ID: 1092936239

View in Genome Browser
Species Human (GRCh38)
Location 12:13366900-13366922
Sequence CAGGGTATCCATAGATTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092936231_1092936239 20 Left 1092936231 12:13366857-13366879 CCTGACCGTAGAGGCCACCACAA 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1092936239 12:13366900-13366922 CAGGGTATCCATAGATTTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1092936234_1092936239 3 Left 1092936234 12:13366874-13366896 CCACAACAGTGCACGCCCAGATC 0: 1
1: 1
2: 1
3: 3
4: 54
Right 1092936239 12:13366900-13366922 CAGGGTATCCATAGATTTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1092936233_1092936239 6 Left 1092936233 12:13366871-13366893 CCACCACAACAGTGCACGCCCAG 0: 1
1: 1
2: 1
3: 11
4: 143
Right 1092936239 12:13366900-13366922 CAGGGTATCCATAGATTTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1092936232_1092936239 15 Left 1092936232 12:13366862-13366884 CCGTAGAGGCCACCACAACAGTG 0: 1
1: 0
2: 3
3: 12
4: 120
Right 1092936239 12:13366900-13366922 CAGGGTATCCATAGATTTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1092936230_1092936239 23 Left 1092936230 12:13366854-13366876 CCTCCTGACCGTAGAGGCCACCA 0: 1
1: 0
2: 1
3: 4
4: 81
Right 1092936239 12:13366900-13366922 CAGGGTATCCATAGATTTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092936239 Original CRISPR CAGGGTATCCATAGATTTGC TGG Intergenic
902123604 1:14189466-14189488 CAGGCAATCCATAGACTTACAGG - Intergenic
904706173 1:32392696-32392718 CAGGGCATTCTCAGATTTGCTGG + Intronic
906289881 1:44612962-44612984 CAGAGCATCCATGGATATGCAGG + Intronic
906289894 1:44613038-44613060 CAGAGCATCCATGGATATGCAGG + Intronic
906289908 1:44613114-44613136 CAGAGCATCCATGGATATGCAGG + Intronic
906289921 1:44613190-44613212 CAGAGCATCCATGGATATGCAGG + Intronic
906289934 1:44613266-44613288 CAGAGCATCCATGGATATGCAGG + Intronic
906289950 1:44613342-44613364 CAGAGCATCCATGGATATGCAGG + Intronic
908811024 1:67982422-67982444 CAGGGTATCCAATGACTTTCAGG - Intergenic
919811447 1:201411395-201411417 CAAGGTGTCCATGGATCTGCGGG - Exonic
921532218 1:216298603-216298625 CAGGTTATCCATATATCTGCAGG - Intronic
923471918 1:234298929-234298951 GAGGGCAGCCATACATTTGCTGG + Intronic
1069151645 10:64968419-64968441 CAGAGCATCCATATCTTTGCAGG + Intergenic
1070533970 10:77361665-77361687 GAGGGGATCCATAGGTCTGCTGG + Intronic
1073001164 10:100287041-100287063 CAGGGAATCCAAAGTTTTACAGG + Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1092936239 12:13366900-13366922 CAGGGTATCCATAGATTTGCTGG + Intergenic
1096354649 12:50930120-50930142 CAGCATATCCATAGATATGAGGG - Exonic
1096565737 12:52476948-52476970 CAAGGAATCCAAAGATTTGATGG - Intergenic
1099052286 12:77794654-77794676 AATGGCACCCATAGATTTGCTGG - Intergenic
1099865823 12:88279441-88279463 CAGGGGATCCATTCATTTGTTGG - Intergenic
1104721802 12:131048558-131048580 CCGGGGCTCCATGGATTTGCGGG + Intronic
1111642735 13:90990904-90990926 CAGGTTTTCCTTAGATTTGAGGG - Intergenic
1120463786 14:84829875-84829897 CAAAGTGTTCATAGATTTGCAGG - Intergenic
1128229556 15:66025173-66025195 CAGGTTTTGCATAGACTTGCTGG - Intronic
1133313184 16:4864523-4864545 CAGGGAATCCAGTGATTTGATGG + Intronic
1136168978 16:28476628-28476650 CAGTGAATACATAGATTTGATGG + Intergenic
1152079569 17:78178314-78178336 CAGGTTTTCCAGAGATTTCCAGG + Intronic
1152278570 17:79372258-79372280 CAGGGGAGCCATAGGATTGCCGG - Intronic
1161849916 19:6732906-6732928 CAGGGTCTGCAGAGATTTGGGGG + Intronic
926133720 2:10322104-10322126 CATGTAATCCATAGAGTTGCAGG - Intronic
926163974 2:10506644-10506666 CAGGGGATCCATGGCATTGCTGG + Intergenic
926211838 2:10877035-10877057 CAGGGTCTCACTAGATTTCCCGG + Intergenic
926870919 2:17416052-17416074 CAGGGTAACCAAAGAGTTACAGG + Intergenic
927627591 2:24738756-24738778 CAGGATATTAATAGATGTGCTGG - Intronic
936887805 2:117334024-117334046 CAGTGTATCCATTGATCTGTTGG - Intergenic
939233333 2:139459372-139459394 GAGGTTTTCCAGAGATTTGCTGG + Intergenic
941575322 2:167222721-167222743 AAGGGTATCTCTAGATATGCTGG + Intronic
941843112 2:170108767-170108789 CTGGGTATCGAGAGATCTGCAGG + Intergenic
945121084 2:206458027-206458049 CAGTGTAGCCATTTATTTGCAGG + Intronic
1170827428 20:19808811-19808833 CAGGGTATCCCTAGGGTCGCTGG - Intergenic
950568435 3:13785654-13785676 CAGGATCTCCAGAGTTTTGCCGG + Intergenic
953317865 3:41945252-41945274 CAAGGCATCCATCCATTTGCCGG - Intronic
958159382 3:89797788-89797810 CAGGGCATCTAGAGATTTCCAGG - Intergenic
959579770 3:107971413-107971435 CAAGGTGTGCATACATTTGCTGG + Intergenic
961384746 3:126517182-126517204 CACGTTCTCCAGAGATTTGCGGG + Intronic
962842081 3:139243232-139243254 CAGGGTGTCCATAGATTCAGTGG + Intronic
973530348 4:51831469-51831491 CCCGGTTTCAATAGATTTGCTGG + Intergenic
974169416 4:58246412-58246434 CATGGTATCCATCGACTTCCTGG - Intergenic
977452745 4:97219831-97219853 CAGGGTATCAAAAGATTTGATGG - Intronic
978033733 4:103969673-103969695 CAGGGTGCCCATAGAACTGCTGG + Intergenic
979181614 4:117735855-117735877 AAGGGCATACATAGATTTGAAGG + Intergenic
984072114 4:175128186-175128208 CATGGTATCCACAGATTGGGAGG + Intergenic
989426212 5:41299093-41299115 CAGGGTATGCAAGGATTTGGAGG - Intergenic
1002018124 5:176342274-176342296 CAGGGTATCTATAGACTTAGAGG - Intronic
1002297202 5:178238318-178238340 CAGGGACTCCAGAGTTTTGCGGG + Exonic
1006175003 6:32116376-32116398 CAGGGCATCCAGAGAGCTGCTGG - Intronic
1014830381 6:126096204-126096226 CAGTGGATCCATAGAATTCCTGG + Intergenic
1022376817 7:29821482-29821504 CAGGGTCTCCCTATATTTCCAGG + Intronic
1023627076 7:42126774-42126796 CATGGTAGCTATAGAATTGCTGG - Intronic
1027193439 7:76011701-76011723 CAGACTATGCAGAGATTTGCAGG - Intronic
1035959555 8:4122270-4122292 CTGGTTATTTATAGATTTGCTGG + Intronic
1039461505 8:37749405-37749427 CAGGGGATCTTTAGATTTGTGGG + Intronic
1041048532 8:53910198-53910220 CAGGGCATCTATACTTTTGCTGG - Intronic
1049495730 8:142931350-142931372 CAGGGCATCCGTGGATTAGCCGG + Intergenic
1050020254 9:1276548-1276570 CAGGGCTTCCAAAGACTTGCTGG - Intergenic
1056309063 9:85321378-85321400 CAGGGTATCCATAGGGTCGCTGG - Intergenic
1056899393 9:90584012-90584034 CAGGGTATCCACAGGGTCGCTGG - Intergenic
1187670578 X:21662115-21662137 CAGGGTCTCAATAGATATTCTGG - Intergenic
1195007620 X:100701708-100701730 CAGGATATGCATAGATTGGATGG + Intronic
1196676919 X:118429651-118429673 CAGGGCATTCATTGAATTGCTGG + Intronic
1199561453 X:149167983-149168005 CATGGTGTCCATACATTTCCTGG - Intergenic