ID: 1092927697

View in Genome Browser
Species Human (GRCh38)
Location 12:13287126-13287148
Sequence CCTGGACACCAAAGCTCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092927686_1092927697 4 Left 1092927686 12:13287099-13287121 CCCACAGAAGGAAGCCCCCATAA No data
Right 1092927697 12:13287126-13287148 CCTGGACACCAAAGCTCGGGTGG No data
1092927689_1092927697 -10 Left 1092927689 12:13287113-13287135 CCCCCATAAAAACCCTGGACACC No data
Right 1092927697 12:13287126-13287148 CCTGGACACCAAAGCTCGGGTGG No data
1092927687_1092927697 3 Left 1092927687 12:13287100-13287122 CCACAGAAGGAAGCCCCCATAAA No data
Right 1092927697 12:13287126-13287148 CCTGGACACCAAAGCTCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092927697 Original CRISPR CCTGGACACCAAAGCTCGGG TGG Intergenic
No off target data available for this crispr