ID: 1092899369

View in Genome Browser
Species Human (GRCh38)
Location 12:13044371-13044393
Sequence GCGGGCGCGCGCACGCGCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 247}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092899360_1092899369 17 Left 1092899360 12:13044331-13044353 CCCACGCACCGCCGCTCGGAACT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG 0: 1
1: 0
2: 2
3: 30
4: 247
1092899363_1092899369 6 Left 1092899363 12:13044342-13044364 CCGCTCGGAACTACACTTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG 0: 1
1: 0
2: 2
3: 30
4: 247
1092899355_1092899369 28 Left 1092899355 12:13044320-13044342 CCGGTCCCAGCCCCACGCACCGC 0: 1
1: 0
2: 6
3: 49
4: 501
Right 1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG 0: 1
1: 0
2: 2
3: 30
4: 247
1092899354_1092899369 29 Left 1092899354 12:13044319-13044341 CCCGGTCCCAGCCCCACGCACCG 0: 1
1: 0
2: 1
3: 39
4: 387
Right 1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG 0: 1
1: 0
2: 2
3: 30
4: 247
1092899359_1092899369 18 Left 1092899359 12:13044330-13044352 CCCCACGCACCGCCGCTCGGAAC 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG 0: 1
1: 0
2: 2
3: 30
4: 247
1092899361_1092899369 16 Left 1092899361 12:13044332-13044354 CCACGCACCGCCGCTCGGAACTA 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG 0: 1
1: 0
2: 2
3: 30
4: 247
1092899362_1092899369 9 Left 1092899362 12:13044339-13044361 CCGCCGCTCGGAACTACACTTCC 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG 0: 1
1: 0
2: 2
3: 30
4: 247
1092899357_1092899369 22 Left 1092899357 12:13044326-13044348 CCAGCCCCACGCACCGCCGCTCG 0: 1
1: 1
2: 0
3: 26
4: 231
Right 1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG 0: 1
1: 0
2: 2
3: 30
4: 247
1092899356_1092899369 23 Left 1092899356 12:13044325-13044347 CCCAGCCCCACGCACCGCCGCTC 0: 1
1: 0
2: 0
3: 22
4: 251
Right 1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG 0: 1
1: 0
2: 2
3: 30
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092899369 Original CRISPR GCGGGCGCGCGCACGCGCAC CGG Exonic