ID: 1092919028

View in Genome Browser
Species Human (GRCh38)
Location 12:13214433-13214455
Sequence CTATTGCTAATGAGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 492}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092919024_1092919028 11 Left 1092919024 12:13214399-13214421 CCTGTTTAGGGACAAACAAGCAG 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1092919028 12:13214433-13214455 CTATTGCTAATGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 21
4: 492
1092919023_1092919028 22 Left 1092919023 12:13214388-13214410 CCATCAGAACTCCTGTTTAGGGA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1092919028 12:13214433-13214455 CTATTGCTAATGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 21
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092919028 Original CRISPR CTATTGCTAATGAGGGAAAT AGG Intronic
903364817 1:22799630-22799652 CTTTTGCAGATGAGGGAACTGGG + Intronic
905723755 1:40230157-40230179 ATATTTCTAAAGAGGGAACTGGG - Intronic
905939455 1:41851654-41851676 CTATTGAAAATGAGAGAAACAGG - Intronic
906770136 1:48476126-48476148 TCATTCCAAATGAGGGAAATTGG - Intergenic
907586332 1:55621059-55621081 CCATTCCTAATGGGAGAAATTGG - Intergenic
909057110 1:70834114-70834136 CTATTGCAAATGGGAGATATTGG - Intergenic
909086136 1:71172105-71172127 CCATTGCAAATGGGAGAAATTGG + Intergenic
909298601 1:73983029-73983051 CCATTCCAAATGGGGGAAATTGG + Intergenic
909334683 1:74458324-74458346 TTAATGCTCATGAGGCAAATTGG + Intronic
909756972 1:79239353-79239375 CCATTTCAAATGAGAGAAATTGG + Intergenic
910363355 1:86437302-86437324 TTATAGCTAATGAGGGACACAGG + Intronic
910563473 1:88618090-88618112 CCATTCCAAATGAGAGAAATTGG + Intergenic
911123743 1:94321104-94321126 CTACTGCTATTGAGGCAAACAGG - Intergenic
911811476 1:102287568-102287590 TTAGTGCTAAAGAGAGAAATAGG + Intergenic
911880895 1:103236892-103236914 CCATTCCAAATGAGAGAAATTGG - Intergenic
912004411 1:104879009-104879031 CCATTCCAAATGAGAGAAATTGG - Intergenic
915527559 1:156485325-156485347 CTCTTGCTCATGAGGGAAGGAGG + Intronic
917022148 1:170601383-170601405 CCATTCCAAATGGGGGAAATTGG + Intergenic
917323804 1:173811452-173811474 CTATAGCCAATGAGGAATATAGG - Intronic
917919674 1:179740874-179740896 ATATTACCAATGAGGGAAACTGG + Intergenic
918459358 1:184759913-184759935 CTAGTGCCAGTGAGAGAAATGGG - Intergenic
918536643 1:185582221-185582243 GAATTGCTAATGTGGGAAAGAGG - Intergenic
918668986 1:187189276-187189298 CTCTTCCAAATGAGGGAAAATGG - Intergenic
918781278 1:188703418-188703440 CTATTTCAAATGTAGGAAATAGG + Intergenic
918794800 1:188880007-188880029 CTCTTGCAAAAGAGGAAAATGGG + Intergenic
918800248 1:188961511-188961533 CCATTCCAAATGAGAGAAATTGG - Intergenic
918998210 1:191790922-191790944 TTATTGCTAATGAGGGGATGTGG - Intergenic
919124455 1:193378529-193378551 CCATTCCAAATGGGGGAAATTGG - Intergenic
919290560 1:195624199-195624221 CTGTTCCAAATGAGAGAAATTGG - Intergenic
919409598 1:197227297-197227319 CCATTCCAAATGAGAGAAATTGG + Intergenic
919436688 1:197571641-197571663 ATATTTCTAGTGAAGGAAATGGG - Intronic
920325063 1:205156543-205156565 CCATTCCAAATGAGAGAAATTGG - Intronic
921632395 1:217451525-217451547 CATTAGCTAATGAGGGAACTGGG - Intronic
922310265 1:224382027-224382049 ATTTTACAAATGAGGGAAATAGG - Intergenic
923120444 1:230985211-230985233 CGAATGCTAAGAAGGGAAATGGG + Intronic
923587264 1:235284869-235284891 TTTTTGCTCATGAGGGATATTGG - Intronic
923893452 1:238241204-238241226 CTAATGCTAATGAGGAAAGTAGG + Intergenic
1063268650 10:4482617-4482639 CTAATGAAAATGAGGTAAATGGG + Intergenic
1066024143 10:31336281-31336303 GGATTGCCAATGAGTGAAATAGG + Intronic
1068010396 10:51442424-51442446 CTATTACAAATGAGGGAGGTAGG - Intronic
1068184284 10:53564719-53564741 CTGTTCCAAATGAGAGAAATTGG - Intergenic
1068221970 10:54056887-54056909 CCATTCCAAATGAGAGAAATTGG + Intronic
1068284950 10:54922354-54922376 CTATTCCAAAAGAGAGAAATTGG + Intronic
1070626472 10:78054522-78054544 CTTTTGCAGATGAGGGAATTGGG + Exonic
1071402840 10:85294164-85294186 CTATTACCATTGGGGGAAATGGG - Intergenic
1071549982 10:86559502-86559524 CTGTTCCAAATGAGAGAAATTGG + Intergenic
1071671371 10:87612189-87612211 CTATTCCAAATGGGAGAAATGGG - Intergenic
1072369101 10:94745476-94745498 CCATTGCAAATGGGAGAAATTGG - Intronic
1072380293 10:94861385-94861407 TTAGAGCTAAAGAGGGAAATAGG + Intergenic
1072487935 10:95874273-95874295 CTGTTCCAAATGAGAGAAATTGG + Exonic
1074610081 10:115013512-115013534 TTCTTGCTAATGAGGAAAAGTGG - Intergenic
1074741713 10:116491507-116491529 CTGTTGCCAATGATGTAAATAGG - Intergenic
1075767092 10:124901572-124901594 CTGTTACTAAAGAGGGAAAGGGG + Intergenic
1078065344 11:8075166-8075188 TTATTGCTAATAGGGGAAATTGG - Intronic
1078122068 11:8520956-8520978 CTAATGATAATGAATGAAATTGG + Intronic
1078201798 11:9190074-9190096 CCATTCCAAATGAGAGAAATTGG - Intronic
1078556285 11:12329199-12329221 CTATTTCTAATGAGCAAATTTGG - Intronic
1079962372 11:26940515-26940537 CCATTGCAAATGGGAGAAATTGG + Intergenic
1080151532 11:29057348-29057370 CTATTCCAAATGGGAGAAATTGG - Intergenic
1080817518 11:35772648-35772670 CCATTCCAAATGGGGGAAATTGG - Intronic
1081238984 11:40680175-40680197 CCATTGCAAATGGGAGAAATTGG - Intronic
1082626716 11:55495798-55495820 CCATTCCAAATGGGGGAAATTGG + Intergenic
1082780734 11:57285653-57285675 CTTTTGCTTTAGAGGGAAATGGG + Intergenic
1082788277 11:57329533-57329555 CTATTTTTAATTAAGGAAATCGG + Intronic
1082827085 11:57587738-57587760 CCATTCCAAATGAGAGAAATTGG - Intergenic
1085861903 11:80244727-80244749 CCATTCCAAATGAGAGAAATTGG - Intergenic
1086280734 11:85184575-85184597 CTGTACCAAATGAGGGAAATGGG - Intronic
1086562212 11:88180709-88180731 CACTTTATAATGAGGGAAATAGG + Intergenic
1087474239 11:98617547-98617569 CTATTTAAAATGAGAGAAATTGG + Intergenic
1087497419 11:98908534-98908556 CCATTCCAAATGAGAGAAATTGG - Intergenic
1087612245 11:100448446-100448468 CTATTCCAAAAGAGAGAAATTGG - Intergenic
1088497158 11:110442570-110442592 CTATTCCAAATGGGAGAAATCGG - Intronic
1088851013 11:113703326-113703348 CTATTCCAAATGGGAGAAATTGG - Intronic
1090504721 11:127298613-127298635 CTATTCCAAATGGGAGAAATTGG - Intergenic
1091145264 11:133273805-133273827 CCATTGATAATGACGGACATTGG - Intronic
1091294013 11:134459847-134459869 CTATTGCTAATGTGGGATGGAGG + Intergenic
1091811784 12:3405605-3405627 CTGTTCCAAATGAGAGAAATTGG + Intronic
1092326360 12:7535147-7535169 CAATTCCAAATGAGAGAAATTGG - Intergenic
1092361252 12:7838471-7838493 CCATTGCAAAAGGGGGAAATGGG - Intronic
1092518400 12:9240200-9240222 GGAATGCTAATGAGGAAAATGGG - Intergenic
1092796082 12:12111272-12111294 GGAATGCTAATGAGGAAAATGGG + Intronic
1092919028 12:13214433-13214455 CTATTGCTAATGAGGGAAATAGG + Intronic
1093230471 12:16537136-16537158 CTGTTCCAAATGGGGGAAATTGG + Intronic
1093589316 12:20881819-20881841 ATATTGCTAATGTTGGTAATAGG - Intronic
1093709449 12:22313390-22313412 GTTTTGCCAATGAAGGAAATAGG + Intronic
1094036893 12:26081548-26081570 CTATTCCAAATGGGAGAAATTGG + Intergenic
1094343030 12:29434032-29434054 CTATTGCAAATTATAGAAATCGG - Intronic
1095235100 12:39785880-39785902 CTATTCCAAATGGGAGAAATTGG - Intronic
1095308840 12:40670653-40670675 CTTCTGCTAATGATGGAATTAGG + Intergenic
1098011703 12:66060193-66060215 CAATTGCTAATGGGAGACATTGG - Intergenic
1098653739 12:73004936-73004958 CTGTAGCTAATAAGGGAACTGGG + Intergenic
1098830780 12:75360443-75360465 CCATTCCAAATGAGAGAAATTGG + Intronic
1099932717 12:89092110-89092132 CTCTTGCAAATGGGAGAAATTGG - Intergenic
1100402298 12:94242822-94242844 CTTTTGCAAATGAGGGAACTGGG + Intronic
1101026644 12:100613902-100613924 CTATTTCTATTGAGGGAATCAGG + Intronic
1101321313 12:103675655-103675677 TTATTTCTCATGAGGAAAATGGG - Intronic
1102211638 12:111131639-111131661 CCATTCCGAATGAGAGAAATTGG + Intronic
1103357877 12:120335172-120335194 CCATTCCAAATGAGAGAAATTGG + Intergenic
1104343238 12:127971719-127971741 CCAGTGCTAATGATGGCAATAGG - Intergenic
1104588046 12:130063168-130063190 CCATTCCAAATGAGAGAAATTGG - Intergenic
1106877385 13:34088673-34088695 CCATTGCAAATGGGAGAAATTGG - Intergenic
1106967437 13:35088423-35088445 CTATGGCTAACCATGGAAATTGG - Intronic
1107554684 13:41507545-41507567 CCATTCCAAATGGGGGAAATTGG + Intergenic
1108184245 13:47872859-47872881 CCATTCCAAATGGGGGAAATTGG + Intergenic
1109098360 13:58145716-58145738 CCATTCCAAATGAGAGAAATTGG - Intergenic
1109681363 13:65756919-65756941 CTATTCCAAATGAGAGAAATTGG - Intergenic
1110377931 13:74814906-74814928 CTATTCCAAATGGGAGAAATCGG - Intergenic
1110701109 13:78550200-78550222 CTGTTGATAATGGGGGAGATTGG + Intergenic
1110846642 13:80197313-80197335 CTGTTACTAATAAGGAAAATAGG - Intergenic
1110965525 13:81690177-81690199 GGAATGCTAATGAGGAAAATGGG + Intergenic
1111107874 13:83669756-83669778 CTGTTCCAAATGAGAGAAATTGG - Intergenic
1111385540 13:87521959-87521981 CTGTTGCAAATGGGAGAAATTGG - Intergenic
1111688149 13:91527284-91527306 CTGTTCCAAATGAGAGAAATTGG + Intronic
1111889852 13:94068661-94068683 CCATTGCAAATGGGAGAAATTGG + Intronic
1111936059 13:94557943-94557965 CAATTGCAAATGAGGAGAATAGG - Intergenic
1112185520 13:97124577-97124599 CTATTAATCATGAGGGAGATTGG + Intergenic
1112625357 13:101097608-101097630 CCATTCCTAATGAGGAAAACAGG - Intronic
1112889236 13:104211027-104211049 CTATGGCTAATAAGGGAACTGGG + Intergenic
1114320879 14:21546369-21546391 CTATTCCAAATGGGAGAAATTGG + Intergenic
1115090318 14:29567047-29567069 CCATTCCAAATGAGAGAAATTGG + Intergenic
1115112554 14:29841086-29841108 CCATTCCAAATGAGAGAAATCGG - Intronic
1115404244 14:32997174-32997196 CTATTCCAAATGGGAGAAATTGG - Intronic
1115608971 14:35034008-35034030 CCATTGCAAATGGGAGAAATCGG + Intergenic
1115729662 14:36255069-36255091 CTGTTCCTAATGAGGGCAAAGGG + Intergenic
1116389543 14:44376538-44376560 CTATTCCAAATGGGAGAAATTGG + Intergenic
1116393592 14:44422306-44422328 CCATTTCAAATGAGAGAAATTGG + Intergenic
1116542328 14:46113297-46113319 CTATTCCAAATGGGAGAAATTGG - Intergenic
1116986143 14:51222417-51222439 CCATTCCAAATGAGAGAAATTGG + Intergenic
1117256849 14:53986454-53986476 CTGTTCCAAATGAGAGAAATTGG - Intergenic
1117749311 14:58903573-58903595 CTATTCCAAATGGGAGAAATTGG - Intergenic
1117775289 14:59177703-59177725 CTAATGCAAGTGGGGGAAATGGG + Intergenic
1118431818 14:65726896-65726918 CCATTACAAATGAGAGAAATTGG + Intronic
1118496017 14:66308760-66308782 CTATTCCAAATGGGAGAAATTGG + Intergenic
1118956962 14:70491305-70491327 CCATTCCAAATGAGAGAAATTGG + Intergenic
1119013599 14:71024326-71024348 CTATTGCCAATGAAGACAATGGG - Intronic
1119447151 14:74675154-74675176 GTGATGGTAATGAGGGAAATGGG - Intronic
1120134185 14:80845831-80845853 TAATTGATAATGATGGAAATGGG + Intronic
1120247837 14:82027252-82027274 CTATTCCAAATGGGAGAAATTGG + Intergenic
1120817962 14:88883140-88883162 CCATTGCAAGTGAGAGAAATTGG + Intergenic
1123195851 14:106615895-106615917 CCATTGCAAATGGGAGAAATTGG + Intergenic
1123629045 15:22248168-22248190 CCATTCCAAATGAGAGAAATTGG - Intergenic
1123677455 15:22725088-22725110 CTCTTGGTAATGAAGGAAGTAGG + Intergenic
1124329665 15:28799359-28799381 CTCTTGGTAATGAAGGAAGTAGG + Intergenic
1125275242 15:37981965-37981987 CTACTGTTCATGAGGGAAACAGG - Intergenic
1126185002 15:45823286-45823308 CCATTCCAAATGAGAGAAATTGG + Intergenic
1127171490 15:56307385-56307407 GGATTGCCAGTGAGGGAAATTGG - Intronic
1127273190 15:57419323-57419345 ATATTGATAATAGGGGAAATTGG - Intronic
1128889644 15:71319186-71319208 GTATGTCTAATCAGGGAAATGGG + Intronic
1129900964 15:79149233-79149255 CCATTGCAAATGGGAGAAATTGG + Intergenic
1130778492 15:87009848-87009870 CCATTTCAAATGAGAGAAATTGG - Intronic
1132811293 16:1799147-1799169 CTATTCCAAATGGGAGAAATTGG - Intronic
1135190874 16:20353478-20353500 CTATTACTACTGTGGGAGATGGG - Intronic
1140614265 16:76641463-76641485 CCAGTGTTCATGAGGGAAATTGG + Intergenic
1141037728 16:80643130-80643152 CTATTCCAAATGGGAGAAATTGG + Intronic
1141975025 16:87510090-87510112 CCATTCCAAATGAGAGAAATTGG + Intergenic
1147814813 17:43201496-43201518 CTGTGGCTAAAGAGGAAAATGGG + Intronic
1148319231 17:46736087-46736109 GTACTGCAAATGAGGGAAGTTGG - Intronic
1148518720 17:48248072-48248094 CTATTTCTATTAAGGCAAATAGG + Intronic
1151002944 17:70399695-70399717 CTATTCCAAATGGGAGAAATTGG - Intergenic
1151074593 17:71256505-71256527 CTATTGCTAATGAGAGGACTTGG - Intergenic
1153363108 18:4221326-4221348 TTATTGTAAATGAGGAAAATGGG - Intronic
1156004168 18:32420386-32420408 CCACTGATATTGAGGGAAATGGG + Intronic
1156065138 18:33132823-33132845 CAATTGGTAATGAAAGAAATAGG - Intronic
1156077817 18:33301720-33301742 CTATTCCAAAAGAGAGAAATTGG - Intronic
1156243676 18:35277120-35277142 CTATTCCAAATGGGAGAAATTGG - Intronic
1156534384 18:37848696-37848718 CTCTGGGTAATGAGGGTAATAGG + Intergenic
1156683246 18:39616557-39616579 CCATTCCAAATGAGAGAAATTGG + Intergenic
1156858776 18:41813259-41813281 CCATTGCGAATGGGAGAAATTGG + Intergenic
1156924466 18:42558881-42558903 CTATTGCTCATCAGTAAAATGGG - Intergenic
1157003016 18:43549929-43549951 CCATTTCAAATGAGAGAAATTGG + Intergenic
1157842993 18:50976880-50976902 CCATTCCAAATGAGAGAAATTGG + Intronic
1159139830 18:64380084-64380106 CTTTTGCTACTAAGGGAAGTTGG + Intergenic
1159215648 18:65387488-65387510 CCATTCCAAATGAGAGAAATTGG - Intergenic
1159718058 18:71849769-71849791 CCACTGCAAATGAGAGAAATTGG - Intergenic
1160068207 18:75598112-75598134 CTATTTATAATGAGGCAAAATGG - Intergenic
1160080293 18:75720275-75720297 CTATTGCTAGTGAGAGGAACAGG - Intergenic
1160461723 18:79043721-79043743 CTATTCCTAATGAGAAACATGGG + Intergenic
1163815842 19:19463947-19463969 CTATTGCTCATTTGTGAAATTGG + Intronic
1164494731 19:28749641-28749663 CCATTCCAAATGAGAGAAATTGG + Intergenic
1167403565 19:49289092-49289114 CCATTCCAAATGAGAGAAATTGG - Intergenic
1168455100 19:56500656-56500678 CTCATGCAAATGAGGGAAACAGG - Intergenic
1168559852 19:57373656-57373678 CTATTCCTAATGGAAGAAATGGG + Intronic
925245667 2:2380234-2380256 TTATTGCAAATGGGAGAAATTGG - Intergenic
925455985 2:4017098-4017120 CTATTCCAAATGGGAGAAATTGG + Intergenic
925524740 2:4787424-4787446 CCATTGCAAATGAGAGAAATTGG + Intergenic
926456453 2:13073616-13073638 CCATTCCAAATGAGAGAAATTGG + Intergenic
926611827 2:14955112-14955134 CTATTCCAAATGGGAGAAATTGG + Intergenic
926983651 2:18598011-18598033 CTATTACTAATGGGAGAAAGGGG - Intergenic
928112529 2:28522211-28522233 CAATTGTAAATGAGGGAAATGGG + Intronic
928821515 2:35366950-35366972 CCATTGCAAATGGGAGAAATTGG - Intergenic
928910869 2:36419410-36419432 CTCTTGTTAATGATGCAAATAGG - Intronic
930440869 2:51403736-51403758 CCATTCCAAATGAGAGAAATTGG + Intergenic
930471669 2:51823572-51823594 TTATTGATAATAGGGGAAATTGG + Intergenic
930480676 2:51944347-51944369 CTGTTCCAAATGAGAGAAATTGG - Intergenic
930960068 2:57251008-57251030 CTGTTTCAAATGAGAGAAATGGG + Intergenic
932537636 2:72617005-72617027 CCATTCCAAATGAGAGAAATTGG + Intronic
933520084 2:83360735-83360757 TTCTTGCTAATGAGAGAAATAGG - Intergenic
933548072 2:83740198-83740220 CCATTCCAAATGAGAGAAATTGG + Intergenic
934918570 2:98321627-98321649 CCATTCCAAATGAGAGAAATTGG - Intergenic
935486129 2:103656537-103656559 CGATAGCTAATTAGGTAAATAGG - Intergenic
936499469 2:113054692-113054714 CTATTCCAAATGGGAGAAATTGG + Intergenic
936590329 2:113797545-113797567 TTATTGCTAATGACTGCAATTGG + Intergenic
936728864 2:115357324-115357346 CCATTCCAAATGAGAGAAATTGG + Intronic
937800694 2:126077435-126077457 CCATTCCAAATGGGGGAAATTGG - Intergenic
938641481 2:133285477-133285499 CTCTTGCTAATGTAGTAAATGGG + Intronic
939016989 2:136914221-136914243 CTATTCCAAATGGGAGAAATTGG - Intronic
939091986 2:137790634-137790656 CTATTCCAAATGAGAGAAACTGG + Intergenic
939150166 2:138463016-138463038 CTGTTCCAAATGAGCGAAATTGG + Intergenic
939278957 2:140038282-140038304 CCATTCCAAATGAGAGAAATTGG + Intergenic
939353748 2:141074010-141074032 CTATAGCTGCTGAGAGAAATAGG + Intronic
939729779 2:145768436-145768458 CTTTTGTTAAGGAGGGGAATTGG - Intergenic
940621811 2:156122193-156122215 CTATTCCAAATGGGAGAAATTGG - Intergenic
940826613 2:158419760-158419782 CAGTTTCTAATGAGGGAAATGGG - Intronic
941247167 2:163113113-163113135 CTATTCCAAATGAGAAAAATTGG + Intergenic
942783379 2:179672223-179672245 CTATTCCAAAAGAGAGAAATAGG - Intronic
943427287 2:187752360-187752382 CTGTTCCAAATGAGAGAAATTGG + Intergenic
944650312 2:201823106-201823128 TTATTGCTGATGAGGGGAAAAGG - Intronic
944846279 2:203671459-203671481 CCATTGATAATGAGGGTAGTGGG - Intergenic
945284342 2:208067018-208067040 GTATTTCTAATGAGTAAAATGGG + Intergenic
945495203 2:210500492-210500514 CTATTCCAAATGGGAGAAATTGG + Intronic
945926947 2:215815484-215815506 AGATTGCGAATGAGGAAAATTGG - Intergenic
946546008 2:220744647-220744669 CTAGTGCAAATATGGGAAATAGG - Intergenic
946574198 2:221056874-221056896 CCATTCCAAATGAGAGAAATTGG + Intergenic
946575481 2:221071301-221071323 CCATTTCAAATGAGAGAAATTGG + Intergenic
947396777 2:229694672-229694694 CTGTTCCAAATGAGAGAAATTGG - Intronic
947419746 2:229931479-229931501 CTTATGCTGATGAGGCAAATAGG - Intronic
947951554 2:234152311-234152333 CCATTCCAAATGAGAGAAATTGG + Intergenic
948520270 2:238532084-238532106 CCATTCCAAATGAGAGAAATTGG - Intergenic
1170252613 20:14301774-14301796 CTATTTCAAAAGAGGGAAACAGG - Intronic
1172870723 20:38134024-38134046 CTACTGCTAAAGAGGGAGATTGG + Intronic
1172987334 20:39002412-39002434 CTATTGGTTAGGAGGGAAAATGG + Intronic
1173145527 20:40520997-40521019 CTAATGCCAATTAGGGAAATGGG + Intergenic
1174824628 20:53758251-53758273 ATTTTGCAAATGAGGGAACTAGG + Intergenic
1174885815 20:54332994-54333016 TTATAGCTAATGGAGGAAATAGG - Intergenic
1176369794 21:6055870-6055892 CTATTTCTCAGGCGGGAAATGGG - Intergenic
1176696068 21:9978995-9979017 CCATTGCAAATGGGAGAAATTGG - Intergenic
1176883841 21:14230262-14230284 CCATTCCAAATGAGAGAAATTGG - Intergenic
1177047387 21:16187150-16187172 CTATTGGCAATGAGGCATATGGG + Intergenic
1177258155 21:18692686-18692708 CCATTCCAAATGAGAGAAATTGG + Intergenic
1177504219 21:22000262-22000284 CTATTCCAAATGGGAGAAATTGG + Intergenic
1177529108 21:22337390-22337412 CTGTTCCAAATGAGAGAAATTGG - Intergenic
1177599307 21:23289633-23289655 CCATTCCAAATGAGAGAAATTGG - Intergenic
1178013777 21:28318389-28318411 CTATTCCAAATGGGAGAAATTGG - Intergenic
1179753725 21:43482671-43482693 CTATTTCTCAGGCGGGAAATGGG + Intergenic
1182860578 22:33556098-33556120 GCATTGCTAGTGAGGGAAGTTGG - Intronic
1184263692 22:43334704-43334726 CTATTGATGATGAGGGTGATGGG - Intronic
949261338 3:2105944-2105966 CTATTCCAAATGGGAGAAATTGG + Intronic
949635891 3:5981220-5981242 CTATTCCAAATGGGAGAAATTGG + Intergenic
951362781 3:21744353-21744375 ATTTTGCTGATGAGGGAAAGTGG - Intronic
951427008 3:22558281-22558303 GTTTTGCTAATGTAGGAAATAGG + Intergenic
954272422 3:49520217-49520239 CTTCTGCTAATGAGGAACATGGG - Intronic
955435399 3:58894375-58894397 CTATTCCAAATGAGAGAAATTGG + Intronic
955586192 3:60480582-60480604 CCATTACAAATGAGAGAAATTGG + Intronic
957012854 3:75027989-75028011 CTGTTGCTAATGGAAGAAATTGG + Intergenic
957148642 3:76457279-76457301 CCATTCCAAATGAGAGAAATTGG + Intronic
957412884 3:79862918-79862940 CTGTTCCAAATGAGAGAAATTGG - Intergenic
957630437 3:82710750-82710772 CTATTCCAAATGGGAGAAATTGG + Intergenic
957648821 3:82971751-82971773 CATTTGCTAATGTGGAAAATAGG - Intergenic
957648837 3:82971877-82971899 CATTTGCTAATGTGGAAAATAGG + Intergenic
958637541 3:96763964-96763986 CTATTCCAAATGGGAGAAATTGG - Intergenic
958638989 3:96780288-96780310 CCATTCCAAATGAGAGAAATTGG - Intergenic
958861096 3:99446051-99446073 CTATTCCGAATGGGAGAAATTGG - Intergenic
959031751 3:101307956-101307978 CTGTTGCAAATGGGAGAAATTGG + Intronic
959202858 3:103271089-103271111 CCATTCCTAATGGGAGAAATGGG + Intergenic
960386445 3:117026807-117026829 GGAATGCTAATGAGGAAAATGGG + Intronic
960636216 3:119787347-119787369 CTTTTGCAAATGAGGAAACTGGG - Intronic
960765153 3:121119318-121119340 GTATTGCAAATGAGTTAAATAGG - Intronic
962229677 3:133651490-133651512 TTATTGTTAAGAAGGGAAATTGG - Intronic
962406492 3:135105021-135105043 ATTTTGCTAATGAGGAAACTGGG - Intronic
963022597 3:140886513-140886535 CCATTCCAAATGAGAGAAATTGG - Intergenic
963604633 3:147404185-147404207 CTTTTGCTTCTGGGGGAAATGGG + Exonic
964150435 3:153518220-153518242 CCATTACAAATGAGAGAAATTGG + Intergenic
964895454 3:161590300-161590322 CCATTCCAAATGGGGGAAATTGG + Intergenic
964897279 3:161613327-161613349 CTATTCCAAATGGGAGAAATTGG - Intergenic
965057724 3:163743944-163743966 CCATTTCAAATGAGAGAAATTGG + Intergenic
965198547 3:165628853-165628875 CTATTCCAAATGGGAGAAATTGG + Intergenic
966226044 3:177599181-177599203 CTATGGCTATTGTGGGAAATAGG + Intergenic
967793075 3:193569880-193569902 ATATTAACAATGAGGGAAATCGG + Intronic
968265644 3:197360936-197360958 CCATTCCAAATGAGAGAAATTGG - Intergenic
970441742 4:16085987-16086009 CTATTTCCTCTGAGGGAAATTGG - Intergenic
970481055 4:16475348-16475370 CTATAGCTAATGAGCGAAGAAGG + Intergenic
970707007 4:18816351-18816373 CTATTCCAAAAGAGAGAAATTGG - Intergenic
970844228 4:20516898-20516920 CTATTGTTAATGAGACAAAGTGG - Intronic
971739702 4:30503780-30503802 CCATTCCTAATGGGAGAAATTGG - Intergenic
971943527 4:33245510-33245532 CTGTTCCAAATGAGAGAAATTGG + Intergenic
972137436 4:35909097-35909119 CCATTCCTAATGGGAGAAATTGG - Intergenic
972879584 4:43407228-43407250 CAATTACAAATGAGAGAAATTGG - Intergenic
973015665 4:45134455-45134477 CCATTCCAAATGAGAGAAATTGG + Intergenic
974145194 4:57937704-57937726 CCATTCCAAATGAGAGAAATTGG - Intergenic
974171435 4:58271229-58271251 CCATTCCAAATGAGGGAAATTGG - Intergenic
974480606 4:62438129-62438151 CTATTCCAAATGGGAGAAATTGG + Intergenic
974492728 4:62588215-62588237 CTATTCCAAATGGGAGAAATTGG + Intergenic
975274869 4:72484918-72484940 ATATTTATAATGTGGGAAATAGG - Intronic
976259803 4:83135047-83135069 CCATTGCAAATGGGAGAAATTGG + Intronic
976444885 4:85118532-85118554 CCATTCCAAATGGGGGAAATTGG - Intergenic
976952551 4:90850628-90850650 CCATTCCAAATGAGAGAAATTGG - Intronic
977046483 4:92073828-92073850 CTATTGGTTATGATGTAAATTGG + Intergenic
978034565 4:103977046-103977068 CTATTCCAAATGGGAGAAATTGG - Intergenic
978276671 4:106958936-106958958 CTATTAGGAATGAGGGCAATTGG - Intronic
978612697 4:110561228-110561250 CTATTGCTAATCTGAGAGATGGG + Intronic
978774269 4:112490325-112490347 CCATTCCAAATGAGAGAAATTGG + Intergenic
979063628 4:116098856-116098878 CTGTTCCAAATGAGAGAAATTGG - Intergenic
980293168 4:130871072-130871094 CTATTCCAAATGGGAGAAATTGG - Intergenic
980368684 4:131839223-131839245 CCATTGCAAATGGGAGAAATTGG - Intergenic
980596607 4:134962850-134962872 CCATTCCAAATGAGAGAAATTGG - Intergenic
980727928 4:136788399-136788421 TTATTGCAAATGGGAGAAATTGG - Intergenic
981407129 4:144385051-144385073 CTATTCCAAATGGGAGAAATTGG + Intergenic
981611365 4:146597196-146597218 CCATTCCAAATGGGGGAAATTGG + Intergenic
981872998 4:149508556-149508578 CCATTGCAAATGGGAGAAATTGG - Intergenic
982433341 4:155349642-155349664 CTATTTCTAATAAGGCAAAGAGG + Intronic
982597329 4:157403608-157403630 CTATTCCAAATGGGAGAAATTGG + Intergenic
982746754 4:159111850-159111872 CTATTACTAATGGGAGAAACCGG - Intronic
983164650 4:164460257-164460279 CTATTCCAAATGAAAGAAATTGG - Intergenic
983236627 4:165187636-165187658 CCATTCCAAATGAGAGAAATTGG + Intronic
983863406 4:172735396-172735418 CTGTTCCAAATGAGAGAAATTGG - Intronic
984279878 4:177657809-177657831 GTATTTCTAAAGAGCGAAATAGG - Intergenic
986028056 5:3869325-3869347 GTATAGCTAATGTGGAAAATAGG + Intergenic
986081038 5:4394612-4394634 CCATTTCAAATGAGAGAAATTGG + Intergenic
986507724 5:8470267-8470289 CCATTTCAAATGAGAGAAATTGG + Intergenic
986900268 5:12422266-12422288 CCATTCCAAATGAGAGAAATTGG - Intergenic
987478988 5:18428955-18428977 CCATTCCAAATGAGAGAAATTGG - Intergenic
987499004 5:18681807-18681829 CCATTCCAAATAAGGGAAATTGG - Intergenic
987581421 5:19798296-19798318 ATATTGCCAATGAGGGGTATTGG + Intronic
987610754 5:20199431-20199453 CCATTCCAAATGAGAGAAATTGG - Intronic
987737733 5:21867619-21867641 CCATTCCAAATGAGAGAAATTGG - Intronic
988129033 5:27079435-27079457 CTGTTCCTAATGGGAGAAATTGG + Intronic
989144556 5:38235602-38235624 ATATTCCAAATGAGAGAAATAGG - Intergenic
989416858 5:41188565-41188587 ATATTGCAAATGAATGAAATTGG + Intronic
989495094 5:42102535-42102557 CCATTCCAAATGGGGGAAATTGG - Intergenic
990601259 5:57360691-57360713 ATATTACCAATGAGAGAAATTGG + Intergenic
992111230 5:73496191-73496213 CTATGGCAAATGTGGGTAATTGG - Intergenic
992279779 5:75162372-75162394 CCATTCCAAATGAGAGAAATTGG - Intronic
992311025 5:75499068-75499090 CTATTCCAAATGGGAGAAATTGG - Intronic
993215797 5:85021412-85021434 CTGTTACAAATGGGGGAAATTGG + Intergenic
993413122 5:87596138-87596160 CCATTCCAAATGGGGGAAATTGG + Intergenic
993580663 5:89656530-89656552 TTATAGCTAATGAGAGAGATAGG + Intergenic
993945992 5:94117205-94117227 CCATTCCTAATGGGAGAAATTGG - Intergenic
993967097 5:94371964-94371986 CTGTTCCAAATGAGAGAAATTGG + Intronic
994081897 5:95716464-95716486 CTATTTCAAATGGGAGAAATTGG - Intronic
995962733 5:117863136-117863158 CTATGTCTACTGAGGGAACTAGG - Intergenic
996030838 5:118702746-118702768 CTATTCCAAATGGGAGAAATTGG + Intergenic
996055105 5:118973905-118973927 GGAATGCTAATGAGGAAAATGGG + Intronic
996583066 5:125053028-125053050 TTATTACAACTGAGGGAAATGGG + Intergenic
997016149 5:129937699-129937721 CTATTCCAAATGAGAGTAATTGG + Intronic
997344530 5:133177305-133177327 CTATTGCTCTTGAGTGAGATTGG + Intergenic
998134312 5:139666666-139666688 ATTTTGCTCATGCGGGAAATGGG + Intronic
998753573 5:145351812-145351834 CCATTCCAAATGGGGGAAATTGG + Intergenic
999353418 5:150900381-150900403 CTTTGGCTCATGAGGGAAGTAGG - Intronic
1000515533 5:162233307-162233329 CTTTTCCAAATGAGAGAAATTGG - Intergenic
1000674671 5:164105936-164105958 CAATTCCAAATGAGAGAAATAGG - Intergenic
1000787982 5:165570201-165570223 CTATTCCAAATGGGAGAAATTGG + Intergenic
1001879964 5:175234745-175234767 TTATTGCTGATGAATGAAATGGG + Intergenic
1005096598 6:22123378-22123400 TTTTTGCTAATGAGGAAACTAGG + Intergenic
1005984046 6:30859501-30859523 CTATTCCAAATGGGAGAAATTGG + Intergenic
1008826896 6:55706442-55706464 CTCTTGATAATGAGTAAAATTGG + Intergenic
1009026217 6:58003452-58003474 CTATTGCCACTGAAAGAAATTGG + Intergenic
1009201769 6:60754925-60754947 CTATTGCCACTGAAAGAAATTGG + Intergenic
1009532931 6:64843582-64843604 CTATTCCAAATGGGAGAAATTGG - Intronic
1010307051 6:74337253-74337275 CTATTTCTTAGGAAGGAAATAGG + Intergenic
1010551282 6:77225102-77225124 TTATAGCTATAGAGGGAAATGGG - Intergenic
1010602247 6:77843934-77843956 CTGTTGCTAATGAGTTTAATGGG + Intronic
1010735782 6:79442669-79442691 CCATTCCAAATGAGAGAAATTGG + Intergenic
1010883016 6:81202359-81202381 CTATTCCAAATGGGAGAAATTGG - Intergenic
1011211292 6:84959068-84959090 CTATTCCAAATGGGAGAAATTGG - Intergenic
1011294008 6:85807790-85807812 CCATTCCAAATGAGAGAAATTGG + Intergenic
1011346049 6:86370560-86370582 CCATTCCAAATGGGGGAAATTGG + Intergenic
1011821289 6:91256303-91256325 CTATTTCAAATGGGAGAAATTGG - Intergenic
1011835158 6:91421966-91421988 CTATTCCAAATGAGAGAAATTGG - Intergenic
1012683288 6:102210089-102210111 CTATTCCAAATGGGAGAAATTGG - Intergenic
1013214482 6:108015148-108015170 CCATTCCAAATGAGAGAAATTGG + Intergenic
1013688165 6:112609787-112609809 CCATTTCAAATGAGAGAAATTGG - Intergenic
1013910776 6:115273148-115273170 CCATTCCAAATGAGAGAAATTGG - Intergenic
1014075534 6:117230578-117230600 CTATTGCAAAAGGGAGAAATTGG + Intergenic
1015018641 6:128444516-128444538 CTATTGCAATAGAGGGAAAGAGG - Intronic
1015045105 6:128767706-128767728 CCATTCCAAATGAGAGAAATTGG + Intergenic
1015158105 6:130120684-130120706 AAATTGATAATGAGGAAAATGGG + Intronic
1015479124 6:133688837-133688859 CCTTTACTAATGGGGGAAATGGG - Intergenic
1016632633 6:146250027-146250049 CCATTCCAAATGAGAGAAATTGG - Intronic
1016633023 6:146254073-146254095 CTTTGGCTAATTAGGAAAATAGG + Intronic
1016643596 6:146378559-146378581 CTATTCCAAATGGGAGAAATTGG - Intronic
1016649269 6:146445466-146445488 GTATTGCTAATGTGGGTCATTGG - Intergenic
1016819799 6:148336495-148336517 CTGCTGCTAAAGAGGTAAATGGG + Intronic
1016987974 6:149909345-149909367 CTGTTGCAAATGGGAGAAATTGG - Intergenic
1017291367 6:152742489-152742511 CTATTGCTCTTGAAGGAAACAGG - Intergenic
1017931403 6:158958815-158958837 CTATTTCAAAAGAGAGAAATAGG + Intergenic
1018075261 6:160206943-160206965 CCATTCCAAATGAGAGAAATTGG + Intronic
1018477637 6:164159090-164159112 CCATTCCAAATGAGAGAAATTGG + Intergenic
1018699940 6:166418513-166418535 CAATTGCTAAGGAAGGAAAACGG - Intronic
1020453610 7:8347155-8347177 CCATTCCAAATGAGAGAAATTGG - Intergenic
1020576810 7:9943466-9943488 CAATTTCTAATGGGGGAAGTGGG + Intergenic
1020754978 7:12190738-12190760 CTATTTCAAATGGGAGAAATTGG + Intergenic
1021045594 7:15919024-15919046 CTGTTAATAATAAGGGAAATGGG - Intergenic
1021573232 7:22085584-22085606 CCATTCCAAATGAGAGAAATTGG + Intergenic
1022678477 7:32522483-32522505 CCATTCCAAATGAGAGAAATTGG - Intronic
1023141383 7:37105686-37105708 GGTTTGCTAATGATGGAAATTGG - Intronic
1024207643 7:47177457-47177479 CTATTCCAAATGGGAGAAATTGG - Intergenic
1024416076 7:49108291-49108313 CTATTCCAAATGGGAGAAATTGG - Intergenic
1024487261 7:49932496-49932518 CCATTCCTAATGGGAGAAATTGG - Intronic
1024660441 7:51487859-51487881 CTATGAATAATGAGGGAAGTTGG + Intergenic
1024684851 7:51734139-51734161 CCATTCCAAATGAGAGAAATTGG + Intergenic
1024865747 7:53903833-53903855 CTATTTCAAATGGGAGAAATTGG + Intergenic
1025225820 7:57161771-57161793 CTATTTCAAATGGGAGAAATTGG + Intergenic
1027689675 7:81328108-81328130 CTACTGCTGAAGTGGGAAATGGG + Intergenic
1027714862 7:81657740-81657762 CTATAGCTCATGTGGGAATTGGG - Intergenic
1028790238 7:94845049-94845071 CTATTTCAAATGGGAGAAATTGG - Intergenic
1029047550 7:97645857-97645879 CCATTCCAAATGAGAGAAATTGG - Intergenic
1029873291 7:103719016-103719038 CTATTGCTCAAGAGAGAAAGAGG + Intronic
1029961534 7:104693156-104693178 CTATTGCAAATGAGAGAAATTGG - Intronic
1030894671 7:115043131-115043153 GTATTACTAATGGGGGAAACTGG - Intergenic
1031298766 7:120038740-120038762 CCATTCCAAATGAGAGAAATTGG + Intergenic
1031508368 7:122616714-122616736 CTAATACTCATCAGGGAAATTGG + Intronic
1031777425 7:125920350-125920372 CTGTAGCTAATAAGGGAACTGGG - Intergenic
1034305789 7:150043683-150043705 CTATTGGTGATGAGAGTAATGGG + Intergenic
1034623208 7:152472199-152472221 CTATTCCAAATGGGAGAAATTGG - Intergenic
1034801055 7:154056964-154056986 CTATTGGTGATGAGAGTAATGGG - Intronic
1034885135 7:154793521-154793543 CTCTAGCTAATTAGGGAAATTGG - Intronic
1036385599 8:8277201-8277223 CAATTGCTAAAGAGGTACATTGG + Intergenic
1036461742 8:8959723-8959745 CCATTCCAAATGGGGGAAATTGG + Intergenic
1036583781 8:10104056-10104078 CTATTGCTAATGTGGGTATGAGG + Intronic
1037640601 8:20738669-20738691 CTATTCCTATTGTGGGAATTTGG - Intergenic
1038139120 8:24823049-24823071 CCATTCCAAATGAGAGAAATTGG - Intergenic
1040749291 8:50686363-50686385 ATTTATCTAATGAGGGAAATAGG - Intronic
1041894539 8:62908209-62908231 CTATTGCAAATGGGAGAAACTGG - Intronic
1042432716 8:68727169-68727191 CTATTCCAAATGAGAGAAATTGG + Intronic
1042725048 8:71865474-71865496 CTATTGATAGTGAGGGAAAAAGG - Intronic
1042827256 8:72991640-72991662 CTATTGTAAATGGGAGAAATTGG - Intergenic
1043030820 8:75131309-75131331 CTGTTCCAAATGAGAGAAATTGG - Intergenic
1043265949 8:78267497-78267519 CCATTCCAAATGTGGGAAATTGG - Intergenic
1043623848 8:82230237-82230259 CTATTTCAAATGGGAGAAATTGG - Intergenic
1044126984 8:88471385-88471407 CTATTTCAAATGAAAGAAATTGG + Intergenic
1045700705 8:104862983-104863005 CAATTCCAAATGAGAGAAATTGG - Intronic
1046004040 8:108458004-108458026 CCATTCCAAATGGGGGAAATTGG + Intronic
1046232376 8:111374174-111374196 CCATTCCAAATGAGAGAAATTGG - Intergenic
1046243682 8:111531673-111531695 CCATTCCAAATGGGGGAAATTGG + Intergenic
1046302459 8:112314161-112314183 TTATTGTTAATGAGGTAGATTGG - Intronic
1047471889 8:125182511-125182533 CCATTGCTGGGGAGGGAAATTGG + Intronic
1047555470 8:125924612-125924634 CTACAGCTACTGGGGGAAATGGG - Intergenic
1047562062 8:125997683-125997705 CTAATGATAATGAGTTAAATGGG - Intergenic
1048038927 8:130706514-130706536 CCATTGCAAATGGGAGAAATTGG + Intergenic
1048046173 8:130775341-130775363 CCATTCCAAATGAGAGAAATTGG - Intergenic
1048111644 8:131474120-131474142 CCATTCCAAATGAGAGAAATTGG - Intergenic
1048668277 8:136689072-136689094 CCATTTCAAATGAGAGAAATTGG + Intergenic
1049085676 8:140476962-140476984 CTATTCCAAATGGGAGAAATTGG + Intergenic
1050472924 9:6010858-6010880 TTATTACTAATGGGGGAAAAAGG - Intergenic
1051267618 9:15323839-15323861 CTATTTCAAATGGGAGAAATTGG - Intergenic
1051923526 9:22296220-22296242 TTAGAGCTAATGAGAGAAATAGG - Intergenic
1052046179 9:23796902-23796924 CTATTTGGAATGAGGAAAATGGG - Intronic
1052120814 9:24714247-24714269 CTGTTACAAATGAGAGAAATAGG + Intergenic
1052250362 9:26390637-26390659 CCATTCCTAATGGGAGAAATTGG - Intergenic
1052540985 9:29811140-29811162 CTCTTCCTAATGGGAGAAATTGG - Intergenic
1052734343 9:32324940-32324962 CAATTGGAAATGAAGGAAATTGG - Intergenic
1052789057 9:32857152-32857174 CTATTGTTTATAAGAGAAATAGG - Intergenic
1053616313 9:39770109-39770131 CCATTCCAAATGAGAGAAATTGG + Intergenic
1053633050 9:39964947-39964969 CCATTGCAAATGGGAGAAATTGG - Intergenic
1053772701 9:41498586-41498608 CCATTGCAAATGGGAGAAATTGG + Intergenic
1053874480 9:42529416-42529438 CCATTCCAAATGAGAGAAATTGG + Intergenic
1053898136 9:42765171-42765193 CCATTCCAAATGAGAGAAATTGG - Intergenic
1054210838 9:62285750-62285772 CCATTGCAAATGGGAGAAATTGG + Intergenic
1054237204 9:62572280-62572302 CCATTCCAAATGAGAGAAATTGG - Intergenic
1054267855 9:62937339-62937361 CCATTCCAAATGAGAGAAATTGG - Intergenic
1054551340 9:66606791-66606813 CCATTCCAAATGAGAGAAATTGG - Intergenic
1056742902 9:89275562-89275584 TTATTCCAAATGAGAGAAATTGG + Intergenic
1057357988 9:94347432-94347454 GGAATGCTAATGAGGAAAATGGG - Intergenic
1057461388 9:95265865-95265887 TTATGGCTAATGAGGAAATTGGG + Intronic
1057533678 9:95876975-95876997 CTCTTGGTATTTAGGGAAATTGG + Intronic
1057649761 9:96910185-96910207 GGAATGCTAATGAGGAAAATGGG + Intronic
1058141124 9:101357756-101357778 CTATTCCAAATGGGAGAAATTGG + Intergenic
1059979265 9:119751752-119751774 CTATTGATAATTTGGGAAAGTGG + Intergenic
1059986374 9:119824150-119824172 CTATTCCAAATGGGAGAAATTGG - Intergenic
1060312039 9:122470893-122470915 CCATTCCAAATGGGGGAAATTGG - Intergenic
1185852167 X:3499453-3499475 ATATTGATAATGGGGGAAGTTGG - Intergenic
1186028821 X:5345057-5345079 CTATAACCAATGAGGGACATGGG + Intergenic
1186728766 X:12385248-12385270 CTATTGGTTATCAGTGAAATTGG + Intronic
1186992534 X:15085035-15085057 CCATTCCAAATGTGGGAAATTGG - Intergenic
1187391260 X:18887864-18887886 TTGTGGCTAATGAGGGAAAGGGG + Intergenic
1187461179 X:19488520-19488542 CAATTGCTCATGAAGGAATTCGG + Intronic
1187467303 X:19538885-19538907 CTATTGAAAATAAAGGAAATAGG - Intronic
1187555269 X:20345123-20345145 CCATTCCAAATGAGAGAAATTGG - Intergenic
1187585573 X:20657694-20657716 GTACTGTTAATCAGGGAAATTGG + Intergenic
1188162425 X:26819964-26819986 CTATTCCAACTGTGGGAAATTGG - Intergenic
1188794133 X:34441591-34441613 CCATTCCAAATGGGGGAAATTGG + Intergenic
1188873051 X:35398052-35398074 CTATTCCAAATGGGAGAAATTGG + Intergenic
1188934155 X:36153221-36153243 CTATTCCAAATGGGGGAAATAGG + Intergenic
1188961810 X:36501938-36501960 CCATTCCAAATGGGGGAAATTGG + Intergenic
1189253654 X:39620801-39620823 CCATTGCAAATGGGAGAAATTGG + Intergenic
1189286610 X:39856119-39856141 TTACTGCTAATGATGGTAATGGG + Intergenic
1191603727 X:63039679-63039701 CCATTCCAAATGAGAGAAATTGG - Intergenic
1191887035 X:65899339-65899361 CTGTTCCTAATGAGAGAAACTGG + Intergenic
1193230697 X:79041946-79041968 CCATTCCAAATGAGAGAAATTGG + Intergenic
1193421761 X:81291774-81291796 CTATTACAAAAGGGGGAAATTGG + Intronic
1193449264 X:81645820-81645842 CTATTCCAAATGGGAGAAATTGG - Intergenic
1193561685 X:83025222-83025244 TTATTGCTAAAGAGAGAGATAGG + Intergenic
1194054621 X:89116747-89116769 CTATTCCAAATGGGAGAAATTGG + Intergenic
1194256997 X:91646634-91646656 CTATTCCAAATGGGAGAAATTGG - Intergenic
1194756389 X:97743851-97743873 CCATTCCAAATGAGAGAAATTGG - Intergenic
1195522684 X:105849637-105849659 CTGTTGCAAATGGGAGAAATTGG + Intronic
1195608269 X:106834692-106834714 CTATTCCAAATGGGAGAAATTGG + Intronic
1197023387 X:121717632-121717654 CCATTCCAAATGGGGGAAATTGG + Intergenic
1197464362 X:126784636-126784658 CTATTTCAAATGAGAGAAATTGG - Intergenic
1198297446 X:135301539-135301561 CCATTCCTAATGGGAGAAATTGG + Intronic
1198441257 X:136665458-136665480 GACTAGCTAATGAGGGAAATGGG + Intergenic
1198804048 X:140475885-140475907 CCATTCCAAATGGGGGAAATTGG - Intergenic
1198836014 X:140805635-140805657 CTATTCCAAATGGGAGAAATTGG + Intergenic
1198872908 X:141194373-141194395 CCATTACAAATGAGAGAAATTGG - Intergenic
1199291025 X:146105396-146105418 CCATTGCAAATGGGAGAAATTGG + Intergenic
1199317852 X:146401099-146401121 CTATTCCCAATGGGAGAAATTGG - Intergenic
1199350599 X:146795496-146795518 CCATTGCAAATGGGAGAAATTGG - Intergenic
1199515173 X:148668058-148668080 CTATTCCAAATGGGAGAAATTGG + Intronic
1199569294 X:149251891-149251913 CCATTCCAAATGAGAGAAATTGG + Intergenic
1200270803 X:154680951-154680973 CCACTGCAAATGAGTGAAATAGG - Intronic
1200342183 X:155409289-155409311 CTATTCCCAATGGGAGAAATTGG - Intergenic
1200355315 X:155543819-155543841 CAATAGCTACTGAGGTAAATAGG + Intronic
1200575715 Y:4885900-4885922 CTATTCCAAATGGGAGAAATTGG - Intergenic
1200641247 Y:5720043-5720065 CTATTCCAAATGGGAGAAATTGG - Intronic
1201927959 Y:19310801-19310823 CTATTTCAAATGAAAGAAATTGG + Intergenic