ID: 1092912784

View in Genome Browser
Species Human (GRCh38)
Location 12:13162817-13162839
Sequence CAGGTTATAAATTCTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092912780_1092912784 2 Left 1092912780 12:13162792-13162814 CCTGAGCGATGCTTGTCTCTTCT No data
Right 1092912784 12:13162817-13162839 CAGGTTATAAATTCTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092912784 Original CRISPR CAGGTTATAAATTCTGTTGC TGG Intergenic
No off target data available for this crispr