ID: 1092931927

View in Genome Browser
Species Human (GRCh38)
Location 12:13324077-13324099
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092931927_1092931935 12 Left 1092931927 12:13324077-13324099 CCCTCCTCCTCATAAATACCCTG No data
Right 1092931935 12:13324112-13324134 GCCTGATGTTCTCTCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092931927 Original CRISPR CAGGGTATTTATGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr