ID: 1092908335

View in Genome Browser
Species Human (GRCh38)
Location 12:13122739-13122761
Sequence AGGTGGTGATGGGTGCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092908323_1092908335 30 Left 1092908323 12:13122686-13122708 CCAGCAGTCATTTGTCCAGTTGT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1092908335 12:13122739-13122761 AGGTGGTGATGGGTGCTTCAAGG 0: 1
1: 0
2: 3
3: 21
4: 233
1092908325_1092908335 15 Left 1092908325 12:13122701-13122723 CCAGTTGTTTACGTGGTTTCATT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1092908335 12:13122739-13122761 AGGTGGTGATGGGTGCTTCAAGG 0: 1
1: 0
2: 3
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092908335 Original CRISPR AGGTGGTGATGGGTGCTTCA AGG Intronic
901984690 1:13065269-13065291 AGGTGATGATGTGTGCTTCTAGG - Intronic
901997120 1:13161501-13161523 AGGTGATGATGTGTGCTTCTAGG + Intergenic
902040957 1:13492028-13492050 TGGTGGTGATGGTTGCATAACGG - Intronic
902389449 1:16094623-16094645 TGGTGGTGGTGGGTGTGTCAAGG - Intergenic
902724635 1:18326532-18326554 AGGTAGTGATGGGTCCTTTGAGG - Intronic
902833060 1:19029992-19030014 AGTTGGCGAAGGGTGCTCCAAGG - Intergenic
903498250 1:23786473-23786495 CTGTGGTGATGGGAGCTTCCAGG + Intronic
903507219 1:23846085-23846107 AGGTAGTTATGGGGGATTCAAGG + Exonic
903619236 1:24685902-24685924 AGGTGCTCATGGCTGGTTCAAGG + Intergenic
903684099 1:25118694-25118716 AGGGGGAGATGGGTGCTCAAAGG + Intergenic
904425577 1:30420666-30420688 AAGTGGTGCTGAGTGCTCCACGG - Intergenic
904574296 1:31493122-31493144 AGATGATGATTAGTGCTTCATGG + Intergenic
904604873 1:31692736-31692758 TGGAGGTGATGCCTGCTTCAGGG - Intronic
908137220 1:61145664-61145686 GGGTGGTGTTGGGTGCATCATGG + Intronic
911101994 1:94102541-94102563 TGGCTGTGATGGGTGCTGCAAGG - Intronic
912864310 1:113243734-113243756 AGGTTGTGATGGGTGGGTGATGG - Intergenic
913073954 1:115325447-115325469 AGGGGGTGGTGGAGGCTTCAGGG - Intronic
913102044 1:115577327-115577349 AGTTGCTGAGAGGTGCTTCAGGG + Intergenic
914249004 1:145906732-145906754 AGATGGTGATGGGGGATTCATGG - Exonic
914899886 1:151706276-151706298 AGGTGGTGGTGGGGGCTGCTGGG + Exonic
916639483 1:166711685-166711707 TGGTGGTCATGAGTGCTTCTGGG - Intergenic
920338895 1:205263058-205263080 AGGCGGTGGGGGGTGCTTGAGGG - Intronic
920542976 1:206793300-206793322 AGCTGGTGATGGCTGCTTTAGGG + Intergenic
920552132 1:206871039-206871061 AGGAGAAGATGGGTTCTTCAGGG - Intergenic
921153930 1:212423634-212423656 AGGTGGGGCTGGGTTCCTCAGGG - Intergenic
923147765 1:231209909-231209931 AGATGGGGATGGGTCCTCCAGGG + Intronic
924548645 1:245053796-245053818 GGATGGTGATGGGTTCCTCAAGG + Intronic
1062899392 10:1130926-1130948 AGGTGGTTATGGGTTTTTCTTGG - Exonic
1062975404 10:1678938-1678960 AGGTGGTGCTGGCTCCCTCACGG + Intronic
1063662112 10:8042118-8042140 GGCTGGTGGTAGGTGCTTCAGGG + Intergenic
1068201127 10:53785510-53785532 AGGTGCTAATGGGTGCCTCAGGG - Intergenic
1068206304 10:53859172-53859194 AGGAGATGATGGGAGCTTCAGGG - Intronic
1069822643 10:71237014-71237036 AGGTGTAGATGGGGGCTCCAGGG + Intronic
1069893497 10:71666396-71666418 AGGAAATGATGGGTGCTTGAAGG - Intronic
1070208849 10:74293917-74293939 TGGGGGTGAGGGGTGCTTCTGGG - Intronic
1071855270 10:89618136-89618158 AGGTGGAGAAGGGTCCTTTAGGG - Intronic
1073946710 10:108758883-108758905 AGGTGATGAAGGGTGCTTTATGG + Intergenic
1075658692 10:124178391-124178413 AGGTGGTGCAGGGTGTTACATGG + Intergenic
1077091400 11:779939-779961 AGGTGGGAAAGGGTGCTTCCAGG + Intronic
1077715631 11:4577354-4577376 ATGAGGTAATGAGTGCTTCAAGG + Intronic
1080274453 11:30487845-30487867 AAGTGGTGAGGTGTGCTTCTAGG - Intronic
1081950829 11:47041017-47041039 TGGTGCTGCTGGGTGCTACAGGG + Intronic
1083094110 11:60232541-60232563 TGGTGGTGATGGGAGCTGCTGGG - Intronic
1083099652 11:60289328-60289350 TGGTGGTGATGGGAGCTGCTGGG + Intronic
1084111038 11:67014469-67014491 AGCTGGTGCTGGGTGCGTCAGGG - Intronic
1085992951 11:81873281-81873303 AGGTGTGGATGGTTTCTTCAAGG + Intergenic
1088601241 11:111478100-111478122 TGGTGGTGATGGCAGCTGCAGGG - Intronic
1089515143 11:119027497-119027519 AGGTGGTGATGTAGGCTGCATGG - Intronic
1089753455 11:120668489-120668511 AGGGAGTGATGGGAGCTTAAAGG - Intronic
1090154915 11:124426995-124427017 AGGATGTGAAGGGTGCTTTAGGG + Intergenic
1090334949 11:125955818-125955840 GGGTGGTGGTTGGTGTTTCAAGG - Exonic
1090394165 11:126407960-126407982 ACGGGGTGATGCCTGCTTCATGG + Intronic
1090877628 11:130805143-130805165 AGGTGGGGACGGGGGCTTCCAGG - Intergenic
1092908335 12:13122739-13122761 AGGTGGTGATGGGTGCTTCAAGG + Intronic
1093339058 12:17949456-17949478 GGGTGGTGATGGGGGATGCAAGG - Intergenic
1095146234 12:38730917-38730939 AGGTAGTGATGATTACTTCAAGG - Intronic
1101375543 12:104168241-104168263 AGGTGGTAATGTGTGCATTAGGG - Intergenic
1104820035 12:131671891-131671913 AGGTGGTCATGGGGGATTCCAGG - Intergenic
1104987449 12:132604830-132604852 AGCTGGTGAGTGGTGTTTCAGGG - Exonic
1106133556 13:26958406-26958428 GGGAGGTGGGGGGTGCTTCATGG + Intergenic
1106133592 13:26958509-26958531 GGGAGGTGAGGGGTGCTCCATGG + Intergenic
1107435900 13:40380650-40380672 GGGTGGTGGAGGGTTCTTCAAGG - Intergenic
1108048311 13:46404336-46404358 GGGTGGTGATGGTGGCTACAAGG - Intronic
1111686123 13:91502680-91502702 GAGTGGTGCTGGGTGGTTCAGGG - Intronic
1113056928 13:106278262-106278284 AGGTGGTGATGGGTGCTACGTGG - Intergenic
1113213114 13:108005424-108005446 AGGCGGAGGTGGGTGCTGCATGG - Intergenic
1115303864 14:31914232-31914254 CGGTGGTGATGGGGGCTGCTGGG + Intergenic
1118224209 14:63883979-63884001 GGGTGGTGATGGGTGACCCAGGG + Intronic
1120964298 14:90153940-90153962 AGGTGGTGGTGGGTGGGTCTTGG + Intronic
1121507509 14:94487857-94487879 AGGAGGTGCTGGAGGCTTCAGGG - Intronic
1122069681 14:99197546-99197568 GGGTGGTGAGGGGTGCTCCAGGG + Intronic
1122795054 14:104201843-104201865 AGGTGGGGCTGGGGGCTGCAGGG - Intergenic
1122810945 14:104287589-104287611 AGGAGGTGATGTGGGCCTCAGGG + Intergenic
1123886431 15:24732202-24732224 AGGTGAGGATGGATGGTTCAGGG - Intergenic
1124249532 15:28097755-28097777 AGTTGGTGATGGGTGATGGATGG - Intronic
1124322091 15:28721836-28721858 AGGTGGTGGTGGTTGGGTCATGG - Intronic
1124523193 15:30423678-30423700 AGGTGGTGGTGGTTGGGTCATGG - Intergenic
1124535473 15:30542538-30542560 AGGTGGTGGTGGTTGGGTCATGG + Intergenic
1124763181 15:32465058-32465080 AGGTGGTGGTGGTTGGGTCATGG - Intergenic
1124775446 15:32584001-32584023 AGGTGGTGGTGGTTGGGTCATGG + Intergenic
1126802169 15:52308931-52308953 AGGTGTTGATGGGTGCTAGGAGG - Exonic
1128082807 15:64866295-64866317 AGCTGGAGATGGGAGCTGCAGGG - Exonic
1128578871 15:68795067-68795089 TGGTGGTGGTGTGTGCTGCAGGG - Intronic
1128770288 15:70276910-70276932 AAGAGGGGATGGGTGCTTCAAGG + Intergenic
1129119650 15:73388322-73388344 AGGTGGTGATATCTGATTCAGGG - Intergenic
1130504823 15:84529198-84529220 AGGTGGTGATGGTTGGATAATGG - Intergenic
1132072424 15:98790215-98790237 AGGTGGGTATGGGTGTTTGAAGG + Intronic
1132336714 15:101052662-101052684 AGGTGGTGATGGCTGGCACAGGG - Intronic
1132561241 16:595250-595272 AGGTGGTGGTGGGGGCTACACGG - Intronic
1132910482 16:2308216-2308238 AGGAGGTGATGGGAGCCACAGGG - Intronic
1133468246 16:6048839-6048861 AGGTGGTGATGGTTTCATAAGGG + Intronic
1133740308 16:8646372-8646394 TGGTTGTGATGTGTGCTCCAGGG + Exonic
1134833159 16:17339964-17339986 AAGGGGTGATGGATGCATCATGG - Intronic
1136253688 16:29024311-29024333 AGAAGGTGATGGGTGCCTCGAGG + Intergenic
1137687602 16:50397388-50397410 AGGGGGTGGTGGGTGAGTCATGG + Intergenic
1138965392 16:62078157-62078179 AGGTGGTGATAGAGGCTCCATGG - Intergenic
1139531361 16:67544251-67544273 AGGTGGTGATGTGTGCCTGTGGG + Intronic
1139962097 16:70723979-70724001 AGGTGGCCATGTGTCCTTCAGGG - Intronic
1140923146 16:79557941-79557963 AAGGCCTGATGGGTGCTTCAGGG + Intergenic
1141449567 16:84088927-84088949 AGGTGGAGATGGGGCCTTCCTGG + Intronic
1143117111 17:4587322-4587344 AGATGGGGATTGGTGCTTCGGGG - Intronic
1144579553 17:16450702-16450724 AGCTGGTCATGGGGGCTGCAGGG + Intronic
1144826988 17:18110826-18110848 AGGTGGTAAGAGGGGCTTCAAGG - Intronic
1147896016 17:43751889-43751911 AGGTGGAGAAGGGGGCTTCTAGG - Intergenic
1150174282 17:63033756-63033778 AGGTGATGATGGGTTATCCAGGG + Intronic
1150498271 17:65625874-65625896 AGGTGGTAATGCTTGCTCCAAGG - Intronic
1150650348 17:67006012-67006034 AGGTGGGGAGGGGTGGTTGATGG - Intronic
1151099676 17:71542655-71542677 AGATGGTGATGGCTGCTTCCAGG - Intergenic
1151713874 17:75821716-75821738 AGGTGGATATGGGTCCTTCTCGG + Intronic
1151830191 17:76544921-76544943 AGGAGGTGGTGGCTGCTCCAGGG + Intronic
1152701324 17:81821358-81821380 AGGTGGTGATGACTACATCATGG - Intergenic
1154315378 18:13299915-13299937 TGGTGGTGGTGGGTGTTTTAGGG + Intronic
1154338328 18:13483344-13483366 ACTTGGAGATGGGAGCTTCAAGG - Intronic
1156261685 18:35450333-35450355 AGGTGGTGATGAGCCCGTCATGG + Intronic
1156381801 18:36568367-36568389 AGGTGGTGGAGGGAGCCTCAGGG + Intronic
1156820627 18:41368300-41368322 AGTTGCTGGTGAGTGCTTCAGGG + Intergenic
1157545953 18:48546637-48546659 AGGTGTTGAGGGGTGCTTCCTGG + Intronic
1158300558 18:56047364-56047386 AGGATGTGATGTGTGCTTCTGGG + Intergenic
1160563345 18:79772340-79772362 AGGTTTTGATGGGTGCATCTCGG + Intergenic
1161406701 19:4094987-4095009 AGGTGCTGCTGGGTGCTTGGGGG + Intronic
1162568404 19:11457041-11457063 AGCTGGGGAGGGGTGCATCAGGG + Intronic
1163047208 19:14652380-14652402 ATTGGGTGATGGGTGCATCAGGG + Intronic
1164438570 19:28253599-28253621 AGGTGGCTATCGGTACTTCAGGG - Intergenic
1164994343 19:32708676-32708698 ATGTGGTGATGTGTGCCACATGG - Intronic
1165018859 19:32906613-32906635 AGGAGGGGATGGTTGATTCAAGG - Intronic
1166052765 19:40270204-40270226 CGGTGGTGATGGGTGCTTAGGGG - Intronic
1166707019 19:44913713-44913735 CGGTGGTCTGGGGTGCTTCAAGG + Intergenic
926884841 2:17587444-17587466 AGATGCTCATGGGTGCTTCTTGG + Intronic
930549751 2:52818266-52818288 GGGTGGTGATGGGGTGTTCATGG - Intergenic
931989052 2:67771060-67771082 GGGTGGTGATGAGTGGTTTAGGG + Intergenic
932259889 2:70318275-70318297 AGGGGGTGAGAGATGCTTCAGGG + Intergenic
933935460 2:87199930-87199952 GGGTTGTGATGGGTGCTTTGGGG - Intergenic
934667995 2:96187332-96187354 AGGTTGTGGTTGGTGATTCAGGG - Intronic
934723091 2:96595559-96595581 AGTTGGTGATGGCTGCCTCATGG - Exonic
936357688 2:111765969-111765991 GGGTTGTGATGGGTGCTTTGGGG + Intergenic
937328651 2:121007799-121007821 AGGTGCTGATGAGACCTTCAAGG - Intergenic
939567337 2:143800625-143800647 AGCCGGTGAAGGGTGCCTCATGG - Intergenic
939913062 2:148006493-148006515 AGTTGGGGAGGGGTGCCTCAGGG - Intronic
941452437 2:165675892-165675914 AGGTGGTGATGGCTTCCACAAGG + Intronic
942154878 2:173117922-173117944 AGGGGGTGATAGATGCTTGAGGG + Intronic
942402958 2:175622717-175622739 AGGTGGTGATGGGACATACAAGG + Intergenic
942521108 2:176805135-176805157 AGGTGGTTATGGGGGATTCAAGG + Intergenic
942845186 2:180415784-180415806 TGGTGGGGGTGGGTGCTTGATGG + Intergenic
944976950 2:205064718-205064740 ATGTGGTCAAGGGAGCTTCAAGG + Intronic
946430922 2:219627233-219627255 GGGAGGTGGTGGGTGCTTCCAGG + Intergenic
947624583 2:231611736-231611758 GGGTGGAGAGGGGGGCTTCAGGG + Intergenic
948128006 2:235579079-235579101 AGCTGGGGAAGGCTGCTTCATGG - Intronic
948534234 2:238634390-238634412 AGGTGGTGATGTGGCCTTCGCGG - Intergenic
1169197712 20:3692460-3692482 GGGTGGTGGAGGGTGCTTCTGGG - Intronic
1170790680 20:19506942-19506964 AGGAGGTGCTGGGTGTTCCAGGG - Intronic
1174124313 20:48291477-48291499 TGGTGGAGATCGGTGCTTCAAGG + Intergenic
1174576544 20:51541848-51541870 AGGAGGTGATGGGAGCTGCGTGG + Intronic
1175415851 20:58800535-58800557 AGGAGGTGCTTGGTGCTTCCTGG + Intergenic
1175494819 20:59406517-59406539 GGGTGATGATGGGGGCTCCAGGG + Intergenic
1175739614 20:61411556-61411578 ACGTGGTGCTGTCTGCTTCAGGG + Intronic
1177960489 21:27660505-27660527 AGGTGTTGATGGGGGCTGCTGGG - Intergenic
1179109869 21:38437331-38437353 AGGTGGGGGTGGGGGCTGCAGGG + Intronic
1179575498 21:42305945-42305967 AGGGGGTGCCGCGTGCTTCATGG - Intergenic
1180741705 22:18057597-18057619 AGGTGGTTATGGGTGCTTAACGG + Intergenic
1181850431 22:25745882-25745904 AGGTAGAGATGGTTGCTTGATGG + Intronic
1182782338 22:32878146-32878168 AGGTGATGATGAGAGGTTCAGGG - Intronic
1183095031 22:35546874-35546896 TGGTGGTGCTGGGTGCCTCTCGG + Exonic
1183414597 22:37675229-37675251 AGGAGGTGCAGGGTCCTTCAGGG - Intergenic
1184467606 22:44677979-44678001 AGCTGGTGCTGGGGGCCTCAAGG + Intronic
1184962317 22:47940431-47940453 AGGTGGTGATGGTTGCAACTTGG + Intergenic
949987669 3:9553210-9553232 AGGCGGTGGTGGGCGCTTCTAGG + Intronic
950095089 3:10324387-10324409 AGGGGGTGATGGCTGCTGCCTGG + Exonic
950161099 3:10761819-10761841 CGGTGAGGCTGGGTGCTTCAGGG + Intergenic
950247700 3:11436899-11436921 AGGTGGGGATGGGGGATTAAGGG + Intronic
951643226 3:24859254-24859276 AGGTGGTTCTGGGAGCTTGAGGG + Intergenic
952557236 3:34546579-34546601 TGGTGGTGAGGGGTGTTTGAGGG + Intergenic
952822416 3:37496593-37496615 AGGTGGTTCTGGCTGCTACATGG - Intronic
952823253 3:37503182-37503204 TGGTGGTGATGGGTGCTCCAGGG + Exonic
952923716 3:38306742-38306764 GGGTAGAGATGGGTGCTGCATGG + Intronic
954122060 3:48505172-48505194 AGGAGGTGATGGGGGCTTATTGG - Intergenic
956159788 3:66337789-66337811 GGTTGGTGATGGGTACTGCATGG - Intronic
957417741 3:79928873-79928895 AGCTGGGGCTGTGTGCTTCACGG + Intergenic
959449485 3:106481280-106481302 TGGTGGTGATGGGGGCTACTAGG + Intergenic
960564889 3:119122782-119122804 AGCAGGTGATGGGACCTTCAAGG - Intronic
961065204 3:123869519-123869541 AGATGGGGAGGGGTGATTCAAGG - Intronic
961671470 3:128534832-128534854 AGGTAGAGATGGGTGGTTAATGG - Intergenic
963878580 3:150503440-150503462 AGGTGTTGATGGGGGCTGCTGGG - Intergenic
973307170 4:48665816-48665838 ACTTTGTGATGAGTGCTTCATGG - Intronic
974150749 4:58005883-58005905 AGGTTGTGAGGCCTGCTTCACGG + Intergenic
977352054 4:95901032-95901054 AGGCAGGGATGGGTGCTTCCAGG + Intergenic
977863207 4:101991911-101991933 AGGTGGTGGTGAGTATTTCATGG - Intronic
978337416 4:107684704-107684726 AGGTGGTGCGGGGAGCTTCTAGG - Intronic
980148139 4:129014940-129014962 AGGTGGTGGTGCTGGCTTCAGGG + Intronic
985819100 5:2147878-2147900 AGGGGGTGATGGGCTCTTCAGGG - Intergenic
986583112 5:9285809-9285831 TTCTGGTGATGGCTGCTTCATGG + Intronic
986777178 5:11026782-11026804 AGGTGGTCATGGGAGGATCAAGG + Intronic
990801713 5:59611481-59611503 AGGTTGTGATGAGTGTTACAAGG - Intronic
991409091 5:66329259-66329281 AGGTGGGGCTAGGTGATTCAAGG - Intergenic
992701439 5:79345172-79345194 TGGTGGTGATGGTAGTTTCATGG - Intergenic
995409710 5:111842131-111842153 AGGTGTTGGTAGGTGCATCAAGG - Intronic
995751994 5:115461664-115461686 AGCCAGTGATGAGTGCTTCAAGG + Intergenic
997076679 5:130687033-130687055 TGGTGCTGTTAGGTGCTTCAGGG - Intergenic
997335579 5:133106937-133106959 TGGTGGTGATGGGTGTTTAAAGG + Intergenic
1000987468 5:167876292-167876314 AGGTGGTGTGGGGAGCATCAGGG + Intronic
1001429189 5:171646115-171646137 AGGTGCAGATGGGAGCTCCAGGG + Intergenic
1006136824 6:31900796-31900818 AGGTGGGGGTGGGGGCTTCGGGG + Exonic
1006706547 6:36025795-36025817 AGATAGTCATGGGTGATTCATGG - Intergenic
1009901452 6:69812256-69812278 AGGTGGGGCAGGGTGCTTCCAGG + Intergenic
1010792102 6:80076117-80076139 AGGTGTTGATGGGTGTTCCTGGG + Intergenic
1011164264 6:84428504-84428526 AGGTGGCGATGGCTGCTACCAGG + Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1015808108 6:137132921-137132943 AGGTGGTGATGAGGGCTGCTGGG - Intergenic
1016486122 6:144541744-144541766 AGGTAGTGATGGGTACATAAAGG + Intronic
1017070254 6:150569882-150569904 AGGTGGTGGTGGGAATTTCAGGG - Intergenic
1017878242 6:158541480-158541502 AGGAGGAGATGGGTGCCCCAGGG - Intronic
1019014551 6:168870578-168870600 AAGTGGTGGTGGGGGCTTCCAGG - Intergenic
1019664556 7:2244995-2245017 CGGTGGTGCTGGGGGCTGCAGGG + Intronic
1022616568 7:31936996-31937018 AGGTTGGGAGGGGTGCTTCCAGG + Intronic
1023372998 7:39530577-39530599 AGGGGGCCATGGGTGCTTAAAGG - Intergenic
1024366714 7:48528772-48528794 AGGTGGTCATGACTCCTTCAGGG + Intronic
1026146430 7:67750521-67750543 AGGTAGAGAAGAGTGCTTCAGGG + Intergenic
1026966985 7:74446313-74446335 AGCTGGTGCTGGGAGCTTGATGG + Intergenic
1027685362 7:81273868-81273890 AGCAGTTGATGGGTGCTTCCAGG + Intergenic
1030330184 7:108262267-108262289 GGGAGGTGGTGGGTGCATCAAGG - Intronic
1030777167 7:113548466-113548488 ACTTGGTGATGGGGGCTTGATGG + Intergenic
1030940422 7:115640302-115640324 TGGTGGTGATGGAAGCTTTACGG - Intergenic
1031176156 7:118353771-118353793 AAGTGTTGGGGGGTGCTTCAAGG + Intergenic
1031205674 7:118754540-118754562 AGCTGCTGATGGGTGCCACATGG + Intergenic
1031463728 7:122082790-122082812 AGATGGGGCTGGGTGGTTCAAGG + Intronic
1031463804 7:122083700-122083722 AGATGGGGCTGGGTGGTTCAAGG + Intronic
1036481301 8:9141876-9141898 GGGGGGTGGGGGGTGCTTCAAGG + Intronic
1037806914 8:22063122-22063144 AGGTTGTAGTGGGTGCATCAGGG - Intronic
1038461369 8:27720131-27720153 AGGAGATGTGGGGTGCTTCAAGG + Intergenic
1040035539 8:42866400-42866422 GGGTGGTGGTGGGTGCTACTTGG + Intronic
1040880945 8:52203759-52203781 AGGTGCTGAAGAGTGCATCAGGG + Intronic
1041146723 8:54883822-54883844 TGGTGCTGATGGGAGCTGCAAGG + Intergenic
1041558006 8:59181091-59181113 AGGTATTTATGGTTGCTTCAAGG + Intergenic
1044375007 8:91460032-91460054 AGGTGGAGATGGGTGCAGGAAGG + Intergenic
1047230206 8:122991537-122991559 AGGTGGTGGTGGTTGCTTGTTGG + Intergenic
1049213350 8:141396676-141396698 AGGTGGGGATGGGGGCTACAGGG + Intronic
1049317301 8:141976127-141976149 AGGTGGGGATGGGAATTTCAGGG + Intergenic
1049679726 8:143912743-143912765 AGGTGGGGAAGGATGCGTCAAGG + Intergenic
1049816324 8:144604300-144604322 AGGTGGTGTTGGGTCCTCCCGGG - Intronic
1053412503 9:37924899-37924921 AGGCTGTGGTGGGAGCTTCAGGG - Intronic
1055909181 9:81327493-81327515 CGGTGGTGATGGGTGCTGTTGGG + Intergenic
1056740338 9:89249204-89249226 AGGTGCTGAGAGCTGCTTCAGGG + Intergenic
1056821937 9:89848697-89848719 ATGGGGTGATGAGTGCTCCACGG + Intergenic
1057292299 9:93814444-93814466 AGGTGGGGGTGGGGGCTTGAAGG - Intergenic
1060688838 9:125638068-125638090 AGCTGGTAATGGGTACTTAATGG + Intronic
1061067641 9:128288547-128288569 AGGTGGTCCTGGGTGGGTCAGGG + Intronic
1061161899 9:128900229-128900251 AGGTGGGGTGGGGTGCTGCAGGG - Intronic
1062727320 9:138083007-138083029 AGATGGTGATGGGGGCTGCTGGG - Intronic
1186322933 X:8450142-8450164 AGGGGGAGATGGTAGCTTCAAGG + Intergenic
1188707399 X:33352666-33352688 AGGTGGTGATAAGTGCTGAAAGG - Intergenic
1189180694 X:39001874-39001896 AGGTAGAGATGGCTGCTTGAGGG + Intergenic
1194398439 X:93414288-93414310 AGGAGGTGATGGATCCTTCTAGG - Intergenic
1196357374 X:114809985-114810007 AGGAGGTGATGAGTTCTTCCAGG + Intronic
1196684253 X:118496652-118496674 GGGTGGTGATGGGTGTTGAAGGG + Intronic
1198483039 X:137058401-137058423 AGGTGGTCATGGGTGATTGCTGG - Intergenic
1200072638 X:153536681-153536703 AGGGGGAGATGGGAACTTCATGG + Intronic
1200766627 Y:7085674-7085696 AGCTGGTGATGTGTGGTACAGGG + Intronic
1200912372 Y:8542450-8542472 AGGTGATCAAGTGTGCTTCAAGG + Intergenic
1201328905 Y:12797398-12797420 AGCGGGTGATGGGGGCTTCCAGG + Intronic