ID: 1092935017

View in Genome Browser
Species Human (GRCh38)
Location 12:13353062-13353084
Sequence GTAGTTCTACTAGCAAGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092935017_1092935021 7 Left 1092935017 12:13353062-13353084 CCGGTCCTTGCTAGTAGAACTAC No data
Right 1092935021 12:13353092-13353114 GGCCTATGCCATCTAGAACTTGG No data
1092935017_1092935022 8 Left 1092935017 12:13353062-13353084 CCGGTCCTTGCTAGTAGAACTAC No data
Right 1092935022 12:13353093-13353115 GCCTATGCCATCTAGAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092935017 Original CRISPR GTAGTTCTACTAGCAAGGAC CGG (reversed) Intergenic
No off target data available for this crispr