ID: 1092912780

View in Genome Browser
Species Human (GRCh38)
Location 12:13162792-13162814
Sequence AGAAGAGACAAGCATCGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092912780_1092912785 8 Left 1092912780 12:13162792-13162814 CCTGAGCGATGCTTGTCTCTTCT No data
Right 1092912785 12:13162823-13162845 ATAAATTCTGTTGCTGGAATCGG No data
1092912780_1092912786 9 Left 1092912780 12:13162792-13162814 CCTGAGCGATGCTTGTCTCTTCT No data
Right 1092912786 12:13162824-13162846 TAAATTCTGTTGCTGGAATCGGG No data
1092912780_1092912784 2 Left 1092912780 12:13162792-13162814 CCTGAGCGATGCTTGTCTCTTCT No data
Right 1092912784 12:13162817-13162839 CAGGTTATAAATTCTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092912780 Original CRISPR AGAAGAGACAAGCATCGCTC AGG (reversed) Intergenic
No off target data available for this crispr