ID: 1092908992

View in Genome Browser
Species Human (GRCh38)
Location 12:13128506-13128528
Sequence GCGTGTGCATGTGCGTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092908988_1092908992 15 Left 1092908988 12:13128468-13128490 CCTCCACAAAGTCTCATCTCCTG 0: 1
1: 1
2: 1
3: 27
4: 373
Right 1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG 0: 1
1: 0
2: 4
3: 45
4: 290
1092908987_1092908992 27 Left 1092908987 12:13128456-13128478 CCATTCTGTCTGCCTCCACAAAG 0: 1
1: 0
2: 0
3: 25
4: 321
Right 1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG 0: 1
1: 0
2: 4
3: 45
4: 290
1092908991_1092908992 -4 Left 1092908991 12:13128487-13128509 CCTGAATGGAGCTGTAAGAGCGT 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG 0: 1
1: 0
2: 4
3: 45
4: 290
1092908989_1092908992 12 Left 1092908989 12:13128471-13128493 CCACAAAGTCTCATCTCCTGAAT 0: 1
1: 0
2: 1
3: 30
4: 258
Right 1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG 0: 1
1: 0
2: 4
3: 45
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092908992 Original CRISPR GCGTGTGCATGTGCGTGCTC AGG Intronic
900137400 1:1123781-1123803 GTGTGTGCAGATGTGTGCTCAGG - Intergenic
900137401 1:1123803-1123825 GTGTGCGCAGGTGTGTGCTCAGG - Intergenic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137409 1:1123918-1123940 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900137411 1:1123940-1123962 GTGTGTGCAGGTGTGTGCGCAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137437 1:1124188-1124210 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900353219 1:2247245-2247267 CCGTGGGCATGTGTGTGCACAGG + Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
900513548 1:3071021-3071043 GGGTGTGCGTGTGCGTGTTCGGG + Intronic
900529664 1:3146619-3146641 GTGTGTGCATGTGCTTGGTATGG + Intronic
900576408 1:3384694-3384716 GCATGTGTGTGTGCATGCTCAGG - Intronic
900818955 1:4871568-4871590 GTGTGTGCATGTGTGTGTACAGG - Intergenic
901206038 1:7496463-7496485 GCGTGTGCACATGCGTGCCCAGG + Intronic
902074955 1:13777067-13777089 CTGTGTGCATGTGCGTGTTGTGG - Intronic
902741143 1:18439155-18439177 GCGTGTGAGTGTGCGTGCACAGG + Intergenic
902833520 1:19033002-19033024 GTGCGTGCATGTCCATGCTCTGG - Intergenic
902987565 1:20164420-20164442 GCGTGTGCATGTGTGTGTTTAGG + Intronic
904563701 1:31414613-31414635 GCGTGTGCATGTGCGTGTGCAGG + Intronic
904620675 1:31773204-31773226 GCGTGTGCATGCATCTGCTCAGG - Intergenic
904902913 1:33871588-33871610 GCATGTTGATGTGCCTGCTCAGG + Intronic
905295990 1:36954738-36954760 GTGTGTCCTTGTGCGTGCACAGG - Intronic
905296136 1:36955537-36955559 GTGTGTGCATGCGTGTTCTCCGG - Intronic
906791937 1:48666513-48666535 GTGTGTGCACGTGCATGCTAAGG - Intronic
907898805 1:58718647-58718669 ACGGGTGCAAGTGCCTGCTCTGG + Intergenic
910290557 1:85596433-85596455 GTGTGTGCATGTGCACGCGCGGG - Intergenic
912435174 1:109656578-109656600 GTGTGTGTGTGTGCGTGCGCCGG + Intronic
913511810 1:119569128-119569150 GCTTGTGCATGTGCCTGCTAGGG + Intergenic
914914623 1:151811548-151811570 GCGCGTGCATGTGTGTGCCTTGG + Intronic
916743943 1:167669978-167670000 GCGTGTGCGTGTGTGTCCTGAGG - Intronic
918306546 1:183251893-183251915 GTGTGTGTATGTGCGTGCGCGGG + Exonic
919641904 1:200053554-200053576 GTGTGTGCGTGTGCATGCTGGGG - Intronic
921069784 1:211649436-211649458 GGGTGTGCATGTGTGTCCTTGGG + Intergenic
921343987 1:214162895-214162917 GCGTGTGCATGTGTGTATCCTGG - Intergenic
921708025 1:218346041-218346063 GTGTGTGCGTGTGCGCGCGCTGG - Intergenic
921960524 1:221029062-221029084 GTGTGTGCATGTACATGTTCGGG - Intergenic
1062981151 10:1724195-1724217 GCATGTGCCTGTGTGTCCTCAGG + Intronic
1063158285 10:3399593-3399615 GCGTGTGCATGTGTGCGTGCGGG + Intergenic
1063223378 10:3992116-3992138 GTGTGTGCATCTGGCTGCTCAGG + Intergenic
1063342811 10:5284031-5284053 GGATGTGCATGTGCGTGTTTGGG + Intergenic
1065816975 10:29491342-29491364 ACGTGTGCATGGGCGTGGTAGGG - Intronic
1067061295 10:43079170-43079192 GAGTGTGCATGTGTGAGCTGTGG - Intronic
1067941959 10:50664443-50664465 GTGTGTGTATTTGCGTGCTGGGG - Intergenic
1069709789 10:70480829-70480851 GTGAGTGCGTGTGTGTGCTCAGG + Intronic
1069851596 10:71408961-71408983 GTGTGTGCATGTGCATGCATTGG + Intronic
1069899531 10:71699470-71699492 GTGTGTGCATCTGCATGCACTGG + Intronic
1070375503 10:75827151-75827173 GCATGTTTTTGTGCGTGCTCAGG + Intronic
1070394484 10:76000391-76000413 GGGTGTGCATCTGTGTGCACAGG + Intronic
1070399458 10:76040592-76040614 GCGTGTGCATGCTCGTGGTTGGG - Intronic
1071403634 10:85305147-85305169 GCGTGTGTGTGTGCATGCTGGGG - Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073381851 10:103083943-103083965 GCGTGTGCAGGTGGGTCTTCAGG + Exonic
1074163838 10:110857789-110857811 ACGTGTGCGTGTGTGTGTTCAGG - Intergenic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075508102 10:123043931-123043953 GTGTGTGCATGTGTGTACACAGG - Intronic
1075785758 10:125049098-125049120 GTGTGTGTATGTGTGTGGTCAGG - Intronic
1077227240 11:1443692-1443714 GCGTGTGCCTGTGTGTGCACAGG + Intronic
1079133584 11:17763454-17763476 GAGTGTGCATGTGCGTGTCCGGG - Intronic
1080845040 11:36019657-36019679 GCTTGTGCCTTTGCCTGCTCTGG + Intronic
1081087750 11:38822436-38822458 GTATGTGCATGTGTGTGGTCAGG - Intergenic
1081677262 11:44977665-44977687 GTGTGTGCATGTGTGTGATCTGG - Intergenic
1083018984 11:59486868-59486890 GTGTGTACATGTGCATGCTTTGG + Intergenic
1084786769 11:71447105-71447127 AAGTGTGCATGTGGGTGGTCTGG - Intronic
1085527197 11:77171211-77171233 GCGTGTGTATGTGCATGCTGAGG + Intronic
1085842074 11:80023597-80023619 GTGTGTGCATGTGTGTCATCAGG - Intergenic
1089098547 11:115940051-115940073 GAAAGTGCAAGTGCGTGCTCGGG - Intergenic
1090081168 11:123613721-123613743 GAGTGTGCATGTGTGTGCCTTGG - Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1095438640 12:42219619-42219641 GTGTGTGCATGTGTGTGTGCAGG - Intronic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1098195820 12:68001072-68001094 GTGTGTGTATGTGTGTGCTCTGG - Intergenic
1101726387 12:107391845-107391867 GCGTGTGTATGTGTGTGATGGGG + Intronic
1101845998 12:108363499-108363521 GCATGTGCATGTGTGTGGTATGG + Intergenic
1101966307 12:109284571-109284593 GCGTGTGTGTGTGCGCGCTGTGG + Intronic
1102012050 12:109624713-109624735 GTGTGTGTATGTGCGTGTGCAGG + Intergenic
1103091168 12:118099105-118099127 GGGTGTGAGTGTGCCTGCTCAGG + Intronic
1103971718 12:124676692-124676714 GTGTGTGCGTGTGTGTGCGCGGG + Intergenic
1104807630 12:131599628-131599650 GTGTGTGTATGTGTGTGCACAGG - Intergenic
1104931765 12:132343294-132343316 GCATGTGTATGTGAGTGCTATGG + Intergenic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106585737 13:31054829-31054851 GTCTGTGCGTGTGCGTGCACAGG - Intergenic
1107625572 13:42279242-42279264 GGGTGTGCACGTGCGTGCACTGG - Intronic
1109192665 13:59344290-59344312 GTGTGTGCATGTGTATGCTTTGG - Intergenic
1112944828 13:104915370-104915392 GTGTGTGCATGTGTGTGTGCAGG - Intergenic
1113519650 13:110930690-110930712 GCCGCTGCATGTGCTTGCTCAGG + Intergenic
1113863550 13:113506845-113506867 GCGTGAGCATGTGCTTCATCAGG + Intronic
1113945478 13:114041709-114041731 GTGCATGCATGTGGGTGCTCAGG + Intronic
1118384907 14:65247917-65247939 GCGTGTGCGTGTGTGTGCAAGGG - Intergenic
1118570877 14:67194437-67194459 GCGTGTGTGTGTGTGTGCTGTGG + Intronic
1119778698 14:77264264-77264286 GTGTGTGCATGGGCATGCACTGG - Intergenic
1122276468 14:100593243-100593265 GTGTGTGCCTGTGGGTGGTCGGG - Intergenic
1124696388 15:31867938-31867960 GTGGGTGCATGTGTGTGCGCCGG - Intronic
1125195124 15:37037441-37037463 GTGTGCGAATGTGCGTGCTTAGG - Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1128580874 15:68808759-68808781 GTGTATGCATGTGCGTGTGCAGG - Intronic
1129082340 15:73052267-73052289 GCGTGCGCGTGTGCGCGCCCGGG + Intronic
1133989543 16:10694016-10694038 GCCTGAGCATGTGTGTGTTCTGG - Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135505251 16:23030877-23030899 GCGTGTGCAGGTGCCATCTCTGG - Intergenic
1136107366 16:28039703-28039725 GGATGTGCATGTGTGTGCACAGG - Intronic
1136266321 16:29121503-29121525 ACGTGAGCATGTGCGTGCCCTGG - Intergenic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1137400190 16:48146966-48146988 GTGTGTGCATGTGTGTGCGTGGG - Intronic
1139569935 16:67805641-67805663 GCCTGTGTAAGTGCGTCCTCTGG - Intronic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1142055129 16:87989416-87989438 ACGTGAGCATGTGCGTGCCCTGG - Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG + Intergenic
1143109810 17:4546712-4546734 GTGTGCGCATGTGCGTGTGCAGG + Intronic
1143390896 17:6558629-6558651 GTGTGTGCTTGTGTGTGCTTAGG + Intergenic
1143476015 17:7204404-7204426 GCGTGTGCGTGTGTGTGATGTGG - Intronic
1144754085 17:17668999-17669021 GCGTGTGCGTGTGTGTGCGCAGG - Intergenic
1146669939 17:34730241-34730263 GTGTGTGCATGTGTGTGTGCGGG - Intergenic
1147188419 17:38725334-38725356 GCGTGGGCATGTGCAAGCTAAGG - Intronic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1149644065 17:58226891-58226913 GAGTGTGCATGTGCCAGCTCAGG - Intronic
1151436571 17:74101204-74101226 GCCTGTGCGTGTGTGTGTTCTGG - Intergenic
1151509828 17:74551397-74551419 GTGTGTGTGTGTGCGTGCGCAGG - Intergenic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152273678 17:79341244-79341266 GTGTGTACATGTGTGTGCACAGG + Intronic
1152526854 17:80893216-80893238 GCCTGTGCCTGTGTGTGCGCCGG + Intronic
1152560185 17:81074332-81074354 ACGTGTGAGTGTGCGTGCACTGG + Intronic
1152733495 17:81985279-81985301 GTGTGTGCATGTGAGTGTGCAGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152737872 17:82006236-82006258 GCGGGTGCATGTGCATGCTTGGG + Intronic
1152737880 17:82006277-82006299 GCGGGTGCACGTGCGTGTTTGGG + Intronic
1153398636 18:4655231-4655253 GTGTGTGCATGTGCATGTTATGG - Intergenic
1153667745 18:7381583-7381605 GCCTGTGCATGTGTGTGCGCCGG - Intergenic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154324511 18:13380207-13380229 CCTTGTGCATGTGGGTGCTGTGG + Intronic
1158109180 18:53920841-53920863 GCATGCGCAGGTGCGTGCACGGG + Intergenic
1158120006 18:54038436-54038458 GCGTGTGCATGTGTGTGTGTGGG - Intergenic
1160509263 18:79444205-79444227 GCGTGTGTGTGTGCACGCTCTGG + Intronic
1161322777 19:3648967-3648989 GTGTGTGCATGTGTGTGTCCAGG - Intronic
1161967683 19:7557325-7557347 GCGTGTGCGTGTGTGTGGTGCGG - Intronic
1162301531 19:9847698-9847720 GTGTGTGCATGTGTGTGTGCTGG + Intronic
1162807151 19:13143938-13143960 GTGTGCACATGTGCGTGTTCCGG - Intergenic
1163369253 19:16892888-16892910 GTGTGTGCATGTGTGTGTCCCGG - Intergenic
1164479689 19:28601945-28601967 GTGTGTGCATGTGCGTGTGTGGG - Intergenic
1166652199 19:44582972-44582994 GCTTGTGCCTGGGCTTGCTCTGG - Intergenic
1166711819 19:44942475-44942497 GCGTATGCATGTGCGTGTCGGGG + Intronic
1167181151 19:47904448-47904470 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167181819 19:47909808-47909830 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167182468 19:47915198-47915220 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167183136 19:47920550-47920572 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167183804 19:47925900-47925922 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167184433 19:47930950-47930972 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167185105 19:47936301-47936323 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167185758 19:47941690-47941712 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167186425 19:47947045-47947067 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167187076 19:47952436-47952458 CCGCGTGCATGTGTGTACTCGGG - Intergenic
1167542116 19:50095813-50095835 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167542550 19:50098878-50098900 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167542987 19:50101943-50101965 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167543423 19:50105006-50105028 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167544096 19:50110350-50110372 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167544771 19:50115703-50115725 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167545446 19:50121055-50121077 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167546123 19:50126410-50126432 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167546800 19:50131745-50131767 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167547457 19:50137118-50137140 CCGCGTGCATGTGTGTACTCGGG + Intergenic
1167784909 19:51628581-51628603 GCGTGTGTGTGTGCGTGTGCGGG + Intronic
1167827744 19:51989145-51989167 GCATGTGAATGTCCGTGTTCAGG - Intergenic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
926122495 2:10252429-10252451 GTGTGTGCATGTGCGTGTGGTGG + Intergenic
926249865 2:11148599-11148621 GGGTGGGCATGGGCGTGGTCAGG - Intergenic
927477424 2:23424278-23424300 ACGTGTGCATGTGTGTGCGTGGG + Intronic
928276770 2:29908275-29908297 GTGTGTGTGTGTGTGTGCTCTGG - Intronic
931516574 2:63053728-63053750 GCGTGTGCGTGTGTGTGTGCAGG + Intronic
931991666 2:67796681-67796703 GTGTGTGTATGTGCGTGATGGGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
933949445 2:87315488-87315510 GTGTGTGCATGTGTGTGCACGGG + Intergenic
935310648 2:101779679-101779701 GAGTTTGCATGAGAGTGCTCTGG + Intronic
936073712 2:109388078-109388100 GTGTGTGCATGTGTGTGCACAGG - Intronic
936330747 2:111546109-111546131 GTGTGTGCATGTGTGTGCACGGG - Intergenic
939713338 2:145551634-145551656 GTGTGTGGATGTGCGTGTGCAGG + Intergenic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942865439 2:180668011-180668033 GTGTGTGCATGTGTGTGTTATGG + Intergenic
944436554 2:199696144-199696166 GCATGTGCATGTGTGTGCCCTGG - Intergenic
946617718 2:221527631-221527653 GCGTGTGTCTGTGCTTCCTCAGG + Intronic
947000693 2:225452780-225452802 ACGTGTGCATGTGTGTGGTGGGG - Intronic
947052306 2:226059191-226059213 GCGTGCTCATGTGCTAGCTCAGG + Intergenic
947386623 2:229596974-229596996 GCGTGTGCATGTGTGTGCGCAGG - Intronic
947693133 2:232158329-232158351 GTGTGTGCATGTGTGTGTTCGGG + Intronic
947916639 2:233836501-233836523 GCGTGCGCACCTGCATGCTCAGG - Intronic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
1168804371 20:663811-663833 GCGTCTGCATGTGCGCGCGCAGG + Exonic
1168891068 20:1295642-1295664 GCGTCTCCATGAACGTGCTCAGG - Intronic
1169399837 20:5270512-5270534 ATGTGTGCTTGTGCGTGCTAGGG + Intergenic
1170405055 20:16026947-16026969 GTGTGTGTATGTGTTTGCTCTGG + Intronic
1172619972 20:36312324-36312346 GCGTGTGCATGTGCATATTGAGG - Intronic
1173028669 20:39333925-39333947 GTGTGTGCATGTGTGTGTGCAGG - Intergenic
1173119388 20:40275014-40275036 GTGTGTGCATGTACATGCTTGGG + Intergenic
1173325199 20:42026776-42026798 GTGTGTGCATGTGCGCACACGGG + Intergenic
1173585918 20:44183010-44183032 GCGTGTGTATGTGTGTGTTTTGG - Intronic
1173658163 20:44715293-44715315 GCGTGTGCCTGTGTGTGCCTGGG + Intronic
1173997516 20:47350241-47350263 GTGCGTGCATGTGTGTGCACGGG - Intronic
1174887018 20:54347078-54347100 GTGTGTGCATGTGCGTGCTTTGG + Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175850400 20:62087618-62087640 GCGTGTGCAGGTGAGTGTACAGG - Intergenic
1175850404 20:62087684-62087706 GCGTGTGCAGGTGGGTGTACAGG - Intergenic
1175850421 20:62087942-62087964 GCGTGTGCAGGTGAGTGTGCAGG - Intergenic
1175850443 20:62088318-62088340 GCGTGTGCAGGTGAGTGTACAGG - Intergenic
1175928758 20:62483659-62483681 GCATATGCATGTGTGTGCACAGG - Intergenic
1175957622 20:62619349-62619371 GAGTGGGCATGAGCGTGCACAGG - Intergenic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1177999955 21:28149954-28149976 GTGTGTGTGTGTGCGTGCTCAGG + Intergenic
1178710045 21:34908953-34908975 GTGTGTGTATGTGTGTGCTAGGG + Intronic
1179153926 21:38833076-38833098 GTGTGTGCATGTGTGTTCTTGGG - Intergenic
1179505406 21:41836471-41836493 GCGAGCGCACGTGCCTGCTCAGG + Exonic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1182966899 22:34530562-34530584 GTGTGTGCATGTGTGTGTTTGGG + Intergenic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1184073697 22:42162830-42162852 GCATGTGCATGTACGTGCTTGGG - Intronic
1184478209 22:44732658-44732680 GTATGTGCGTGTGCGTGCTGGGG - Intronic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
1185023687 22:48395507-48395529 GTGTGTGCATGTGTGTGCACAGG - Intergenic
951479894 3:23148967-23148989 GAGTGTGCATGTCTGTGCACAGG + Intergenic
953369298 3:42373547-42373569 GGGTGTGCATGTGTGTGTGCAGG + Intergenic
953743181 3:45554348-45554370 ACGTGTGCATGTGTGTGGTGTGG - Intergenic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
957363875 3:79196353-79196375 GCGTGTGCATGTGTGTGTGATGG - Intronic
958010148 3:87866840-87866862 GTGTGTGCGTGTGTGTGTTCAGG + Intergenic
958646065 3:96876064-96876086 GCATTTGTATGTGCTTGCTCTGG - Intronic
959515236 3:107258690-107258712 GTGTGTGCTTGTGCGTGCTTTGG - Intergenic
960052903 3:113254624-113254646 GGGTGTGCATGCGTGTGCACCGG - Intronic
960441804 3:117697722-117697744 GCGTGGGCATGCCCGTGTTCAGG + Intergenic
961649860 3:128411865-128411887 GCATGTGCATGTGCGCACACGGG + Intergenic
961653166 3:128427501-128427523 GTGTGTGCATGGGCGTGAGCAGG - Intergenic
962677116 3:137765330-137765352 GCGTGTGCGTGTGCTGGCTGGGG - Exonic
963729372 3:148956679-148956701 TAGTGTAGATGTGCGTGCTCAGG - Intergenic
965361203 3:167740722-167740744 GCGTGTGTGTGTGCGTGCATGGG + Intronic
966161277 3:176971299-176971321 GTGTGTGCATGCACGTGCTTCGG + Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967219619 3:187237617-187237639 GGTGGTGCATGTGCATGCTCAGG - Intronic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
973007988 4:45036676-45036698 GTGTGTGTATGTCCGTGCTATGG + Intergenic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974413740 4:61577194-61577216 GTGTGTGCATGTGTGTGTTAGGG + Intronic
974867120 4:67594942-67594964 GTGTGTGCATGTGTGTGATTGGG + Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
977249884 4:94677854-94677876 GTGTGTGCATGAGCCTGCACAGG - Intergenic
978084897 4:104639461-104639483 GTGTGTGTGTGTGCGCGCTCAGG - Intergenic
978575413 4:110184985-110185007 GCCTGTGCATGTGTGTACTGGGG + Intronic
979692768 4:123577595-123577617 CTGTGTGCATGTGTGTGATCTGG + Intergenic
981107665 4:140899570-140899592 GCATGTGTATGTGTGTGCACAGG + Intronic
983717641 4:170805084-170805106 GCCTGTGTATGTGCCTGCTAGGG - Intergenic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985581367 5:697004-697026 GCGTGTGCCTGTGTGTGCATGGG + Intergenic
985795735 5:1960880-1960902 GCGTATGCATGTCTGTGTTCTGG - Intergenic
985795753 5:1961196-1961218 GTGTGTGCATGTGTGTGATCAGG - Intergenic
985795754 5:1961255-1961277 GTGTGCGCATGTGTGTGTTCAGG - Intergenic
986109795 5:4702224-4702246 GTGTGTGTGTGTGTGTGCTCAGG + Intergenic
987514488 5:18888370-18888392 CCTTGTGCATCAGCGTGCTCTGG - Intergenic
987576983 5:19742379-19742401 GCGTGTGCATTTGTGTGTTTTGG - Intronic
988520876 5:31944733-31944755 GCGTGTGCACGTGTGTCCCCAGG + Intronic
990777584 5:59320172-59320194 GCGCATGCATGTGCGTGTGCAGG + Intronic
991502994 5:67295636-67295658 GTGTGTGTGTGTGCGTGCACGGG + Intergenic
993690310 5:90992004-90992026 GCGTGTGCATGTGCACCCACAGG - Intronic
995106471 5:108381805-108381827 GTGTGTGCGTGTGTGTGCGCAGG - Exonic
996163660 5:120197994-120198016 ACGTGTGCATGTGTGTGTTTTGG - Intergenic
997095705 5:130908747-130908769 GTGTGTGCATGTGCGTGTGTGGG - Intergenic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
999844291 5:155461507-155461529 GTATGTGCATGTGCGTGTTTGGG - Intergenic
1002095899 5:176830802-176830824 GTGTGTGCGTGTGTGTGCGCTGG + Intronic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1003009512 6:2413629-2413651 GTGTTTGCATGCACGTGCTCAGG - Intergenic
1003566996 6:7230400-7230422 GCGTGCGCATGTGGATGCGCAGG - Exonic
1006923088 6:37638943-37638965 GTGTGTGCATGTGTGTGTTTGGG - Intronic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1012355818 6:98312710-98312732 GCATGTGCCTGTGCTTGCACAGG - Intergenic
1014208469 6:118682762-118682784 GTGTGTGTGTGTGCATGCTCAGG - Intronic
1015395358 6:132727914-132727936 TTGTGTGCATGTGTGTGCTCTGG + Intronic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1018240973 6:161774377-161774399 GTGTGTGTGTGTGTGTGCTCAGG - Intronic
1018244104 6:161805437-161805459 GTGTGTGCATGTGTGTACTCAGG - Intronic
1018299554 6:162386698-162386720 GTGTATGCATGTGTGTGCGCAGG + Intronic
1018918569 6:168154637-168154659 GCGTGTGAGTGTGTGTGCACAGG + Intergenic
1018925666 6:168205291-168205313 GCGTGAGCGTGTGCTTGCACGGG - Intergenic
1019492202 7:1320827-1320849 GCGTGTGCATGTGCAACCTCAGG + Intergenic
1022528357 7:31052473-31052495 GCGTGTGCGTGTGCGCACGCGGG - Exonic
1022965518 7:35467953-35467975 GTGTGTGCATGTGGGTGTGCTGG + Intergenic
1023870025 7:44258286-44258308 GTGTGTGCATGTGGGTACGCTGG - Intronic
1023986022 7:45096541-45096563 GTGTGTGTATGTGTGTGCACTGG - Intergenic
1024803255 7:53105940-53105962 GTGTGTCCATGCGCATGCTCAGG + Intergenic
1034378264 7:150665586-150665608 GTGTGTGCACATGCGTTCTCTGG + Intergenic
1034526848 7:151669791-151669813 GTGTGTGCAAGTGTGTGCACAGG - Intronic
1034783096 7:153899776-153899798 GAGTGTGAATGTGTGTGCACAGG + Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1037745903 8:21643830-21643852 GCGCGTGCATGTGTGTGTTTTGG - Intergenic
1041909691 8:63075572-63075594 GGGTGTGGTGGTGCGTGCTCAGG + Intronic
1045538648 8:103059869-103059891 GTGTGTGTGTGTGCGTGCTGGGG - Intronic
1046530768 8:115442585-115442607 GTGTGTGCATGTGTGTGTTTGGG + Intronic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1049016819 8:139925800-139925822 GCGTGTGCGTGTGCGTGTGCTGG - Intronic
1049315726 8:141966259-141966281 GTGTGCACATGTGTGTGCTCTGG - Intergenic
1049673098 8:143878345-143878367 GCGGGTGCGGGTGCGGGCTCGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1049761381 8:144333340-144333362 GCGTCTGCATGTGCGCGCGCAGG + Exonic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1051367806 9:16333582-16333604 GTCTGTGCATGTGCTGGCTCTGG - Intergenic
1051400019 9:16670980-16671002 GCTTGTGCATGTGCGTCTTCAGG - Intronic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053411422 9:37918361-37918383 GCGTGTGCGTGTGCGTGTGTAGG + Intronic
1055736146 9:79333736-79333758 GTGTGTGCATGTGCGCCCACAGG + Intergenic
1056178668 9:84060826-84060848 GCGTGTGAATGTGTGAGCTCAGG + Intergenic
1057404629 9:94757747-94757769 GTGTGAGCATGTGTGTGTTCAGG + Intronic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061526124 9:131164221-131164243 ACGTGTGCATGTGTGAGCTAGGG + Intronic
1062037284 9:134388299-134388321 GTATGTGCATTTGCGTGCACAGG + Intronic
1062107327 9:134763006-134763028 GTGTATGCATGTGCATGCACAGG + Intronic
1062107330 9:134763063-134763085 GTGTATGCATGTGCATGCACAGG + Intronic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1186286265 X:8046899-8046921 GCTTGTGTATGTGCCTGCTAAGG + Intergenic
1189915256 X:45850628-45850650 CCGTGTGAATGTGCGTCCTAGGG - Intergenic
1192216740 X:69164628-69164650 GCGTGTGCCTGCGCATGCGCGGG + Intronic
1192244513 X:69361523-69361545 GTGTGTGTGTGTGCGTGCACAGG - Intergenic
1195716591 X:107824974-107824996 GCGTGTGTGTGTGTGTGCTGGGG + Intergenic
1197398321 X:125956073-125956095 GTGTGTGTGTGTGCATGCTCAGG + Intergenic
1197845345 X:130795985-130796007 GTGTGTGTATGTGTGTGTTCTGG + Intronic
1199246430 X:145610544-145610566 GTGTGTGCATGTGCATACACTGG - Intergenic
1199580094 X:149352045-149352067 GCTTGTGCATGTGCCCGCTAGGG + Intergenic
1199791843 X:151162129-151162151 ACGTGTGGATGTGCATGCTCAGG + Intergenic