ID: 1092893762

View in Genome Browser
Species Human (GRCh38)
Location 12:12993781-12993803
Sequence ACATTGTTACAGGTGCTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092893759_1092893762 9 Left 1092893759 12:12993749-12993771 CCAACAACTACTGAGTATCTACC 0: 1
1: 0
2: 1
3: 22
4: 143
Right 1092893762 12:12993781-12993803 ACATTGTTACAGGTGCTATAAGG 0: 1
1: 0
2: 0
3: 5
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092893762 Original CRISPR ACATTGTTACAGGTGCTATA AGG Intronic
900500285 1:3001188-3001210 AGATTGTCACAGGTGCCATTGGG - Intergenic
906898772 1:49809616-49809638 ACATTTTTAAATGTGCAATACGG - Intronic
907148788 1:52262513-52262535 ACATTCTTAAATGTGATATAGGG - Intronic
909315611 1:74214166-74214188 ATATTGTTCCAGATGCTACAAGG + Intronic
912582296 1:110731408-110731430 ACTTTGTTACAGCAGCTTTAGGG + Intergenic
918130784 1:181627222-181627244 ACAATGTTACAGGTACTGCAGGG + Intronic
921811653 1:219521474-219521496 ATTTTGGTACAGATGCTATAAGG - Intergenic
921829614 1:219712083-219712105 CCACTGTTACAGGGGCTCTAGGG - Intronic
1062951873 10:1509765-1509787 ACATTGTAACAGCTGCGAAATGG + Intronic
1068326189 10:55491037-55491059 ACATTTTTCCATATGCTATATGG - Intronic
1068431816 10:56942777-56942799 AGATTGTTACAAATGCTGTATGG + Intergenic
1070784004 10:79152785-79152807 ACACTGGTACAGATTCTATAAGG - Intronic
1073696476 10:105875154-105875176 ACAGTGTGACTGCTGCTATAGGG + Intergenic
1075222299 10:120595683-120595705 CCATTGTAAAAGGTCCTATAAGG - Intergenic
1078918634 11:15805652-15805674 TCATTGTGACAGTTGCTACAAGG - Intergenic
1086289078 11:85284916-85284938 ACATGGTTACCTGTGCTGTAGGG - Intronic
1086372376 11:86168067-86168089 AGAATGTTACATGTGCTGTACGG - Intergenic
1089553871 11:119303895-119303917 ACATGGTGACAGGTCCCATAAGG - Exonic
1091335189 11:134761251-134761273 TCTTTGTTACAGGAGCAATATGG + Intergenic
1092129330 12:6097811-6097833 ACATTGTGACAGGTACTCTCTGG + Intronic
1092893762 12:12993781-12993803 ACATTGTTACAGGTGCTATAAGG + Intronic
1093769477 12:23002469-23002491 CCATTGTTAGAGGAGCTCTAAGG + Intergenic
1094254805 12:28411204-28411226 ACATTGTTACAGATTTTTTAAGG + Intronic
1100904723 12:99284749-99284771 ACGTTGTTCCAAGTACTATAGGG - Intronic
1107293290 13:38881708-38881730 ACATTGTTACAGATGGTGAAGGG + Exonic
1109382225 13:61577982-61578004 CCATTGTGACAGGTGAGATATGG - Intergenic
1109584230 13:64376728-64376750 ATATTCTTCCAAGTGCTATATGG - Intergenic
1109723129 13:66302308-66302330 ACATTGATGCAGTTGCTCTAGGG + Intergenic
1121162282 14:91754905-91754927 ACATTGTCACATGTTCCATAGGG - Intronic
1122109387 14:99485938-99485960 ACATTTTTAGAAGTGCAATAGGG - Intronic
1125459152 15:39892092-39892114 GCACTGTGCCAGGTGCTATAGGG + Intronic
1128855764 15:71013135-71013157 GTAATGTTTCAGGTGCTATAAGG + Intronic
1130832586 15:87616632-87616654 ACCTTGTTACAGGTACTTGATGG - Intergenic
1133455919 16:5942483-5942505 ATGTTGTTACAGGTGCAATTGGG + Intergenic
1135241934 16:20814999-20815021 ACACTTTTACAGGTTCTATTTGG + Exonic
1138238291 16:55404415-55404437 ACTTTGTTAGAGATGCTACAGGG + Intronic
1139787354 16:69404607-69404629 ACAGTGTTACAGCTGCCTTAGGG + Intronic
1141009310 16:80382459-80382481 ACATGGGTACAGGTGCTCTGGGG + Intergenic
1149198497 17:54153274-54153296 ACAATGTGACAGGCTCTATAGGG + Intergenic
1153329061 18:3854116-3854138 ACTTTGTTACAGGTGTTATTAGG - Intronic
1156405246 18:36776911-36776933 AGATTGTTACATGAGCTGTAAGG + Intronic
1156839320 18:41592598-41592620 GCTTTGTTGCAGATGCTATAGGG - Intergenic
1166129179 19:40735744-40735766 ACACTGTGCCAGGTGCTATGTGG - Intronic
926762479 2:16291189-16291211 ACAGTTTTACATGTACTATAGGG - Intergenic
926879491 2:17527616-17527638 ACTTTGTTACAGCTGCTTTGAGG + Intergenic
926942729 2:18155174-18155196 ACTTTGTTACAGCAGCTGTAGGG + Intronic
928697993 2:33870161-33870183 ACATTGTTACATGTGCTCTGAGG - Intergenic
930884767 2:56313356-56313378 ACAATGTGCCAGGTACTATAAGG - Intronic
930996031 2:57719561-57719583 ACATTCTGACACATGCTATAAGG + Intergenic
935629548 2:105201739-105201761 ACATTGTTGCAGTTGTTATTGGG + Intergenic
936962059 2:118086619-118086641 ACCTTGGAACTGGTGCTATATGG + Intergenic
939804196 2:146752337-146752359 ACTTTGTTACAGCAGCTCTATGG + Intergenic
940689725 2:156900586-156900608 ACTTTGTTACAGCAGCAATAGGG + Intergenic
941218157 2:162739547-162739569 ACATTGCTCCAGGTCCTACATGG + Intronic
941922008 2:170860433-170860455 TCATTGTTACAGGTGTACTATGG + Exonic
942133048 2:172899541-172899563 ACCTAGTTACAGAAGCTATAAGG + Intronic
943898140 2:193394416-193394438 ACATTATTGGTGGTGCTATAAGG - Intergenic
943938565 2:193959592-193959614 ACATTGTTACCTGTATTATAGGG - Intergenic
944116195 2:196189298-196189320 TCATTGTTATAGTTGCTATTTGG + Intergenic
949030547 2:241795037-241795059 ACATTGTTACACATTCTTTAAGG - Intronic
1170576434 20:17665291-17665313 ACATTGTTCTGGGTGCTATTTGG + Intronic
1173240291 20:41289659-41289681 ACATTGTTAAAGCTGCTGAAAGG - Intronic
1174614367 20:51824700-51824722 AAATTGTTACAGGAGTTGTAAGG + Intergenic
1176987353 21:15453299-15453321 ACATTTTTACTGGTGCCACATGG - Intergenic
1180613899 22:17115079-17115101 ACTTTGTGACAGGTGCAGTAGGG - Exonic
1183033473 22:35122981-35123003 ACAGTGTTTCAGGTGCAGTAGGG - Intergenic
949598655 3:5575046-5575068 ACATGGTTACAGATGCTTAAGGG - Intergenic
951296227 3:20938711-20938733 ACACTGCTACTGGTGGTATATGG + Intergenic
951428227 3:22574805-22574827 TCATTCTTACAGTTGCTATTTGG - Intergenic
952329966 3:32355783-32355805 ACATTCTTACAGGTTCTAGAAGG + Intronic
955488611 3:59460284-59460306 GCATTGGTAGAAGTGCTATAGGG - Intergenic
957023292 3:75149190-75149212 TCCTTGGTTCAGGTGCTATACGG - Intergenic
961058491 3:123808977-123808999 ACATTGTTAGAGATGCCACACGG + Intronic
962329864 3:134468198-134468220 AAATTGTTAAAGGTGTTAGAAGG - Intergenic
962694937 3:137938765-137938787 ACATTGTATTAGGTACTATAAGG + Intergenic
963413490 3:144962669-144962691 ACAATATGCCAGGTGCTATATGG - Intergenic
966276822 3:178182750-178182772 ATATTTTTACAGATGCTACAGGG - Intergenic
970337960 4:15072035-15072057 ACATTGTTAAGTGTGCTATTTGG - Intergenic
970483358 4:16500132-16500154 ATATTGATACAGGTGCCAAAAGG + Intergenic
975882675 4:78929163-78929185 ACCATGTAACAGGTGCTCTAAGG - Intronic
976681345 4:87759515-87759537 AAATTTCTACAGGTGCTATGGGG - Intergenic
980654422 4:135764120-135764142 ACTTTGTTTCAGGGGCTACATGG + Intergenic
980728521 4:136797353-136797375 ACATTGTTCCAGATACTAAAGGG + Intergenic
984070950 4:175111280-175111302 ACATTGTTTCATGGCCTATAAGG - Intergenic
984922364 4:184777114-184777136 ACTCTGTGCCAGGTGCTATAAGG + Intronic
986265217 5:6184784-6184806 GCATTGGTTCAGGTGCTATCTGG - Intergenic
989299945 5:39878893-39878915 TAAGTGTTACAGGTGCTATTCGG - Intergenic
989375867 5:40759373-40759395 ACATTGTAACAGATGATAAATGG + Intronic
989644332 5:43613361-43613383 TCATTTTTACATTTGCTATATGG + Intronic
990624570 5:57597149-57597171 ACTTTGTTATAGCAGCTATAGGG - Intergenic
994725382 5:103429130-103429152 ACATTGTTTTGGGTGCAATAAGG + Intergenic
998608594 5:143663278-143663300 ACATTTTTAAAGGTTCAATATGG + Intergenic
1000433895 5:161184643-161184665 ACATTGTGACAGAGGCTCTATGG + Intergenic
1001136913 5:169110326-169110348 ACTTTGTTACAGCAGCTTTAGGG - Intronic
1001137049 5:169111269-169111291 ACTTTGTTACAGCAGCTTTAGGG + Intronic
1003644485 6:7903468-7903490 ACATTGTTACAGGACTTACATGG - Intronic
1004048066 6:12045450-12045472 ACATTTTTAAAGGTGCTGTTAGG + Intronic
1008753161 6:54761435-54761457 ACACTGTTACAAGAGATATAAGG - Intergenic
1011686661 6:89829320-89829342 CCATTCCTACAGGTTCTATAAGG + Intergenic
1013537117 6:111073213-111073235 ATATTGTTACAAGTGACATAAGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1016316244 6:142791164-142791186 ACACTGTCCCAGGTTCTATAAGG + Intronic
1018711388 6:166500280-166500302 ATTTTGTTGCAGATGCTATAGGG + Intronic
1021298539 7:18940713-18940735 ACAGTGTCACAGTTGCTTTAAGG + Intronic
1022762357 7:33368807-33368829 ACATTGTTACAGTTTCTAAATGG - Intronic
1030842609 7:114374746-114374768 ACATTGCCTCAGGTGCTAGAGGG - Intronic
1031515976 7:122699371-122699393 ACATTCTTACATGTGCTTTCAGG - Intronic
1032562474 7:132906848-132906870 AAAGTGTTACAGGAGCTATTTGG - Intronic
1036123064 8:6038678-6038700 AAATTCTTACAGGAGCAATAAGG - Intergenic
1037627393 8:20620041-20620063 ACATTGTTACAGCAGCCTTAGGG + Intergenic
1038551331 8:28471963-28471985 ACATTGTTACAGTTCTTGTATGG + Intronic
1044791062 8:95847438-95847460 ACATTGGAACAGTTGCTATGGGG + Intergenic
1044854595 8:96462109-96462131 ACTTTATTACAGATGCTAAATGG - Intergenic
1047534566 8:125707818-125707840 TCAAAGTTACAGGTGCTGTATGG - Intergenic
1050135120 9:2454768-2454790 AGATTGTTACACATGCTATGAGG + Intergenic
1053406779 9:37883855-37883877 ACATTGTCAGAGCTGCTGTATGG + Intronic
1059849885 9:118326152-118326174 ACATTGTACCAGCTGCCATATGG + Intergenic
1060788706 9:126470695-126470717 ACATTCTTAGAGGTTCTATTTGG - Intronic
1186304443 X:8240515-8240537 ACATTGAAACAAGTGCTTTAAGG + Intergenic
1189403944 X:40700612-40700634 AGTTTGTTAGAGTTGCTATAAGG + Intronic
1190514715 X:51211625-51211647 ACATTTTTACAAGTGCTCAATGG + Intergenic
1195933452 X:110102940-110102962 ACATTGTTGCAGGTATTGTAGGG - Intronic
1196645476 X:118113096-118113118 ACATTGTGACTTGTGCTACAAGG - Intronic
1198376120 X:136041724-136041746 ACTTTGTTACAGCTGCTCTAGGG - Intronic
1198788990 X:140322051-140322073 AGATTGTTATAGCTGTTATATGG - Intergenic
1199549603 X:149044289-149044311 ACACTATAACAGGTGCTCTAGGG + Intergenic