ID: 1092929041

View in Genome Browser
Species Human (GRCh38)
Location 12:13298003-13298025
Sequence ATCCCCAAAGGGGGCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092929031_1092929041 22 Left 1092929031 12:13297958-13297980 CCAGATGCAAAGATGGAGACACA No data
Right 1092929041 12:13298003-13298025 ATCCCCAAAGGGGGCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092929041 Original CRISPR ATCCCCAAAGGGGGCTTGAG AGG Intergenic
No off target data available for this crispr