ID: 1092916205

View in Genome Browser
Species Human (GRCh38)
Location 12:13191579-13191601
Sequence CCTCAAACTCAGATGCCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092916205_1092916207 -2 Left 1092916205 12:13191579-13191601 CCATGCGGCATCTGAGTTTGAGG No data
Right 1092916207 12:13191600-13191622 GGAACCGAGATCCCATTACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092916205 Original CRISPR CCTCAAACTCAGATGCCGCA TGG (reversed) Intergenic
No off target data available for this crispr