GGATGTTCAAATAATGTTGCAGG + Intronic
1053907888 9:42862834-42862856 GGATGTTCAAATAATGTTGCAGG + Intergenic
1054357988 9:64082063-64082085 GGATGTTCAAATAATGCTGCAGG + Intergenic
1054369649 9:64379828-64379850 GGATGTTCAAATAATGTTGCAGG + Intronic
1054527071 9:66142671-66142693 GGATGTTCAAATAATGTTGCAGG - Intronic
1054677276 9:67869581-67869603 GGATGTTCAAATAATGTTGCAGG + Intronic
1056462589 9:86822789-86822811 CTATGTTCCAAGAATGCTGTGGG + Intergenic
1057153755 9:92820376-92820398 GGATGTTCAAATAATGTTGCAGG + Intergenic
1057681681 9:97193369-97193391 GGATGTTCAAATAATGTTGCAGG - Intergenic
1059852670 9:118362001-118362023 AGCTGTTCCCAGGATCCTGCAGG - Intergenic
1060893132 9:127201257-127201279 GGATGTTTCAAGACTGCTGGAGG - Intronic
1061049454 9:128185851-128185873 GGATGTTCCCATGATGCTCTGGG - Intronic
1062318211 9:135978399-135978421 GGCTGTCCCAGGGCTGCTGCAGG - Intergenic
1203699032 Un_GL000214v1:120521-120543 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203699990 Un_GL000214v1:126831-126853 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203700895 Un_GL000214v1:132815-132837 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203479730 Un_GL000224v1:1395-1417 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203480698 Un_GL000224v1:7691-7713 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203481659 Un_GL000224v1:14021-14043 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203550191 Un_KI270743v1:160649-160671 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1203560475 Un_KI270744v1:51458-51480 GGATGTTCAAATAATGTTGCAGG - Intergenic
1203567692 Un_KI270744v1:105532-105554 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203568753 Un_KI270744v1:112517-112539 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203569331 Un_KI270744v1:116769-116791 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203570280 Un_KI270744v1:123050-123072 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1189617565 X:42799642-42799664 TGATGATCCAAGAAGGCTGCTGG - Intergenic
1193193644 X:78604014-78604036 AAATGTTCCAAGGATGTTTCTGG + Intergenic
1194207799 X:91032599-91032621 GCAGATTCCTAGGATGCTGCAGG + Intergenic
1202250403 Y:22865220-22865242 GGAAGTTGCTAGGTTGCTGCAGG - Intergenic
1202403392 Y:24498968-24498990 GGAAGTTGCTAGGTTGCTGCAGG - Intergenic
1202467387 Y:25171113-25171135 GGAAGTTGCTAGGTTGCTGCAGG + Intergenic