ID: 1092915453

View in Genome Browser
Species Human (GRCh38)
Location 12:13185208-13185230
Sequence CTGGAGACTCAGAAGGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092915446_1092915453 11 Left 1092915446 12:13185174-13185196 CCAGAATTGGACATGGAGAGTGG No data
Right 1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092915453 Original CRISPR CTGGAGACTCAGAAGGCGGA GGG Intergenic
No off target data available for this crispr