ID: 1092913767

View in Genome Browser
Species Human (GRCh38)
Location 12:13171527-13171549
Sequence GGACACCCCAGTCCACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092913767_1092913774 2 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913774 12:13171552-13171574 TGCCCAGGAAGACACTGATGGGG No data
1092913767_1092913783 20 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913783 12:13171570-13171592 TGGGGCGGTAGGGTGGTGGTGGG No data
1092913767_1092913777 5 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913777 12:13171555-13171577 CCAGGAAGACACTGATGGGGCGG No data
1092913767_1092913785 24 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913785 12:13171574-13171596 GCGGTAGGGTGGTGGTGGGTGGG No data
1092913767_1092913780 13 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913780 12:13171563-13171585 ACACTGATGGGGCGGTAGGGTGG No data
1092913767_1092913772 0 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913772 12:13171550-13171572 TCTGCCCAGGAAGACACTGATGG No data
1092913767_1092913784 23 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913784 12:13171573-13171595 GGCGGTAGGGTGGTGGTGGGTGG No data
1092913767_1092913778 9 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913778 12:13171559-13171581 GAAGACACTGATGGGGCGGTAGG No data
1092913767_1092913781 16 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913781 12:13171566-13171588 CTGATGGGGCGGTAGGGTGGTGG No data
1092913767_1092913773 1 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913773 12:13171551-13171573 CTGCCCAGGAAGACACTGATGGG No data
1092913767_1092913779 10 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913779 12:13171560-13171582 AAGACACTGATGGGGCGGTAGGG No data
1092913767_1092913782 19 Left 1092913767 12:13171527-13171549 CCCTCCTGTGGACTGGGGTGTCC No data
Right 1092913782 12:13171569-13171591 ATGGGGCGGTAGGGTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092913767 Original CRISPR GGACACCCCAGTCCACAGGA GGG (reversed) Intergenic
No off target data available for this crispr