ID: 1092930516

View in Genome Browser
Species Human (GRCh38)
Location 12:13311265-13311287
Sequence ATTTATAAGCAATAGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092930516_1092930520 24 Left 1092930516 12:13311265-13311287 CCTGCCCTCTATTGCTTATAAAT No data
Right 1092930520 12:13311312-13311334 GCCACACTCAGAGACTGAGGAGG No data
1092930516_1092930519 21 Left 1092930516 12:13311265-13311287 CCTGCCCTCTATTGCTTATAAAT No data
Right 1092930519 12:13311309-13311331 TGTGCCACACTCAGAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092930516 Original CRISPR ATTTATAAGCAATAGAGGGC AGG (reversed) Intergenic
No off target data available for this crispr