ID: 1092899819

View in Genome Browser
Species Human (GRCh38)
Location 12:13047818-13047840
Sequence GAGTAGGACTTAAGGCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092899812_1092899819 19 Left 1092899812 12:13047776-13047798 CCTAAGCTTGGAAGCTGGATTTG 0: 1
1: 0
2: 3
3: 16
4: 190
Right 1092899819 12:13047818-13047840 GAGTAGGACTTAAGGCAAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 102
1092899814_1092899819 -7 Left 1092899814 12:13047802-13047824 CCTGGCTCCTCAGCCTGAGTAGG 0: 1
1: 1
2: 0
3: 39
4: 356
Right 1092899819 12:13047818-13047840 GAGTAGGACTTAAGGCAAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 102
1092899811_1092899819 20 Left 1092899811 12:13047775-13047797 CCCTAAGCTTGGAAGCTGGATTT 0: 1
1: 0
2: 1
3: 7
4: 152
Right 1092899819 12:13047818-13047840 GAGTAGGACTTAAGGCAAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092899819 Original CRISPR GAGTAGGACTTAAGGCAAGT TGG Intronic
902901130 1:19516885-19516907 CTGTAGGACTTAAGGCATGGAGG + Intergenic
903257916 1:22114909-22114931 GAGGCGGTCTTAAGGCATGTGGG - Intergenic
905977483 1:42187444-42187466 AAGGAGGACTTAAAGCAAGTTGG + Intronic
906300538 1:44678290-44678312 GGGTAGGAATGAGGGCAAGTGGG + Intronic
908365861 1:63422992-63423014 GAGAAGAACTAAAGACAAGTAGG + Intronic
909086787 1:71177870-71177892 GAGTATAACTTAAGGAATGTAGG + Intergenic
909549777 1:76884862-76884884 GACTAGGACTTATGACAACTAGG + Intronic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
912866684 1:113263946-113263968 GAGGAGGAATTAAGACAATTGGG + Intergenic
915930659 1:160058876-160058898 GAGTAGAAATTAAGCAAAGTGGG - Intronic
1067814230 10:49459930-49459952 CAGTAGCACTCAAGGCAAGCAGG + Intronic
1067963764 10:50886529-50886551 TACTAGAACTAAAGGCAAGTAGG - Intergenic
1068812909 10:61276757-61276779 GACTAGGACATAATGAAAGTAGG + Intergenic
1077804516 11:5576841-5576863 GAGGAGAACTGAAGTCAAGTTGG + Intronic
1080156995 11:29122953-29122975 TAGTAGGAATTTAGGGAAGTGGG - Intergenic
1084344615 11:68537917-68537939 GAGTGGGACTAAAGTGAAGTGGG + Intronic
1089443344 11:118533349-118533371 GAGTAGTACCTATGGCATGTTGG + Intronic
1089810117 11:121124870-121124892 GAGGAGGACTAAAGGCAGGAAGG + Intronic
1091784597 12:3235531-3235553 GACAAGGACTCAAGGGAAGTGGG - Intronic
1092061831 12:5557460-5557482 GAGTTGGAATCAAGGCAAGGTGG + Intronic
1092899819 12:13047818-13047840 GAGTAGGACTTAAGGCAAGTTGG + Intronic
1098841939 12:75487707-75487729 GAGTAGGAAGTGAGGCAAGAGGG - Intronic
1100204521 12:92333726-92333748 GACTAGGAGTTAAGGGAAATAGG - Intergenic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1105790088 13:23790115-23790137 GACTGGGTCTGAAGGCAAGTAGG + Intronic
1111108211 13:83673602-83673624 CAGTAGGACTTATGGCAATAGGG - Intergenic
1111870817 13:93830075-93830097 CAGTTGTACTTAAGGTAAGTGGG + Intronic
1115435092 14:33363018-33363040 GAGCAGGGCACAAGGCAAGTAGG + Intronic
1115736188 14:36332687-36332709 TAGTACGACTTGTGGCAAGTGGG - Intergenic
1118153473 14:63214709-63214731 GAGTCAGACTAGAGGCAAGTGGG + Intronic
1124784039 15:32662635-32662657 GAGGAAGACTTGAGGCAAGTTGG + Intronic
1125094323 15:35833369-35833391 CAGTAAGACTTAGGGCATGTAGG + Intergenic
1125253055 15:37728520-37728542 CAGTGGGAATTAAGCCAAGTGGG - Intergenic
1126931169 15:53653058-53653080 GATTTGGACTTAAAGCAATTGGG + Intronic
1128005129 15:64231523-64231545 GAATAGTACTTAACCCAAGTGGG + Intronic
1128261760 15:66237552-66237574 GATTATGACTTTGGGCAAGTGGG + Intronic
1130111837 15:80971791-80971813 AAGTAGGACCTGAGACAAGTAGG + Intronic
1133923106 16:10172312-10172334 GAGAAGGCCTTAAGGCCAGTGGG + Intronic
1134401598 16:13914931-13914953 GAATATGACTTAAGACAATTGGG + Intergenic
1135911847 16:26568480-26568502 GACTAGGACTGAAGCCAAATAGG + Intergenic
1136567763 16:31080309-31080331 GAGTAGGTCTTGGGGCAGGTGGG - Exonic
1136619716 16:31420268-31420290 GTGTAGGGCTGAAGGCAAGAGGG + Intronic
1137401243 16:48155964-48155986 GAGGAGGACTTCAGGCGGGTGGG - Intronic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1141936478 16:87242358-87242380 GATTTGGTCTTAAGGCAAGTTGG - Intronic
1143540207 17:7563879-7563901 GAGCTGGGCTTAAGGAAAGTAGG + Intronic
1143642552 17:8207462-8207484 GAGTAGGGATGAAGACAAGTGGG - Intronic
1148599473 17:48883274-48883296 GAGCAGGACATAAGGGAAGCGGG - Intergenic
1156450953 18:37266308-37266330 GGGCAGAACTTCAGGCAAGTGGG - Intronic
1158473891 18:57762567-57762589 GAGTAAGACTTAATGCAAGAGGG - Intronic
1160277670 18:77452577-77452599 GAATAGAACTTAAGGAAAATAGG + Intergenic
1161446149 19:4320391-4320413 GAGGAGGACTTGAGGCCTGTGGG + Intronic
1166276248 19:41756323-41756345 GAGCAGGACCTGAGGCCAGTGGG + Intronic
1167785080 19:51629720-51629742 GTGTAGGACTTGGGGCAGGTCGG - Intronic
1167787181 19:51646144-51646166 GTGTAGGACTTGGGGCAGGTCGG - Intronic
926639124 2:15216530-15216552 AAGCAGAACTTAAGGCAACTTGG - Intronic
929728321 2:44457355-44457377 AAATATGACTTAAGGTAAGTTGG - Intronic
932895167 2:75632281-75632303 GAGTAGCACTTATGCCAAATGGG + Intergenic
935385473 2:102494975-102494997 GAATAGGAATTAGGGCAAGGTGG - Intronic
938762159 2:134435812-134435834 GATAAGGAGATAAGGCAAGTTGG + Intronic
939729192 2:145760756-145760778 AAGTAAGATTTAAGGCAAGAAGG + Intergenic
940014270 2:149086918-149086940 GAGTAGGCTTTAATGCAAGATGG - Intronic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
946717819 2:222571798-222571820 GAGGAGGACTTAAGGACACTAGG + Exonic
946721018 2:222607621-222607643 GAGTAGGACTAAGGAGAAGTTGG + Intronic
947524744 2:230871285-230871307 GAGCAGGTCTTAAGGAAAGGTGG - Intronic
1174846970 20:53951725-53951747 GAGAAGGACTTCACCCAAGTGGG - Intronic
1177902444 21:26933567-26933589 AATTAGGAATTAAGCCAAGTTGG - Intronic
1181558837 22:23687994-23688016 GAGTAGGACTTATGGAAAGGAGG + Intergenic
949876126 3:8627267-8627289 GAGGAGGAGTCAAGGAAAGTTGG - Intronic
951732008 3:25820369-25820391 GAGGAGGAGTTAAAGCAATTTGG + Intergenic
952901736 3:38115645-38115667 GAGCAGGACTGAAGGCAGGAGGG + Intronic
955744615 3:62127645-62127667 GTGTCGGATTCAAGGCAAGTAGG + Intronic
962996821 3:140636980-140637002 GAGTATGACTAAAAGGAAGTAGG - Intergenic
964512473 3:157467793-157467815 GAAAAGGACTGAAGGCTAGTAGG - Intronic
964538044 3:157747239-157747261 AACCAGGACTTAAGGCAAGAAGG - Intergenic
970363001 4:15328905-15328927 GAGTAGGACTGAAAGCAAAGGGG - Intergenic
979987221 4:127330158-127330180 GAGTAGTACATAAGGAAAATTGG - Intergenic
980876050 4:138663368-138663390 GAGAAGGTCTTTAGGCAAGAGGG - Intergenic
980893095 4:138835793-138835815 AAGAAGGACTTAGGGGAAGTGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986648408 5:9940727-9940749 CTGTAGGACTTCAGGCAAGTTGG - Intergenic
990744020 5:58939925-58939947 GAGTAGAATTAAAGGCAAATTGG - Intergenic
991138427 5:63210684-63210706 ATGCAGGACTTAAGGCAAATAGG - Intergenic
1003037483 6:2656925-2656947 GAATCTGACTTAAGGGAAGTTGG + Intergenic
1003867428 6:10376085-10376107 CAGTAGAACATAAGACAAGTTGG - Intergenic
1006092675 6:31637220-31637242 GAGAAGGACCTAAGGGAAGAAGG - Exonic
1007670639 6:43550404-43550426 CAGTAGGACTTCAGAAAAGTGGG - Intronic
1011194489 6:84767195-84767217 GAGCCGAACTTAACGCAAGTTGG - Intergenic
1011941166 6:92845499-92845521 GAGTAGGAATTAAGGCATGGTGG - Intergenic
1015280814 6:131432154-131432176 ATGTAGGACTGAATGCAAGTTGG + Intergenic
1016366873 6:143328425-143328447 AAGAAAGACTAAAGGCAAGTGGG + Intronic
1017715691 6:157211234-157211256 GAGCAGGACTTCAGGCAGCTGGG - Intergenic
1017967254 6:159277129-159277151 GAGTAGTACCATAGGCAAGTGGG + Intergenic
1021243794 7:18237046-18237068 GTGGAGGTCTTAAGTCAAGTGGG - Intronic
1028096888 7:86771977-86771999 GGATAGGACTGAAGGAAAGTAGG - Intronic
1028285235 7:88988784-88988806 GAGTAAGACTAAAGGAAACTTGG + Intronic
1038368474 8:26962332-26962354 GGGTAGGACCTAACACAAGTGGG - Intergenic
1040548460 8:48420303-48420325 GAGTAGGGCTGAAGGCAGGAGGG - Intergenic
1044607167 8:94057562-94057584 GAGTAGCACTGAAGGCAGTTGGG + Intergenic
1045680057 8:104649364-104649386 CAGAAGCATTTAAGGCAAGTTGG - Intronic
1050049221 9:1581423-1581445 GCCTAGGACTTAATGAAAGTTGG + Intergenic
1055209296 9:73770153-73770175 GAGGATCACTTAAGGCCAGTAGG - Intergenic
1056224151 9:84479175-84479197 GAGGATGACTTAAGCCAAGGAGG - Intergenic
1058114530 9:101069873-101069895 TAGGAGGACTTAGGGAAAGTGGG + Intronic
1188634940 X:32417893-32417915 AAGTAGGAGTTAAGGAAAATAGG - Intronic
1189732652 X:44037750-44037772 GAGTAGGCCTTAAAGCAAGCAGG - Intergenic
1190970238 X:55341559-55341581 GAACAGGACTTAAGACCAGTAGG + Intergenic
1192735245 X:73844480-73844502 GAGTAGGACTTTATTCAAATAGG + Intergenic
1195827488 X:109018105-109018127 GAGAAGGAAATAAGGCACGTTGG - Intergenic
1196317826 X:114250014-114250036 GAATAGCACTCAAGGCAACTGGG + Intergenic
1199591678 X:149473570-149473592 GAGTAGGAGTTAAAACAAGGAGG + Intergenic